Next Article in Journal
Detection and Tracking of Mesh Intersection Points for Autonomous Net Cleaning Robots
Previous Article in Journal
Seminal Quality Variation in Chirostoma humboldtianum During an Annual Cycle and Cryopreservation Effect
Previous Article in Special Issue
Utilization of Plant-Derived Essential Oils as Natural Alternatives for Controlling Fish Pathogens: A Critical Review of Their Use Against Aeromonas hydrophila
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 11
Issue 4
10.3390/fishes11040214
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Report of Elizabethkingia miricola Isolated from Low-Salinity-Cultured River Puffer (Takifugu obscurus) in South Korea

by
Ki-Taek Cho
1,
Dong-Hoon Lee
1,
Beom-Hee Lee
2 and
Bo-Seong Kim
2,*
1
Gyeonggi Province Maritime & Fisheries Research Institute, Yangpyeong 12513, Republic of Korea
2
Department of Aquatic Life Medicine, Kunsan National University, Gunsan 54150, Republic of Korea
*
Author to whom correspondence should be addressed.
Fishes 2026, 11(4), 214; https://doi.org/10.3390/fishes11040214
Submission received: 4 March 2026 / Revised: 30 March 2026 / Accepted: 31 March 2026 / Published: 2 April 2026
(This article belongs to the Special Issue Microbial Pathogens, Disease Control and Veterinary Drug Use in Aquaculture)
Browse Figures
Versions Notes

Abstract

This study reports the first isolation of Elizabethkingia miricola from cultured river puffer (Takifugu obscurus) in South Korea under low-salinity aquaculture conditions. A total of 5000 juvenile T. obscurus were reared for 20 months in a recirculating aquaculture system with salinity maintained at 3–5 ppt. During the rearing period, fish exhibited a cumulative mortality rate of 58.17%, presenting clinical signs such as lethargy, fin rot, hepatic hemorrhage, and white nodules in the spleen and kidney. Biochemical and molecular analyses identified E. miricola in the internal organs of diseased fish. All isolates exhibited multidrug resistance and showed 98.8–99.8% 16S rRNA gene sequence similarity to E. miricola, forming a distinct phylogenetic cluster. Additionally, several virulence-associated genes (fabG, fabV, wecB, ureB, aceA, acyl) were detected in the isolates. Histopathological examination revealed granulomatous lesions in multiple organs, including the gill, heart, kidney, and spleen. This study represents the first report of E. miricola isolated from cultured river puffer in South Korea and suggests its potential association with disease in this species, as well as its possible zoonotic relevance. These findings highlight the importance of disease monitoring and pathogen surveillance in low-salinity aquaculture systems.
Keywords:
Elizabethkingia miricola; river puffer (Takifugu obscurus); low-salinity aquaculture; granulomatous lesions; zoonotic pathogen; antibiotic resistance
Key Contribution: This study provides the first confirmed isolation and characterization of Elizabethkingia miricola from cultured river puffer (Takifugu obscurus) in South Korea under low-salinity aquaculture conditions. The isolates exhibited multidrug resistance, harbored virulence-associated genes, and were associated with granulomatous lesions in multiple organs. These findings suggest that E. miricola may act as a potential opportunistic pathogen in low-salinity aquaculture systems and highlight the need for enhanced disease surveillance.

1. Introduction

Takifugu obscurus (River Puffer) is a species belonging to the family Tetraodontidae and is considered a commercially valuable aquaculture species in East Asia, particularly in Korea and China, due to its high market price and strong consumer demand [1,2]. In Korea, the production of river puffer has recently increased to approximately 70 tons, highlighting its growing importance as a high-value species with significant economic potential in inland aquaculture [3]. T. obscurus is an anadromous species [4] that migrates upstream during its spawning season from April to June in South Korea. As a euryhaline species, T. obscurus exhibits rapid growth and can tolerate a wide range of salinity conditions in both freshwater and seawater environments [5,6].
In aquaculture, infectious diseases are one of the major constraints on sustainable production, causing direct losses through mortality and reduced growth, as well as indirect losses through increased treatment costs, biosecurity expenses, and trade restrictions [7,8]. Such risks are often amplified in intensive farming systems, where high stocking densities and environmental stress can facilitate rapid pathogen transmission and disease outbreaks [7]. In river puffer aquaculture, bacterial pathogens such as Lactococcus spp. have been reported to cause disease outbreaks associated with high mortality and economic losses [9].
Low-salinity aquaculture systems, including freshwater recirculating aquaculture systems (RAS), have gained attention as alternative management strategies that may help reduce certain disease risks in marine species [10]. Marine-cultured pufferfish, such as T. rubripes, are known to be susceptible to bacterial diseases, including infections caused by Vibrio harveyi [11]. Therefore, low-salinity or freshwater-based aquaculture strategies could be explored to improve disease management in pufferfish farming systems. However, although low-salinity aquaculture may reduce certain marine pathogens, its effects on susceptibility to opportunistic bacteria remain unclear, particularly in river puffer.
Elizabethkingia spp. are widely distributed in diverse environments, including eutrophic lakes, soils, and freshwater ecosystems [12]. These bacteria are aerobic, Gram-negative opportunistic pathogens that have been reported in a range of hosts, including humans, animals, amphibians, and fish [13,14,15,16,17]. In addition, Elizabethkingia spp. are increasingly recognized as emerging opportunistic human pathogens with intrinsic resistance to multiple antimicrobial agents, raising concerns regarding their zoonotic potential and public health implications [13,18]. In aquaculture systems, members of the genus Elizabethkingia have been identified in the gill, gut, and mucosal skin of cultured hybrid groupers [19], and infections caused by Elizabethkingia meningoseptica have been reported in farmed koi carp presenting skin lesions and hemorrhagic septicemia [12]. Furthermore, these pathogens have also been reported in other farmed fish species such as tilapia and catfish [12,17]. Elizabethkingia spp. are known to exhibit broad antibiotic resistance [20], which may complicate treatment strategies in aquaculture systems.
However, there have been no reports of Elizabethkingia spp. in farmed aquatic species in Korea. This study investigated a disease outbreak in T. obscurus cultured under low-salinity conditions, with the aim of identifying and characterizing the associated bacterial pathogen. During this investigation, a mortality event accompanied by clinical signs was observed, and Elizabethkingia miricola was isolated from the internal organs of diseased fish. This study represents the first report of E. miricola in farmed T. obscurus in Korea and provides baseline information for understanding potential bacterial infections in low-salinity pufferfish aquaculture systems.

2. Materials and Methods

2.1. Case History

In this experiment, 5000 juvenile river puffer (Takifugu obscurus), each weighing 5–10 g, were obtained from an aquaculture farm in Gyeonggi-do, South Korea, and cultured for 20 months (from October 2022 to June 2024). The fish were reared in two circular tanks (diameter: 5 m; depth: 1 m; water volume: approximately 20 tons), and were fed an extruded pellet (EP) diet containing 58% crude protein, 8% crude fat, and 13% crude ash, supplied using a belt-type automatic feeder. The feed was provided continuously for 12 h per day at a rate of 1–2% of body weight. To maintain stable water quality throughout the experiment, 10% of the total rearing water was replaced daily. Additionally, to control pH reduction due to feed EP, sodium bicarbonate (Samchun Ltd., Pyeongtaek, Republic of Korea) was added at a rate of 80–180 g per day to maintain the pH within the range of 6.8–7.2. Salinity was maintained at 3–5 ppt using solar salt imported from China (Shandong Feicheng Refined Salt Plant, Co., Ltd., Feicheng, China). The concentrations of total ammonia nitrogen (TAN), NO2-N, and NO3-N ranged from 0.17 to 1.12 mg/L, 0.032 to 0.218 mg/L, and 14.2 to 36.9 mg/L, respectively.

2.2. Bacterial Isolation and Biochemical Identification

To assess the presence of bacterial infections, bacteria were isolated and cultured from the internal organs of T. obscurus reared between 2022 and 2024. Sampling was conducted twice annually in 2023 and 2024, with six individuals examined per sampling event (total n = 24). Both asymptomatic (control) and moribund fish were included in the sampling, depending on their availability at the time of collection. The fish were euthanized, and liver, kidney, and spleen tissues were aseptically collected using sterile instruments. Tissue samples from each individual fish were processed separately and streaked onto tryptic soy agar (TSA) plates, followed by incubation at 25 °C for 24–48 h under aerobic conditions. Single colonies were selected and subcultured in tryptic soy broth (TSB) for further experiments. All bacterial strains were incubated at 25 °C and preserved in glycerol stocks (20%, v/v) at −80 °C. The GENIII MicroPlate system (Biolog, Hayward, CA, USA) was used for the biochemical identification of the isolates. Molecular identification of the isolates based on 16S rRNA gene sequencing was performed as described in Section 2.4.

2.3. Antibiotic Susceptibility Tests

To evaluate the antibiotic susceptibility and resistance of the bacterial isolates, Minimum Inhibitory Concentration (MIC) assays were performed using a MIC panel manufactured by Thermo Fisher Scientific (Waltham, MA, USA). The experimental procedures were conducted with slight modifications to the manufacturer’s instructions. Among various antibiotics, eight commonly used in aquaculture were selected for testing: oxytetracycline (OTC), ampicillin (AMP), neomycin (NEO), gentamycin (GEN), trimethoprim/sulfamethoxazole (SXT), florfenicol (FFN), clindamycin (CLI), and enrofloxacin (ENRO). The susceptibility or resistance of the isolates to these antibiotics was determined based on CLSI guidelines and relevant literature [21].

2.4. Bacterial DNA Extraction and PCR, 16S rRNA Identification

For species identification of the isolated bacteria, total DNA was extracted using the DNeasy Blood&Tissue Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The extracted total DNA samples were stored at −80 °C until analysis. End-point PCR was performed to amplify the 16S rRNA gene and various virulence genes. The template DNA was amplified using Ex Taq DNA polymerase (Takara, Kusatsu, Shiga, Japan) with primers targeting various genes, including virulence-associated genes [22] listed in Table 1 and the universal 16S rRNA primers 27F and 1492R [23]. The PCR mixture contained 1 μL of template DNA, 2 μL of 10× PCR buffer, 200 μM each dNTP, 0.5 μM of each primer, and 0.5 U of Taq DNA polymerase (Takara, Japan), with sterile distilled water added to a final volume of 20 μL. A negative control without template DNA was included in each PCR run. PCR was carried out using a MasterCycler Nexus Gradient (Eppendorf, Hamburg, Germany) under the following conditions: pre-denaturation at 94 °C for 3 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 45 s, with a final extension at 72 °C for 7 min. The amplified PCR products were confirmed by electrophoresis using 2% agarose gel containing SYBR® Safe DNA gel stain (Invitrogen, Carlsbad, CA, USA) using a 100 bp DNA ladder (Thermo Fisher Scientific, USA) as a molecular size marker.
For sequencing, the 16S rRNA PCR amplicons were purified and subjected to Sanger sequencing using the same primers (27F and 1492R) on an Applied Biosystems 3500 series sequencer (Thermo Fisher, USA). The obtained sequences were edited and aligned using BioEdit (Version 7.0.5.3), and species identification was performed by comparison with reference sequences in the NCBI database using the BLAST algorithm.

2.5. Histopathological Analysis

For histopathological examination, various internal organs—including gills, heart, liver, spleen, head kidney, gut, stomach, swim bladder, and brain—were aseptically collected from River Puffer individuals exhibiting clinical signs. The tissues were immediately fixed in 10% neutral-buffered formalin (Sigma-Aldrich, St. Louis, MO, USA) for at least 24 h. Following fixation, samples were dehydrated through a graded ethanol series, cleared in xylene, and embedded in paraffin wax. Sections of 4–5 µm thickness were prepared using a microtome and mounted on glass slides. The sections were stained with hematoxylin and eosin (H&E) for routine histological evaluation. Stained samples were examined for histopathological changes under slide scanner (MoticEasyScan One, Hong Kong, China).
To determine the sequence similarity of the 16S rRNA genes obtained from each strain, a phylogenetic tree was constructed using the MEGA program (Version 12.0.11). The analysis was performed using the Neighbor-Joining method, and evolutionary distances were calculated based on the Tamura-Nei method. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches.

3. Results

3.1. Clinical Signs of Diseased Fish

During the rearing period, river puffer (T. obscurus) was cultured in a recirculating tank system with a water temperature of 28.0 ± 1.0 °C, pH 6.8–7.2, and salinity of 3–5 ppt. Fish were continuously fed an extruded pellet diet using an automatic feeder at 1–2% of body weight per day. Based on the tank volume (~20 tons) and total biomass, the estimated stocking density was approximately 10.8 kg/m3. Daily water exchange (10%) and pH control using sodium bicarbonate were applied to maintain stable water quality.
Under these rearing conditions, diseased river puffer exhibited a daily mortality rate of approximately 0.3% without any mass mortality events over a six-month period (January to June 2023; average body weight: 86.0 g), resulting in a cumulative mortality rate of 58.17%.
Clinically, diseased fish displayed lethargy and whirling behavior. Macroscopic observation revealed caudal fin rot accompanied by hemorrhagic redness, as well as skin erosion or ulceration in the head region (Figure 1A). Internally, petechial hemorrhages and green discoloration associated with jaundice of the liver were observed (Figure 1(B1–B3)), along with distinct white nodules of varying sizes in the spleen and kidney (Figure 1(C1,C2)).

3.2. Bacterial Identification

Bacterial isolates were obtained from the internal organs of moribund river puffer, while no isolates were recovered from asymptomatic individuals. On TSA, each isolate formed a single colony (Figure 1D). The colonies exhibited a beige coloration and were characterized by a transparent zone surrounding them. Biochemical identification using the Biolog system revealed that all isolates showed 97.4–99.2% similarity to Elizabethkingia miricola (Table 2). Additionally, 16S rRNA gene sequencing confirmed that all isolates exhibited 98.8–99.8% similarity to Elizabethkingia miricola (Table 2).

3.3. Characteristics of Antibiotic Resistance

To evaluate the antibiotic resistance characteristics of the isolated strains, the minimum inhibitory concentration (MIC) was determined. All isolates exhibited resistance to four out of eight tested antibiotics (OTC, AMP, NEO, and GEN), whereas they were susceptible to three antibiotics (SXT, FFN, and ENRO) (Table 3). Notably, all isolates, except for a single strain (PFEk-5), were susceptible to CLI.

3.4. Detection of Virulence Genes

PCR analysis was performed using E. miricola-specific primers targeting five virulence-associated genes previously described by An et al. (2024) [22]. Distinct amplicons corresponding to the expected product sizes were detected in all isolates (n = 5) recovered from diseased river puffer (Table 1). The targeted genes included fabG (744 bp), fabV (1203 bp), wecB (1140 bp), ureB (369 bp), aceA (1275 bp), and acyl (240 bp). Non-specific bands were observed in a few samples; however, the target bands were distinct and consistent across all isolates. Representative PCR results are shown in Figure 2. Sequence analysis of the amplicons was not conducted; gene detection was based solely on the presence of size-appropriate bands.

3.5. Phylogenetic Analysis of Isolates

To investigate the genetic relatedness of the five strains (PFEk-1 to PFEk-5) isolated from river puffer, a phylogenetic tree was constructed based on the 16S rRNA gene sequences obtained from each strain (Figure 3). The results showed that PFEk-1 to PFEk-5 were closely related to each other and were also associated with Elizabethkingia miricola, including E. miricola strain W3-B1. However, they were genetically distant from other species within the Elizabethkingia genus, such as E. meningoseptica.

3.6. Histopathological Change in Organs from River Puffer

In the histopathological examination, inflammation characterized by macrophagic infiltration and hemorrhagic lesions associated with petechial hemorrhage was observed in the liver (Figure 4A,B). In the gill, extensive macrophagic infiltration leading to disseminated granuloma formation (Figure 4C) and phagocytosis of erythrocytes by macrophages (Figure 4D) were prominently observed in the primary lamella, whereas only mild epithelial degeneration was noted in the secondary lamella. Multiple granulomas were identified in various organs, including spleen, heart, and kidney (Figure 4E,G,H). In the kidney, necrotic debris of tubular epithelial cells was observed within the lumen of renal tubules, along with activated macrophages exhibiting cytoplasmic vacuolation and erythrophagocytosis (Figure 4I). Additionally, numerous lymphocytes were present in the submucosa of the intestine (Figure 4J).

4. Discussion

River puffer (Takifugu obscurus) is considered a high-value species in the aquaculture industry. In this study, we cultured river puffer under low-salinity conditions in an effort to address challenges related to disease control and water quality management. However, during the culture period, moderate mortality occurred, resulting in the loss of approximately half of the population. Affected individuals exhibited various external and internal clinical signs, including fin rot, reddening of the head, hepatic hemorrhages, and the presence of white nodules in the spleen and kidney (Figure 1). Low salinity is known to act as a physiological stressor in aquatic organisms, potentially compromising osmoregulation and immune function, thereby increasing susceptibility to infectious diseases [24,25]. For instance, in Pacific white shrimp (Litopenaeus vannamei), low-salinity stress has been shown to enhance susceptibility to Vibrio parahaemolyticus infection and reduce gut microbiota diversity [26]. In Takifugu fasciatus, low salinity led to decreased lysozyme activity and complement C3 levels along with suppressed cytokine expression [27]. Furthermore, salinity reduction in Acanthopagrus latus disrupted intestinal microbiota and immune gene regulation, facilitating bacterial overgrowth [28]. Wild river puffer fry remain in freshwater for a few months before migrating downstream toward the sea [29]. Although Takifugu obscurus exhibits salinity tolerance as part of its migratory behavior, prolonged exposure to freshwater may disrupt physiological mechanisms [30], thereby creating conditions favorable for opportunistic pathogen infection. In particular, E. miricola is known to grow optimally at salinities of 0–10 ppt [31]. However, physiological stress indicators (e.g., cortisol, glucose, or immune-related parameters) were not measured in the present study; therefore, the direct effects of low salinity on host stress or immune function could not be determined. Accordingly, the infection observed in this study is hypothesized to be associated with the combined effects of environmental conditions and opportunistic bacterial infection, rather than being attributed solely to low-salinity stress. Further studies are required to clarify the role of salinity in disease susceptibility in T. obscurus. Parasitological examination and limited viral screening were also conducted, but no evidence of co-infection was detected in the examined fish. However, the possibility of undetected co-infections cannot be completely excluded.
Bacterial isolates were obtained from the internal organs of diseased river puffer and identified as E. miricola by using biochemical analysis and BLAST of 16S rRNA (Table 2). Moreover, in results from phylogenetic analysis comparing 16S rRNA sequences, all isolates in this study were closely related to E. miricola, but distinct from E. meningoseptica (Figure 3). Despite the consistent isolation of E. miricola from diseased fish, Koch’s postulates were not satisfied in the present study, as experimental infection trials and subsequent re-isolation of the pathogen were not conducted. Therefore, a definitive causal relationship between E. miricola and the observed disease cannot be established, and the findings should be interpreted as an association. Further studies, including challenge experiments, are required to confirm its pathogenicity. According to previous reports, E. miricola is generally known as a pathogen of amphibians [22,32,33]. In contrast, E. meningoseptica appears to infect a broader range of hosts, including both aquaculture fish [20,21], and amphibians [34,35]. To our knowledge, this is the first report of E. miricola isolated from cultured fish in South Korea, suggesting its possible role as an opportunistic bacterium in aquaculture and its potential transmission to native amphibians. Furthermore, Elizabethkingia spp., including E. miricola, can infect immunocompromised humans [36] and animals [37], potentially leading to mortality [38].
Virulence-associated genes were detected in all E. miricola isolates obtained from river puffer (Figure 2). These included genes involved in motility and adhesion (fabG, fabV) [39,40], capsule and LPS biosynthesis (wecB) [41], urease activity (ureB) [42], metabolic adaptation through the glyoxylate shunt (aceA) [43], and acyl carrier protein synthesis (acyl) [44]. These genes are known to be associated with bacterial pathogenicity by enhancing motility, host colonization, immune evasion, and persistence under stress conditions. Considering the clinical symptoms observed in the affected fish and the presence of these virulence genes in the isolates, E. miricola may be associated with the observed disease in river puffer.
The antibiotic resistance characteristics of the Elizabethkingia isolates in this study revealed resistance to four antibiotics (OTC, AMP, NEO, and GEN). Elizabethkingia spp. are known to exhibit resistance to β-lactams and inhibitors, aminoglycosides, macrolides, tetracycline, vancomycin, and carbapenems, while remaining susceptible to piperacillin, piperacillin-tazobactam, fluoroquinolones, minocycline, tigecycline, and trimethoprim-sulfamethoxazole [45,46]. These findings align with the results of this study, where resistance to β-lactams (AMP) and aminoglycosides (GEN) was observed. Notably, Elizabethkingia spp. harbor resistance genes such as blaCME, blaBlaB, and blaGOB, which contribute to beta-lactam resistance [47]. Although we did not investigate the presence of resistance genes in this study, their potential presence and transferability remain a concern. Moreover, the multidrug resistance of Elizabethkingia spp. complicates treatment, and the presence of various antibiotic resistance genes [31] raises concerns about the potential risk of horizontal transfer of antimicrobial resistance genes.
In gross observation, numerous white granulomas were distributed in the spleen and kidney (Figure 1(C1,C2)), and multiple granulomas were identified in the liver, spleen, gill, and kidney through histopathological analysis (Figure 4). Granulomatous processes are known to be associated with chronic infections caused by Streptococcus spp., Mycobacterium sp., Nocardia sp., Francisella sp., and Staphylococcus sp. [48]. N. seriolae is a significant pathogen in aquaculture, causing chronic granulomatous disease in fish. This pathogen leads to granuloma formation in various organs, including the skin, liver, and kidney, and has been reported to cause high mortality rates, particularly in Asia [49]. Recently, N. seriolae has also been detected in Japanese eels farmed in freshwater, presenting as prominent nodules or macrophage-rich pustules [50,51]. Additionally, granulomatous lesions have been reported in seabream and seabass due to Mycobacteria infections transmitted through aquafeed [52]. However, in this study, Nocardia spp. and Mycobacteria were not detected in the internal organs of the diseased river puffer. Granulomatous lesions are associated with chronic infections and inflammation, and the granulomatous diseases are a recurring problem in the aquaculture field [48]. In this study, Elizabethkingia spp. were isolated from river puffer and are considered relatively rare pathogens in aquaculture [12,17]. While its association with granulomatous lesions in fish remains unclear, clinical reports in humans suggest a potential link to chronic infections [45]. The difficulty in eliminating Elizabethkingia spp. due to their biofilm-forming ability may lead to prolonged infections and contribute to granuloma formation [53].
In summary, the clinical signs, histological lesions, bacterial isolation, and detection of virulence-associated genes suggest that E. miricola may be associated with the disease observed in river puffer. To our knowledge, this is the first report of E. miricola isolated from cultured river puffer in South Korea, providing novel insight into its potential role as an opportunistic pathogen in aquaculture. Further research is warranted to clarify its pathogenic mechanisms and the environmental factors that may influence infection dynamics.

5. Conclusions

This study reports the first isolation and identification of Elizabethkingia miricola from cultured river puffer (Takifugu obscurus) reared under low-salinity conditions (3–5 ppt) in a recirculating aquaculture system in South Korea. Diseased fish exhibited clinical signs including lethargy, fin rot, hepatic hemorrhage, and white nodules in the spleen and kidney, with a cumulative mortality rate of 58.17%. Molecular analyses showed that the isolates shared 98.8–99.8% 16S rRNA gene sequence similarity with E. miricola and formed a distinct phylogenetic cluster, while several virulence-associated genes (fabG, fabV, wecB, ureB, aceA, and acyl) were detected in the isolates. Histopathological examination revealed granulomatous lesions in multiple organs, including the gill, heart, kidney, and spleen, and all isolates exhibited multidrug resistance.

Author Contributions

Conceptualization, K.-T.C. and B.-S.K.; methodology, D.-H.L. and B.-H.L.; validation, D.-H.L. and K.-T.C.; formal analysis, B.-H.L.; investigation, K.-T.C.; writing—original draft preparation, K.-T.C. and B.-S.K.; writing—review and editing, K.-T.C. and B.-S.K.; supervision, B.-S.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The fish samples used in this study were obtained from diseased fish during routine aquaculture disease investigation in a commercial farming system. No experimental infection or animal experimentation was conducted. According: to the Enforcement Decree of the Animal Protection Act of the Republic of Korea, fish kept for the purpose of human consumption are excluded from the scope of animals regulated under the Animal Protection Act. Therefore, Institutional Animal Care and Use Committee (IACUC) approval was not required for this study.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kang, H.W.; Cho, J.K.; Son, M.H.; Hong, C.G.; Park, J.Y. Effect of Feeding Frequency on Growth and Body Composition of Juvenile River Puffer, Takifugu obscurus in Winter season. J. Fish. Mar. Sci. Educ. 2015, 27, 718–724. [Google Scholar]
  2. Yoo, G.Y.; Lee, J.Y. The effect of feeding frequency, water temperature, and stocking density on the growth of river puffer Takifugu obscurus reared in a zero-exchange water system. Fish. Aquat. Sci. 2016, 19, 23. [Google Scholar] [CrossRef]
  3. Ministry of Oceans and Fisheries (MOF). Fisheries Information Portal Service (FIPS). Available online: https://www.fips.go.kr/p/S020304/ (accessed on 30 March 2026).
  4. Cheng, C.-H.; Yang, F.-F.; Ling, R.-Z.; Liao, S.-A.; Miao, Y.-T.; Ye, C.-X.; Wang, A.-L. Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Takifugu obscurus). Aquat. Toxicol. 2015, 164, 61–71. [Google Scholar] [CrossRef] [PubMed]
  5. Ye, H.; Xu, M.; Liu, Q.; Sun, Z.; Zou, C.; Chen, L.; Su, N.; Ye, C. Effects of replacing fish meal with soybean meal on growth performance, feed utilization and physiological status of juvenile obscure puffer, Takifugu obscurus. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2019, 216, 75–81. [Google Scholar] [CrossRef]
  6. Tian, Y.; Wang, C.; Wang, Y.; Xiong, Y.; Liu, Y.; Yan, H.; Wu, A.; Gao, R.; Li, M.; Wang, L.; et al. Gill transcriptomes analysis of Takifugu obscurus, Takifugu rubripes and their hybrid offspring in freshwater and seawater. Aquac. Rep. 2024, 37, 102208. [Google Scholar] [CrossRef]
  7. Assefa, A.; Abunna, F. Maintenance of fish health in aquaculture: Review of epidemiological approaches for prevention and control of infectious disease of fish. Vet. Med. Int. 2018, 2018, 5432497. [Google Scholar] [CrossRef]
  8. Bondad-Reantaso, M.G.; Subasinghe, R.P.; Arthur, J.R.; Ogawa, K.; Chinabut, S.; Adlard, R.; Tan, Z.; Shariff, M. Disease and health management in Asian aquaculture. Vet. Parasitol. 2005, 132, 249–272. [Google Scholar] [CrossRef]
  9. Xu, R.; He, Z.; Deng, Y.; Cen, Y.; Mo, Z.; Dan, X.; Li, Y. Lactococcus garvieae as a Novel Pathogen in Cultured Pufferfish (Takifugu obscurus) in China. Fishes 2024, 9, 406. [Google Scholar] [CrossRef]
  10. Ytrestøyl, T.; Takle, H.; Kolarevic, J.; Calabrese, S.; Timmerhaus, G.; Rosseland, B.O.; Teien, H.C.; Nilsen, T.O.; Handeland, S.O.; Stefansson, S.O.; et al. Performance and welfare of Atlantic salmon, Salmo salar L. post-smolts in recirculating aquaculture systems: Importance of salinity and water velocity. J. World Aquac. Soc. 2020, 51, 373–392. [Google Scholar] [CrossRef]
  11. Zhang, X.-H.; He, X.; Austin, B. Vibrio harveyi: A serious pathogen of fish and invertebrates in mariculture. Mar. Life Sci. Technol. 2020, 2, 231–245. [Google Scholar] [CrossRef]
  12. Jacobs, A.; Chenia, H.Y. Biofilm formation and adherence characteristics of an Elizabethkingia meningoseptica isolate from Oreochromis mossambicus. Ann. Clin. Microbiol. Antimicrob. 2011, 10, 16. [Google Scholar] [CrossRef] [PubMed]
  13. Hem, S.; Jarocki, V.M.; Baker, D.J.; Charles, I.G.; Drigo, B.; Aucote, S.; Donner, E.; Burnard, D.; Bauer, M.J.; Harris, P.N.A.; et al. Genomic analysis of Elizabethkingia species from aquatic environments: Evidence for potential clinical transmission. Curr. Res. Microb. Sci. 2022, 3, 100083. [Google Scholar] [CrossRef] [PubMed]
  14. Furyk, J.S.; Swann, O.; Molyneux, E. Systematic review: Neonatal meningitis in the developing world. Trop. Med. Health 2011, 16, 672–679. [Google Scholar] [CrossRef]
  15. Wei, D.; Cheng, Y.; Xiao, S.; Liao, W.; Yu, Q.; Han, S.; Huang, S.; Shi, J.; Xie, Z.; Li, P. Natural occurrences and characterization of Elizabethkingia miricola infection in cultured bullfrogs (Rana catesbeiana). Front. Cell. Infect. Microbiol. 2023, 13, 1094050. [Google Scholar] [CrossRef] [PubMed]
  16. Qiao, M.; Zhang, L.; Chang, J.; Li, H.; Li, J.; Wang, W.; Yuan, G.; Su, J. Rapid and sensitive detection of pathogenic Elizabethkingia miricola in black spotted frog by RPA-LFD and fluorescent probe-based RPA. Fish Shellfish Immunol. Rep. 2022, 3, 100059. [Google Scholar] [CrossRef] [PubMed]
  17. Laith, A.A.; Mazlan, A.G.; Ambak, M.A.; Jabar, A.; Najiah, M. ISOLATION AND IDENTIFICATION OF Elizabethkingia meningoseptica FROM DISEASED AFRICAN CATFISH Clarias gariepinus. J. Microbiol. Biotechnol. Food Sci. 2017, 6, 1070–1076. [Google Scholar] [CrossRef]
  18. Tan, J.W.Y.; Lian, B.J.X.; Loh, C.Y.X.; See, K.C. Elizabethkingia Species as an Emerging Pathogen: A Comprehensive Review of Clinical and Microbiological Evidence. Pathogens 2026, 15, 278. [Google Scholar] [CrossRef]
  19. Zhang, M.; Hou, L.; Zhu, Y.; Zhang, C.; Li, W.; Lai, X.; Yang, J.; Li, S.; Shu, H. Composition and distribution of bacterial communities and antibiotic resistance genes in fish of four mariculture systems. Environ. Pollut. 2022, 311, 119934. [Google Scholar] [CrossRef]
  20. Jasim, S.A.; Mohammed, J.S.; Roopashree, R.; Alshahrani, M.Y.; Sharma, A.; Sharma, A.; Asliddin, S.; Beig, M. Unraveling the global landscape of Elizabethkingia antibiotic resistance: A systematic review and meta-analysis. PLoS ONE 2025, 20, e0323313. [Google Scholar] [CrossRef]
  21. Baron, S.; Granier, S.A.; Larvor, E.; Jouy, E.; Cineux, M.; Wilhelm, A.; Gassilloud, B.; Le Bouquin, S.; Kempf, I.; Chauvin, C. Aeromonas Diversity and Antimicrobial Susceptibility in Freshwater—An Attempt to Set Generic Epidemiological Cut-Off Values. Front. Microbiol. 2017, 8, 503. [Google Scholar] [CrossRef]
  22. An, R.; Hou, G.; Sun, X.; Wang, L.; Zhang, C.; Han, Y.; Li, Y.; Wu, T.; Shi, Q.; Zhu, Z.; et al. Outbreaks of Elizabethkingia miricola Caused Fatal Meningitis-Like Disease in Cultured Bullfrogs. Transbound. Emerg. Dis. 2024, 4733320. [Google Scholar] [CrossRef]
  23. Heuer, H.; Krsek, M.; Baker, P.; Smalla, K.; Wellington, E.M. Analysis of actinomycete communities by specific amplification of genes encoding 16S rRNA and gel-electrophoretic separation in denaturing gradients. Appl. Environ. Microbiol. 1997, 63, 3233–3241. [Google Scholar] [CrossRef] [PubMed]
  24. Bowden, T.J. Modulation of the immune system of fish by their environment. Fish Shellfish Immunol. 2008, 25, 373–383. [Google Scholar] [CrossRef]
  25. Bly, J.E.; Quiniou, S.M.; Clem, L.W. Environmental effects on fish immune mechanisms. Dev. Biol. Stand. 1997, 90, 33–43. [Google Scholar] [PubMed]
  26. Chang, Y.-T.; Huang, W.-T.; Wu, P.-L.; Kumar, R.; Wang, H.-C.; Lu, H.-P. Low salinity stress increases the risk of Vibrio parahaemolyticus infection and gut microbiota dysbiosis in Pacific white shrimp. BMC Microbiol. 2024, 24, 275. [Google Scholar] [CrossRef] [PubMed]
  27. Wang, D.; Cao, Q.; Zhu, W.; Hu, Y.; Zhang, X.; Yin, S.; Wang, T. Individual and combined effects of salinity and lipopolysaccharides on the immune response of juvenile Takifugu fasciatus. Fish Physiol. Biochem. 2019, 45, 965–976. [Google Scholar] [CrossRef]
  28. Lin, G.; Zheng, M.; Li, S.; Xie, J.; Fang, W.; Gao, D.; Huang, J.; Lu, J. Response of gut microbiota and immune function to hypoosmotic stress in the yellowfin seabream (Acanthopagrus latus). Sci. Total Environ. 2020, 745, 140976. [Google Scholar] [CrossRef]
  29. Shi, Y.; Zhang, G.; Zhu, Y.; Liu, J. Effects of photoperiod, temperature, and salinity on growth and survival of obscure puffer Takifugu obscurus larvae. Aquaculture 2010, 309, 103–108. [Google Scholar] [CrossRef]
  30. Wang, J.; Zhu, X.; Sun, Y.; Gu, L.; Wu, Y.; Chen, Y.; Yang, Z. Changes in Transcriptome and Ultrastructure Reveal Salinity Tolerance of Obscure Puffer Takifugu obscurus. Front. Mar. Sci. 2022, 9, 854140. [Google Scholar] [CrossRef]
  31. Li, S.; Wang, X.; Lu, Y.; Wang, J.; Yu, D.; Zhou, Z.; Wei, J.; Liu, L.; Liu, J.; Liu, F.; et al. Co-infections of Klebsiella pneumoniae and Elizabethkingia miricola in black-spotted frogs (Pelophylax nigromaculatus). Microb. Pathog. 2023, 180, 106150. [Google Scholar] [CrossRef]
  32. Li, F.; Chen, B.; Xu, M.; Feng, Y.; Deng, Y.; Huang, X.; Geng, Y.; Ouyang, P.; Chen, D. Immune Activation and Inflammatory Response Mediated by the NOD/Toll-like Receptor Signaling Pathway—The Potential Mechanism of Bullfrog (Lithobates catesbeiana) Meningitis Caused by Elizabethkingia miricola. Int. J. Mol. Sci. 2023, 24, 14554. [Google Scholar] [CrossRef]
  33. Wei, Q.; Wang, D.; Wei, K.; Xu, B.; Xu, J. The Mechanism of Elizabethkingia miricola Infection of the Black Spotted Frog as Revealed by Multi-Omics Analysis. Fishes 2024, 9, 91. [Google Scholar] [CrossRef]
  34. Tsai, M.-A.; See, M.S.; Chiu, C.-H.; Wang, P.-C.; Chen, S.-C. Genotypic and phenotypic analysis of Elizabethkingia meningoseptica in bullfrog Rana catesbeiana isolated in Taiwan. J. Fish Dis. 2023, 46, 1239–1248. [Google Scholar] [CrossRef] [PubMed]
  35. Xie, Z.-Y.; Zhou, Y.-C.; Wang, S.-F.; Mei, B.; Xu, X.-D.; Wen, W.-Y.; Feng, Y.-Q. First isolation and identification of Elizabethkingia meningoseptica from cultured tiger frog, Rana tigerina rugulosa. Vet. Microbiol. 2009, 138, 140–144. [Google Scholar] [CrossRef] [PubMed]
  36. Zdziarski, P.; Paściak, M.; Rogala, K.; Korzeniowska-Kowal, A.; Gamian, A. Elizabethkingia miricola as an opportunistic oral pathogen associated with superinfectious complications in humoral immunodeficiency: A case report. BMC Infect. Dis. 2017, 17, 763. [Google Scholar] [CrossRef] [PubMed]
  37. Huang, X.; Feng, Y.; Tang, H.; Xiong, G.; Li, L.; Yang, Y.; Wang, K.; Ouyang, P.; Geng, Y.; Chen, D. Candidate animal disease model of Elizabethkingia spp. infection in humans, based on the systematic pathology and oxidative damage caused by E. miricola in Pelophylax nigromaculatus. Oxid. Med. Cell. Longev. 2019, 2019, 6407524. [Google Scholar] [CrossRef]
  38. Fahmy, M.; Stewart, A.; Tey, S.-K.; Hajkowicz, K. Elizabethkingia bloodstream infections in severely immunocompromised patients: Persistent, relapsing and associated with high mortality. JAC-Antimicrob. Resist. 2024, 6, dlae161. [Google Scholar] [CrossRef]
  39. Huang, Y.H.; Lin, J.S.; Ma, J.C.; Wang, H.H. Functional Characterization of Triclosan-Resistant Enoyl-acyl-carrier Protein Reductase (FabV) in Pseudomonas aeruginosa. Front. Microbiol. 2016, 7, 1903. [Google Scholar] [CrossRef]
  40. Campbell, J.W.; Cronan, J.E. Bacterial fatty acid biosynthesis: Targets for antibacterial drug discovery. Annu. Rev. Microbiol. 2001, 55, 305–332. [Google Scholar] [CrossRef]
  41. Rai, A.K.; Mitchell, A.M. Enterobacterial Common Antigen: Synthesis and Function of an Enigmatic Molecule. mBio 2020, 11, e01914-20. [Google Scholar] [CrossRef]
  42. Carter, E.L.; Flugga, N.; Boer, J.L.; Mulrooney, S.B.; Hausinger, R.P. Interplay of metal ions and urease. Metallomics 2009, 1, 207–221. [Google Scholar] [CrossRef] [PubMed]
  43. Dunn, M.F.; Ramírez-Trujillo, J.A.; Hernández-Lucas, I. Major roles of isocitrate lyase and malate synthase in bacterial and fungal pathogenesis. Microbiology 2009, 155, 3166–3175. [Google Scholar] [CrossRef] [PubMed]
  44. Morbidoni, H.R.; de Mendoza, D.; Cronan, J.E., Jr. Bacillus subtilis acyl carrier protein is encoded in a cluster of lipid biosynthesis genes. J. Bacteriol. 1996, 178, 4794–4800. [Google Scholar] [CrossRef] [PubMed]
  45. Wu, C.; Xiong, L.; Liao, Q.; Zhang, W.; Xiao, Y.; Xie, Y. Clinical manifestations, antimicrobial resistance and genomic feature analysis of multidrug-resistant Elizabethkingia strains. Ann. Clin. Microbiol. Antimicrob. 2024, 23, 32. [Google Scholar] [CrossRef]
  46. Lin, J.N.; Lai, C.H.; Yang, C.H.; Huang, Y.H. Elizabethkingia Infections in Humans: From Genomics to Clinics. Microorganisms 2019, 7, 295. [Google Scholar] [CrossRef]
  47. Wang, L.; Zhang, X.; Li, D.; Hu, F.; Wang, M.; Guo, Q.; Yang, F. Molecular Characteristics and Antimicrobial Susceptibility Profiles of Elizabethkingia Clinical Isolates in Shanghai, China. Infect. Drug Resist. 2020, 13, 247–256. [Google Scholar] [CrossRef]
  48. Rajme-Manzur, D.; Gollas-Galván, T.; Vargas-Albores, F.; Martínez-Porchas, M.; Hernández-Oñate, M.Á.; Hernández-López, J. Granulomatous bacterial diseases in fish: An overview of the host’s immune response. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2021, 261, 111058. [Google Scholar] [CrossRef]
  49. Nawaz, M.; Gao, T.; Huang, K.; Gouife, M.; Chen, S.; Zhu, S.; Ma, R.; Jin, S.; Jiang, J.; Xie, J. Pathogenicity, diagnosis, prevention strategies and immune response of bacterium Nocardia seriolae: A critical review. Aquac. Res. 2022, 53, 4901–4918. [Google Scholar] [CrossRef]
  50. Kim, B.S.; Park, J.W.; Kang, G.S.; Jin, J.H.; Roh, H.J.; Kim, D.H.; Lee, M.K.; Huh, M.D. First report of nocardia infection in cultured Japanese eel, Anguilla japonica. J. Fish Dis. 2018, 41, 1921–1927. [Google Scholar] [CrossRef]
  51. Kim, J.D.; Lee, N.S.; Do, J.W.; Kim, M.S.; Seo, H.G.; Cho, M.; Jung, S.H.; Han, H.J. Nocardia seriolae infection in the cultured eel Anguilla japonica in Korea. J. Fish Dis. 2018, 41, 1745–1750. [Google Scholar] [CrossRef]
  52. Mataragka, A.; Tzimotoudis, N.; Kolygas, M.; Karavanis, E.; Ikonomopoulos, J. Diagnostic investigation for the detection of mycobacteria in samples of fish feeds and tissue from sea bream and sea bass with severe granulomatous lesions. Aquaculture 2022, 546, 737283. [Google Scholar] [CrossRef]
  53. Puah, S.M.; Fong, S.P.; Kee, B.P.; Puthucheary, S.D.; Chua, K.H. Molecular identification and biofilm-forming ability of Elizabethkingia species. Microb. Pathog. 2022, 162, 105345. [Google Scholar] [CrossRef]
Fishes 11 00214 g001
Figure 1. Clinical signs observed in diseased puffer fish and bacterial incubation of E. miricola. (A) External signs include severe mouth ulceration (red arrow), redness and caudal fin rot (black arrows), and erythema and erosion in the head region (white arrows). (B1–B3) Internal hepatic lesions characterized by petechial hemorrhages (black arrows) and green discoloration (white arrows) of the liver. (C1,C2) Distinct white nodules (white arrows) present in the spleen. (D) Bacterial colonies E. miricola on tryptic soy agar (TSA).
Figure 1. Clinical signs observed in diseased puffer fish and bacterial incubation of E. miricola. (A) External signs include severe mouth ulceration (red arrow), redness and caudal fin rot (black arrows), and erythema and erosion in the head region (white arrows). (B1–B3) Internal hepatic lesions characterized by petechial hemorrhages (black arrows) and green discoloration (white arrows) of the liver. (C1,C2) Distinct white nodules (white arrows) present in the spleen. (D) Bacterial colonies E. miricola on tryptic soy agar (TSA).
Fishes 11 00214 g001
Fishes 11 00214 g002
Figure 2. Gel electrophoresis of virulence genes amplified from Elizabethkingia miricola isolates. M, 100 bp DNA ladder; Lanes 1–5, isolates PFEk-1 to PFEk-5; N, negative control.
Figure 2. Gel electrophoresis of virulence genes amplified from Elizabethkingia miricola isolates. M, 100 bp DNA ladder; Lanes 1–5, isolates PFEk-1 to PFEk-5; N, negative control.
Fishes 11 00214 g002
Fishes 11 00214 g003
Figure 3. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of Elizabethkingia spp. including isolates in this study (PFEk-1 to PFEk-5). Bootstrap values from 1000 replicates are shown at branch points. Scale bar represents 0.01 nucleotide substitutions per site.
Figure 3. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of Elizabethkingia spp. including isolates in this study (PFEk-1 to PFEk-5). Bootstrap values from 1000 replicates are shown at branch points. Scale bar represents 0.01 nucleotide substitutions per site.
Fishes 11 00214 g003
Fishes 11 00214 g004
Figure 4. Histopathological observation of various organs in puffer fish infected with Elizabethkingia miricola. (A) Macrophagic infiltration (ellipse) in liver. (B) Hemorrhagic lesions (arrows) associated with clinical petechial hemorrhagic lesion. (C) Appearance of multiple granuloma (arrows) in primary lamella of gill. (D) Extensive macrophagic infiltration (black ellipse) adjacent to the granuloma (labeled G) and mild hemorrhagic lesions (red ellipse) exhibiting phagocytic activity of macrophages engulfing erythrocyte (arrows). (E) Disseminated granuloma (black arrows) and massive infiltration of lymphocytes (white arrows) in spleen. (F) Activated macrophage showing cytoplasmic vacuolation (white arrows) and phagocytosis of erythrocytes (black arrows) in reticuloendothelial system of the spleen. (G) Multiple granulomas (arrows) in epicardium, myocardium, and endocardium of heart. (H) Multiple granulomas (arrows) in reticuloendothelial system of interstitial tissue in kidney. (I) Cytoplasmic vacuolation (red arrows) in renal tubular epithelium, necrotic debris of tubular epithelial cells (black arrows) in lumen of renal tubules, macrophages engulfing erythrocytes (arrowheads), and activated macrophages with cytoplasmic vacuolation (white arrows) in reticuloendothelial system of interstitial tissue in kidney, (J) Massive lymphocytic infiltration in submucosa of intestine.
Figure 4. Histopathological observation of various organs in puffer fish infected with Elizabethkingia miricola. (A) Macrophagic infiltration (ellipse) in liver. (B) Hemorrhagic lesions (arrows) associated with clinical petechial hemorrhagic lesion. (C) Appearance of multiple granuloma (arrows) in primary lamella of gill. (D) Extensive macrophagic infiltration (black ellipse) adjacent to the granuloma (labeled G) and mild hemorrhagic lesions (red ellipse) exhibiting phagocytic activity of macrophages engulfing erythrocyte (arrows). (E) Disseminated granuloma (black arrows) and massive infiltration of lymphocytes (white arrows) in spleen. (F) Activated macrophage showing cytoplasmic vacuolation (white arrows) and phagocytosis of erythrocytes (black arrows) in reticuloendothelial system of the spleen. (G) Multiple granulomas (arrows) in epicardium, myocardium, and endocardium of heart. (H) Multiple granulomas (arrows) in reticuloendothelial system of interstitial tissue in kidney. (I) Cytoplasmic vacuolation (red arrows) in renal tubular epithelium, necrotic debris of tubular epithelial cells (black arrows) in lumen of renal tubules, macrophages engulfing erythrocytes (arrowheads), and activated macrophages with cytoplasmic vacuolation (white arrows) in reticuloendothelial system of interstitial tissue in kidney, (J) Massive lymphocytic infiltration in submucosa of intestine.
Fishes 11 00214 g004
Table 1. PCR primers for identification of isolates and detection of virulence gene.
Table 1. PCR primers for identification of isolates and detection of virulence gene.
GenePrimer Sequence (5′→3′)Product Size
(bp)		Reference
fabGATGAAACTATTAGAAGGAAAAGTAG744[22]
CTAAGTTAACATTCCGCCA
fabVATGATCATACAACCACGTGTTA1203
TTATCCTTCTATACTTGGGATGT
wecBATGAAGAAACTAAAAGTAATGACG1140
TTAAATTTCTTCAGACCAGACAG
ureBATGATACCAGGAGAAATTTTTGT369
TTACAGGTTTTTAAAATTTAATTGA
aceAATGAAAACTATTCAGGAACTACAAC1275
TTAGAATTGTGCTGTTTCTGTAGA
acylATGTCAGACATCGCATCAA240
TTATTTGTTGACTACTTCTTCAAT
16S rRNAAGAGTTTGATCCTGGCTCAGabout
1550		[23]
TACGGYTACCTTGTTACGACTT
Table 2. Comparison of results of bacterial identification with different method.
Table 2. Comparison of results of bacterial identification with different method.
SampleResults of Bacterial Identification (% Identify)
Biolog
(Biochemical Identification)		16S rRNA Sequencing
(Molecular Identification)
PFEk-1Elizabethkingia miricola (97.4)Elizabethkingia miricola (99.8)
PFEk-2Elizabethkingia miricola (98.5)Elizabethkingia miricola (99.4)
PFEk-3Elizabethkingia miricola (99.0)Elizabethkingia miricola (98.8)
PFEk-4Elizabethkingia miricola (98.7)Elizabethkingia bruuniana (98.9)
PFEk-5Elizabethkingia miricola (99.2)Elizabethkingia miricola (99.6)
Table 3. Characteristics of the antibiotic-resistance of isolates from cultured puffer fish.
Table 3. Characteristics of the antibiotic-resistance of isolates from cultured puffer fish.
SampleAntibiotics *
OTCAMPNEOGENSXTFFNCLIENR
PFEk-1RRRRSSSS
PFEk-2RRRRSSSS
PFEk-3RRRRSSSS
PFEk-4RRRRSSSS
PFEk-5RRRRSSRS
*: OTC, Oxytetracycline; AMP, Ampicillin; NEO, Neomycin; GEN, Gentamycin; SXT, Trimethoprim/sulfamethoxazole; FFN, Florfenicol; CLI, Clindamycin; ENR, Enrofloxacin; S, Susceptible; R, Resistance.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cho, K.-T.; Lee, D.-H.; Lee, B.-H.; Kim, B.-S. First Report of Elizabethkingia miricola Isolated from Low-Salinity-Cultured River Puffer (Takifugu obscurus) in South Korea. Fishes 2026, 11, 214. https://doi.org/10.3390/fishes11040214

AMA Style

Cho K-T, Lee D-H, Lee B-H, Kim B-S. First Report of Elizabethkingia miricola Isolated from Low-Salinity-Cultured River Puffer (Takifugu obscurus) in South Korea. Fishes. 2026; 11(4):214. https://doi.org/10.3390/fishes11040214

Chicago/Turabian Style

Cho, Ki-Taek, Dong-Hoon Lee, Beom-Hee Lee, and Bo-Seong Kim. 2026. "First Report of Elizabethkingia miricola Isolated from Low-Salinity-Cultured River Puffer (Takifugu obscurus) in South Korea" Fishes 11, no. 4: 214. https://doi.org/10.3390/fishes11040214

APA Style

Cho, K.-T., Lee, D.-H., Lee, B.-H., & Kim, B.-S. (2026). First Report of Elizabethkingia miricola Isolated from Low-Salinity-Cultured River Puffer (Takifugu obscurus) in South Korea. Fishes, 11(4), 214. https://doi.org/10.3390/fishes11040214

Article Metrics

Back to TopTop