Comparative Effects of Untreated and High-Solid Loading Pre-Treated Codium tomentosum on Oxidative and Immune Responses in European Seabass (Dicentrarchus labrax)
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Diets
2.2. Feeding Trial
2.3. Sampling
2.4. Chemical Analysis
2.5. Oxidative Stress Analysis
2.6. Innate Immune Indicators
2.7. Gene Expression Analysis
2.8. Microbial Diversity
2.9. Statistical Analysis
3. Results
3.1. Dietary Effects on Oxidative Stress
3.2. Dietary Effects on Innate Immune Parameters
3.3. Dietary Effects on Immune-Related Gene Expression
3.4. Dietary Effects on Microbial Diversity
4. Discussion
4.1. Dietary Effects on Oxidative Stress
4.2. Dietary Effects on Innate Immune Parameters
4.3. Dietary Effects on Immune-Related Gene Expression
4.4. Dietary Effects on Microbial Diversity
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Harikrishnan, R.; Devi, G.; Van Doan, H.; Balasundaram, C.; Arockiaraj, J.; Jagruthi, C. Efficacy of Ulvan on Immune Response and Immuno-Antioxidant Gene Modulation in Labeo Rohita against Columnaris Disease. Fish Shellfish Immunol. 2021, 117, 262–273. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, M.; Ramos-Oliveira, C.; Magalhães, R.; Martins, N.; Serra, C.R.; Salgado, J.M.; Belo, I.; Oliva-Teles, A.; Peres, H. Effects of Solid-State Fermentation of Gelidium Corneum by-Product on Immune Status and Gut Microbiota in European Seabass. Anim. Feed Sci. Technol. 2025, 324, 116332. [Google Scholar] [CrossRef] [Scilit]
- Galindo, A.; Pérez, J.A.; Martín, V.; Acosta, N.G.; Reis, D.B.; Jiménez, I.A.; Rosa, G.; Venuleo, M.; Marrero, M.; Rodríguez, C. Effect of Feed Supplementation with Seaweed Wracks on Performance, Muscle Lipid Composition, Antioxidant Status, Digestive Enzyme Activities, and Plasma Biochemistry of Gilthead Seabream (Sparus aurata) Juveniles. Aquac. Rep. 2023, 31, 101673. [Google Scholar] [CrossRef] [Scilit]
- Norambuena, F.; Hermon, K.; Skrzypczyk, V.; Emery, J.A.; Sharon, Y.; Beard, A.; Turchini, G.M. Algae in Fish Feed: Performances and Fatty Acid Metabolism in Juvenile Atlantic Salmon. PLoS ONE 2015, 10, e0124042. [Google Scholar] [CrossRef] [Scilit]
- Rouhani, E.; Safari, R.; Imanpour, M.R.; Hoseinifar, S.H.; Yazici, M.; El-Haroun, E. Effect of Dietary Administration of Green Macroalgae (Ulva intestinalis) on Mucosal and Systemic Immune Parameters, Antioxidant Defence, and Related Gene Expression in Zebrafish (Danio rerio). Aquac. Nutr. 2022, 2022, 7693468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kostas, E.T.; White, D.A.; Cook, D.J. Development of a Bio-Refinery Process for the Production of Speciality Chemical, Biofuel and Bioactive Compounds from Laminaria Digitata. Algal Res. 2017, 28, 211–219. [Google Scholar] [CrossRef] [Scilit]
- Siddik, M.A.B.; Francis, P.; Rohani, M.F.; Azam, M.S.; Mock, T.S.; Francis, D.S. Seaweed and Seaweed-Based Functional Metabolites as Potential Modulators of Growth, Immune and Antioxidant Responses, and Gut Microbiota in Fish. Antioxidants 2023, 12, 2066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xuan, X.; Wen, X.; Li, S.; Zhu, D.; Li, Y. Potential Use of Macro-Algae Gracilaria lemaneiformis in Diets for the Black Sea Bream, Acanthopagrus schlegelii, Juvenile. Aquaculture 2013, 412–413, 167–172. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, M.; Ribeiro, P.C.; Ribeiro, L.; Barata, M.; Domingues, V.F.; Sousa, S.; Soares, C.; Marques, A.; Pousão-Ferreira, P.; Dias, J.; et al. Biofortified Diets Containing Algae and Selenised Yeast: Effects on Growth Performance, Nutrient Utilization, and Tissue Composition of Gilthead seabream (Sparus aurata). Front. Physiol. 2022, 12, 812884. [Google Scholar] [CrossRef] [Scilit]
- Thépot, V.; Campbell, A.H.; Rimmer, M.A.; Paul, N.A. Meta-Analysis of the Use of Seaweeds and Their Extracts as Immunostimulants for Fish: A Systematic Review. Rev. Aquac. 2021, 13, 907–933. [Google Scholar] [CrossRef] [Scilit]
- Scapigliati, G.; Romano, N.; Buonocore, F.; Picchietti, S.; Baldassini, M.R.; Prugnoli, D.; Galice, A.; Meloni, S.; Secombes, C.J.; Mazzini, M.; et al. The Immune System of Sea Bass, Dicentrarchus Labrax, Reared in Aquaculture. Dev. Comp. Immunol. 2002, 26, 151–160. [Google Scholar] [CrossRef] [Scilit]
- Cadar, E.; Popescu, A.; Dragan, A.M.L.; Pesterau, A.M.; Pascale, C.; Anuta, V.; Prasacu, I.; Velescu, B.S.; Tomescu, C.L.; Bogdan-Andreescu, C.F.; et al. Bioactive Compounds of Marine Algae and Their Potential Health and Nutraceutical Applications: A Review. Mar. Drugs 2025, 23, 152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cadar, E.; Negreanu-Pirjol, T.; Sirbu, R.; Dragan, A.M.L.; Negreanu-Pirjol, B.S.; Axente, E.R.; Ionescu, A.M. Biocompounds from Green Algae of Romanian Black Sea Coast as Potential Nutraceuticals. Processes 2023, 11, 1750. [Google Scholar] [CrossRef] [Scilit]
- Subramoni, M.; Kumar, S.; Abraham, J.P. Nutritional Content of Selected Macroalgae of the South-West Coast of India. Egypt. J. Phycol. 2023, 24, 161–193. [Google Scholar] [CrossRef] [Scilit]
- Moreira, A.; Cruz, S.; Marques, R.; Cartaxana, P. The Underexplored Potential of Green Macroalgae in Aquaculture. Rev. Aquac. 2022, 14, 5–26. [Google Scholar] [CrossRef] [Scilit]
- Kalavathy, G.; Baskar, G.; Phoebe, M.G.L.; Muthaszeer, A.M.; Subashini, S.; Chang, S.K. Formulation of Topical Ointment Using Seaweed Extracts of Ulva Lactuca and Codium tomentosum and Their Physicochemical, Antioxidant, Antiinflammatory, Antibacterial and Wound Healing Properties. Waste Biomass Valorization 2025, 16, 6133–6144. [Google Scholar] [CrossRef] [Scilit]
- Fernandes, H.; Martins, N.; Vieira, L.; Salgado, J.M.; Castro, C.; Oliva-Teles, A.; Belo, I.; Peres, H. Pre-Treatment of Ulva Rigida Improves Its Nutritional Value for European Seabass (Dicentrarchus labrax) Juveniles. Algal Res. 2022, 66, 102803. [Google Scholar] [CrossRef] [Scilit]
- Pandey, D.; Næss, G.; Fonseca, A.J.M.; Maia, M.R.G.; Cabrita, A.R.J.; Khanal, P. Differential Impacts of Post-Harvest Hydrothermal Treatments on Chemical Composition and in Vitro Digestibility of Two Brown Macroalgae (Fucales, Phaeophyceae), Ascophyllum nodosum and Fucus vesiculosus, for Animal Feed Applications. J. Appl. Phycol. 2023, 35, 2511–2529. [Google Scholar] [CrossRef] [Scilit]
- Agboola, J.O.; Teuling, E.; Wierenga, P.A.; Gruppen, H.; Schrama, J.W. Cell Wall Disruption: An Effective Strategy to Improve the Nutritive Quality of Microalgae in African catfish (Clarias gariepinus). Aquac. Nutr. 2019, 25, 783–797. [Google Scholar] [CrossRef] [Scilit]
- Ometto, F.; Quiroga, G.; Pšenička, P.; Whitton, R.; Jefferson, B.; Villa, R. Impacts of Microalgae Pre-Treatments for Improved Anaerobic Digestion: Thermal Treatment, Thermal Hydrolysis, Ultrasound and Enzymatic Hydrolysis. Water Res. 2014, 65, 350–361. [Google Scholar] [CrossRef] [Scilit]
- Santos, F.; Soares, C.; Morais, S.L.; Neves, C.; Grosso, C.; Ramalhosa, M.J.; Vieira, M.; Delerue-Matos, C.; Domingues, V.F. Optimized Extraction Protocols for Bioactive Antioxidants from Commercial Seaweeds in Portugal: A Comparative Study of Techniques. Foods 2025, 14, 453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, X.; Chen, H.; Mi, J.; Li, X.; Wu, Z.; Jiang, Y.; Dong, X. Process Optimization for Polyphenol Extraction from Macroalgae Residues and Assessment of Their Compositions, Antioxidant Activities, and Glycosidase Inhibition. Foods 2025, 14, 3055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghadiryanfar, M.; Rosentrater, K.A.; Keyhani, A.; Omid, M. A Review of Macroalgae Production, with Potential Applications in Biofuels and Bioenergy. Renew. Sustain. Energy Rev. 2016, 54, 473–481. [Google Scholar] [CrossRef] [Scilit]
- Arias, A.; Feijoo, G.; Moreira, M.T. Macroalgae Biorefineries as a Sustainable Resource in the Extraction of Value-Added Compounds. Algal Res. 2023, 69, 102954. [Google Scholar] [CrossRef] [Scilit]
- Quitério, E.; Grosso, C.; Ferraz, R.; Delerue-Matos, C.; Soares, C. A Critical Comparison of the Advanced Extraction Techniques Applied to Obtain Health-Promoting Compounds from Seaweeds. Mar. Drugs 2022, 20, 677. [Google Scholar] [CrossRef] [Scilit]
- Shiva; Climent Barba, F.; Rodríguez-Jasso, R.M.; Sukumaran, R.K.; Ruiz, H.A. High-Solids Loading Processing for an Integrated Lignocellulosic Biorefinery: Effects of Transport Phenomena and Rheology—A Review. Bioresour. Technol. 2022, 351, 127044. [Google Scholar] [CrossRef] [Scilit]
- Modenbach, A.A.; Nokes, S.E. Enzymatic Hydrolysis of Biomass at High-Solids Loadings—A Review. Biomass Bioenergy 2013, 56, 526–544. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Liu, X.; Bao, J. High Solids Loading Pretreatment: The Core of Lignocellulose Biorefinery as an Industrial Technology—An Overview. Bioresour. Technol. 2023, 369, 128334. [Google Scholar] [CrossRef] [Scilit]
- Ramos-Oliveira, C.; Ferreira, M.; Belo, I.; Oliva-Teles, A.; Peres, H. Effectiveness of High-Solid Loading Treatments to Enhance Nutrient and Antioxidant Bioavailability in Codium tomentosum. Phycology 2025, 5, 69. [Google Scholar] [CrossRef] [Scilit]
- Serra, C.R.; Oliva-Teles, A.; Enes, P.; Tavares, F. Gut Microbiota Dynamics in Carnivorous European Seabass (Dicentrarchus labrax) Fed Plant-Based Diets. Sci. Rep. 2021, 11, 447. [Google Scholar] [CrossRef] [Scilit]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [Scilit]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Ruzafa, A.; Marcos, C. Fisheries in Coastal Lagoons: An Assumed but Poorly Researched Aspect of the Ecology and Functioning of Coastal Lagoons. Estuar. Coast. Shelf Sci. 2012, 110, 15–31. [Google Scholar] [CrossRef] [Scilit]
- Buege, J.A.; Aust, S.D. Microsomal Lipid Peroxidation. Methods Enzymol. 1978, 52, 302–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Magalhães, R.; Guardiola, F.A.; Guerreiro, I.; Fontinha, F.; Moutinho, S.; Olsen, R.E.; Peres, H.; Oliva-Teles, A. Effect of Different Dietary Arachidonic, Eicosapentaenoic, and Docosahexaenoic Acid Content on Selected Immune Parameters in Gilthead Sea Bream (Sparus aurata). Fish Shellfish Immunol. Rep. 2021, 2, 100014. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valero, Y.; García-Alcázar, A.; Esteban, M.Á.; Cuesta, A.; Chaves-Pozo, E. Seasonal Variations of the Humoral Immune Parameters of European Sea Bass (Dicentrarchus labrax L.). Fish Shellfish Immunol. 2014, 39, 185–187. [Google Scholar] [CrossRef] [Scilit]
- Xie, F.; Wang, J.; Zhang, B. RefFinder: A Web-Based Tool for Comprehensively Analyzing and Identifying Reference Genes. Funct. Integr. Genom. 2023, 23, 125. [Google Scholar] [CrossRef] [Scilit]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [Scilit]
- Muyzer, G.; De Waal, E.C.; Uitterlinden, A.G. Profiling of Complex Microbial Populations by Denaturing Gradient Gel Electrophoresis Analysis of Polymerase Chain Reaction-Amplified Genes Coding for 16S RRNA. Appl. Environ. Microbiol. 1993, 59, 695–700. [Google Scholar] [CrossRef] [Scilit]
- Serra, C.R.; Magalhães Júnior, F.; Couto, A.; Oliva-Teles, A.; Enes, P. Gut Microbiota and Gut Morphology of Gilthead Sea Bream (Sparus aurata) Juveniles Are Not Affected by Chromic Oxide as Digestibility Marker. Aquac. Res. 2018, 49, 1347–1356. [Google Scholar] [CrossRef] [Scilit]
- Clarke, K.; Gorley, R.; Somerfield, P.; Warwick, R. Change in Marine Communities: An Approach to Statistical Analysis and Interpretation, 3rd ed.; Primer-E Ltd.: Plymouth, UK, 2014. [Google Scholar]
- El Hafez, M.S.M.A.; Rashedy, S.H.; Abdelmotilib, N.M.; El-Hassayeb, H.E.A.; Cotas, J.; Pereira, L. Fillet Fish Fortified with Algal Extracts of Codium tomentosum and Actinotrichia fragilis, as a Potential Antibacterial and Antioxidant Food Supplement. Mar. Drugs 2022, 20, 785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gómez-Guzmán, M.; Rodríguez-Nogales, A.; Algieri, F.; Gálvez, J. Potential Role of Seaweed Polyphenols in Cardiovascular-Associated Disorders. Mar. Drugs 2018, 16, 250. [Google Scholar] [CrossRef] [Scilit]
- Alghazeer, R.; Ibrahim, A.; Abdulaziz, A.; Abouamer, K. In-Vitro Antioxidant Activity of Five Selected Species of Libyan Algae. Int. J. Med. Pharm. Res. 2016, 4, 1–9. [Google Scholar]
- Regoli, F.; Giuliani, M.E. Oxidative Pathways of Chemical Toxicity and Oxidative Stress Biomarkers in Marine Organisms. Mar. Environ. Res. 2014, 93, 106–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Aal, H.A.H.M.A. Lipid Peroxidation End-Products as a Key of Oxidative Stress: Effect of Antioxidant on Their Production and Transfer of Free Radicals. In Lipid Peroxidation; Intechopen: London, UK, 2012. [Google Scholar] [CrossRef] [Scilit]
- Wu, G.; Fang, Y.Z.; Yang, S.; Lupton, J.R.; Turner, N.D. Glutathione Metabolism and Its Implications for Health. J. Nutr. 2004, 134, 489–492. [Google Scholar] [CrossRef] [Scilit]
- Hoseinifar, S.H.; Fazelan, Z.; Bayani, M.; Yousefi, M.; Van Doan, H.; Yazici, M. Dietary Red Macroalgae (Halopithys incurva) Improved Systemic an Mucosal Immune and Antioxidant Parameters and Modulated Related Gene Expression in Zebrafish (Danio rerio). Fish Shellfish Immunol. 2022, 123, 164–171. [Google Scholar] [CrossRef] [Scilit]
- Rufchaei, R.; Nedaei, S.; Hoseinifar, S.H.; Hassanpour, S.; Golshan, M.; Sayad Bourani, M. Improved Growth Performance, Serum and Mucosal Immunity, Haematology and Antioxidant Capacity in Pikeperch (Sander lucioperca) Using Dietary Water Hyacinth (Eichhornia crassipes) Leaf Powder. Aquac. Res. 2021, 52, 2194–2204. [Google Scholar] [CrossRef] [Scilit]
- Guerreiro, I.; Fontinha, F.; Monteiro, M.; Oliveira, J.; Marçal, R.; Magalhães, R.; Pacheco, M.; Soula, M.; Oliva-Teles, A.; Enes, P.; et al. Towards Sustainable Aquafeeds: Valorization of Codium Sp. and Osmundea Sp. as Functional Ingredients to Enhance Nutrient and Bioactive Compounds in European Seabass. J. Mar. Sci. Eng. 2025, 13, 1884. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Oh, J.Y.; Je, J.G.; Jayawardena, T.U.; Kim, Y.S.; Ko, J.Y.; Fu, X.; Jeon, Y.J. Protective Effects of Sulfated Polysaccharides Isolated from the Enzymatic Digest of Codium Fragile against Hydrogen Peroxide-Induced Oxidative Stress in in Vitro and in Vivo Models. Algal Res. 2020, 48, 101891. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Park, J.; You, S.G.; Hong, S. Immuno-Stimulatory Effects of Sulfated Polysaccharides Isolated from Codium Fragile in Olive Flounder, Paralichthys Olivaceus. Fish Shellfish Immunol. 2019, 87, 609–614. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Lim, J.; Li, C.; Lee, S.; Hong, S. Effects of Sulfated Polysaccharides Isolated from Codium Fragile on Inflammatory Cytokine Gene Expression and Edwardsiella Tarda Infection in Rockfish, Sebastes Schlegelii. Fish Shellfish Immunol. 2021, 112, 125–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Biller-Takahashi, J.D.; Takahashi, L.S.; Mingatto, F.E.; Urbinati, E.C. The Immune System Is Limited by Oxidative Stress: Dietary Selenium Promotes Optimal Antioxidative Status and Greatest Immune Defense in Pacu Piaractus Mesopotamicus. Fish Shellfish Immunol. 2015, 47, 360–367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ayhan, V.; Diler, I.; Arabaci, M.; Sevgili, H. Enzyme Supplementation to Soybean Based Diet in Gilthead Sea Bream (Sparus aurata): Effects on Growth Parameters and Nitrogen and Phosphorus Excretion. Kafkas Univ. Vet. Fak. Derg. 2008, 14, 161–168. [Google Scholar] [CrossRef] [Scilit]
- Monier, M.N. Efficacy of Dietary Exogenous Enzyme Supplementation on Growth Performance, Antioxidant Activity, and Digestive Enzymes of Common Carp (Cyprinus carpio) Fry. Fish Physiol. Biochem. 2020, 46, 713–723. [Google Scholar] [CrossRef] [Scilit]
- Pezeshk, F.; Babaei, S.; Abedian Kenari, A.; Hedayati, M.; Naseri, M. The Effect of Supplementing Diets with Extracts Derived from Three Different Species of Macroalgae on Growth, Thermal Stress Resistance, Antioxidant Enzyme Activities and Skin Colour of Electric Yellow Cichlid (Labidochromis caeruleus). Aquac. Nutr. 2019, 25, 436–443. [Google Scholar] [CrossRef] [Scilit]
- Castro, C.; Coutinho, F.; Iglesias, P.; Oliva-Teles, A.; Couto, A. Chlorella Sp. and Nannochloropsis Sp. Inclusion in Plant-Based Diets Modulate the Intestine and Liver Antioxidant Mechanisms of European Sea Bass Juveniles. Front. Vet. Sci. 2020, 7, 607575. [Google Scholar] [CrossRef] [Scilit]
- Halliwell, B.; Zhao, K.; Whiteman, M. The Gastrointestinal Tract: A Major Site of Antioxidant Action? Free Radic. Res. 2000, 33, 819–830. [Google Scholar] [CrossRef] [Scilit]
- Castro, C.; Peréz-Jiménez, A.; Coutinho, F.; Díaz-Rosales, P.; Serra, C.A.D.R.; Panserat, S.; Corraze, G.; Peres, H.; Oliva-Teles, A. Dietary Carbohydrate and Lipid Sources Affect Differently the Oxidative Status of European Sea Bass (Dicentrarchus labrax) Juveniles. Br. J. Nutr. 2015, 114, 1584–1593. [Google Scholar] [CrossRef] [Scilit]
- Coutinho, F.; Castro, C.; Rufino-Palomares, E.; Ordóñez-Grande, B.; Gallardo, M.A.; Oliva-Teles, A.; Peres, H. Dietary Glutamine Supplementation Effects on Amino Acid Metabolism, Intestinal Nutrient Absorption Capacity and Antioxidant Response of Gilthead Sea Bream (Sparus aurata) Juveniles. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2016, 191, 9–17. [Google Scholar] [CrossRef] [Scilit]
- Bakky, M.A.H.; Yi, P.; Tran, N.T.; Sun, Q.; Zhang, M.; Zhang, Y.; Li, S. Polysaccharide-Induced Immunoregulation, Signaling Pathways, and Stress Mitigation in Aquaculture Animals: A Review. Rev. Aquac. 2025, 17, e70008. [Google Scholar] [CrossRef] [Scilit]
- Ashour, M.; Mabrouk, M.M.; Ayoub, H.F.; El-Feky, M.M.M.M.; Zaki, S.Z.; Hoseinifar, S.H.; Rossi, W.; Van Doan, H.; El-Haroun, E.; Goda, A.M.A.S. Effect of Dietary Seaweed Extract Supplementation on Growth, Feed Utilization, Hematological Indices, and Non-Specific Immunity of Nile Tilapia, Oreochromis Niloticus Challenged with Aeromonas Hydrophila. J. Appl. Phycol. 2020, 32, 3467–3479. [Google Scholar] [CrossRef] [Scilit]
- Cholaraj, R.; Venkatachalam, R. The Effect of Polysaccharide from Padina Boergesenii on Aeromonas Hydrophila Resistance and Growth, Biochemical, Digestive Enzymes, Non-Specific Immune Response in Oreochromis Niloticus. Bioact. Carbohydr. Diet. Fibre 2023, 30, 100357. [Google Scholar] [CrossRef] [Scilit]
- Ponce, M.; Anguís, V.; Fernández-Díaz, C. Assessing the Role of Ulvan as Immunonutrient in Solea Senegalensis. Fish Shellfish Immunol. 2024, 146, 109399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martínez-Antequera, F.P.; Martos-Sitcha, J.A.; Reyna, J.M.; Moyano, F.J. Evaluation of the Inclusion of the Green Seaweed Ulva Ohnoi as an Ingredient in Feeds for Gilthead Sea Bream (Sparus aurata) and European Sea Bass (Dicentrarchus labrax). Animals 2021, 11, 1684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peixoto, M.J.; Svendsen, J.C.; Malte, H.; Pereira, L.F.; Carvalho, P.; Pereira, R.; Gonçalves, J.F.M.; Ozório, R.O.A. Diets Supplemented with Seaweed Affect Metabolic Rate, Innate Immune, and Antioxidant Responses, but Not Individual Growth Rate in European Seabass (Dicentrarchus labrax). J. Appl. Phycol. 2016, 28, 2061–2071. [Google Scholar] [CrossRef] [Scilit]
- Vazirzadeh, A.; Marhamati, A.; Rabiee, R.; Faggio, C. Immunomodulation, Antioxidant Enhancement and Immune Genes up-Regulation in Rainbow Trout (Oncorhynchus mykiss) Fed on Seaweeds Included Diets. Fish Shellfish Immunol. 2020, 106, 852–858. [Google Scholar] [CrossRef] [Scilit]
- Fonseca, F.; Fuentes, J.; Vizcaíno, A.J.; Alarcón, F.J.; Mancera, J.M.; Martínez-Rodríguez, G.; Martos-Sitcha, J.A. From Invasion to Fish Fodder: Inclusion of the Brown Algae Rugulopteryx Okamurae in Aquafeeds for European Sea Bass Dicentrarchus labrax (L., 1758). Aquaculture 2023, 568, 739318. [Google Scholar] [CrossRef] [Scilit]
- Wan, A.H.L.; Davies, S.J.; Soler-Vila, A.; Fitzgerald, R.; Johnson, M.P. Macroalgae as a Sustainable Aquafeed Ingredient. Rev. Aquac. 2019, 11, 458–492. [Google Scholar] [CrossRef] [Scilit]
- Llewellyn, M.S.; Boutin, S.; Hoseinifar, S.H.; Derome, N. Teleost Microbiomes: The State of the Art in Their Characterization, Manipulation and Importance in Aquaculture and Fisheries. Front. Microbiol. 2014, 5, 207. [Google Scholar] [CrossRef] [Scilit]
- Egerton, S.; Culloty, S.; Whooley, J.; Stanton, C.; Ross, R.P. The Gut Microbiota of Marine Fish. Front. Microbiol. 2018, 9, 343795. [Google Scholar] [CrossRef] [Scilit]
- Cerezo, I.M.; Fumanal, M.; Tapia-Paniagua, S.T.; Bautista, R.; Anguís, V.; Fernández-Díaz, C.; Alarcón, F.J.; Moriñigo, M.A.; Balebona, M.C. Solea Senegalensis Bacterial Intestinal Microbiota Is Affected by Low Dietary Inclusion of Ulva Ohnoi. Front. Microbiol. 2022, 12, 801744. [Google Scholar] [CrossRef] [Scilit]
- Tapia-Paniagua, S.T.; Fumanal, M.; Anguís, V.; Fernández-DÍaz, C.; Alarcón, F.J.; Moriñigo, M.A.; Balebona, M.C. Modulation of Intestinal Microbiota in Solea Senegalensis Fed Low Dietary Level of Ulva Ohnoi. Front. Microbiol. 2019, 10, 171. [Google Scholar] [CrossRef] [Scilit]


| Diets | ||||
|---|---|---|---|---|
| CTR | COD | COD30 | COD60 | |
| Ingredients (% dry matter) | ||||
| Untreated C. tomentosum 1 | — | 7.5 | — | — |
| 30 min treated C. tomentosum 2 | — | — | 7.5 | |
| 60 min treated C. tomentosum 2 | — | — | — | 7.5 |
| Wheat gluten 3 | 5.5 | 5.8 | 5.8 | 5.8 |
| Soybean meal 4 | 18.2 | 16.9 | 16.9 | 16.9 |
| Wheat meal 5 | 15 | 8.1 | 8.1 | 8.1 |
| Fish oil | 13.7 | 13.9 | 13.9 | 13.9 |
| Dicalcium phosphate | — | 0.2 | 0.2 | 0.2 |
| Constant components 6 | 47.6 | 47.6 | 47.6 | 47.6 |
| Proximate analysis (% dry matter) and pH | ||||
| Dry matter | 92.4 | 88.4 | 94.1 | 92.3 |
| Protein | 43.5 | 44.9 | 44.1 | 45.4 |
| Lipid | 16.4 | 17.0 | 17.8 | 16.9 |
| Energy (kJ/g) | 23.6 | 24.3 | 21.2 | 23.4 |
| Ash | 5.8 | 8.8 | 10.7 | 9.4 |
| Acid detergent fiber | 3.44 | 3.89 | 2.96 | 3.56 |
| Neutral detergent fiber | 17.2 | 18.2 | 15.7 | 15.9 |
| pH | 5.82 | 5.54 | 6.26 | 6.29 |
| Gene Abbreviation | Prime Sequences (5′→3′) | Primer Efficiency | Anel. Temperature | Accession Number |
|---|---|---|---|---|
| Pro-inflammatory | ||||
| TNF-α | F: AGCCACAGGATCTGGAGCTA R: GTCCGCTTCTGTAGCTGTCC | 1.9 | 60 °C | DQ200910 |
| il-8 | F: GTCTGAGAAGCCTGGGAGTG R: GCAATGGGAGTTAGCAGGAA | 1.9 | 60 °C | AM490063 |
| il-1β | F: GGGCTGAACAACAGCACTCTC R: AAGCTTGCCATCCTTGAAGA | 2.0 | 60 °C | AJ630649 |
| Anti-inflammatory | ||||
| il-10 | F: CGACCAGCTCAAGAGTGATG R: AGAGGCTGCATGGTTTCTGT | 2.0 | 60 °C | DQ821114 |
| cox2 | F: GAGTACTGGAAGCCGAGCAC R: GATATCACTGCCGCCTGAGT | 1.9 | 60 °C | AM296029 |
| Apoptotic | ||||
| casp3 | F: CTGATTTGGATCCAGGCATT R: CGGTCGTAGTGTTCCTCCAT | 1.9 | 60 °C | DQ345773 |
| casp9 | F: GGCAGGACTCGACGAGATAG R: CTCGCTCTGAGGAGCAAACT | 1.9 | 60 °C | DQ345775 |
| Housekeeping | ||||
| EF1α | F: GCTTCGAGGAAATCACCAAG R: CAACCTTCCATCCCTTGAAC | 1.9 | 60 °C | AJ866727 |
| 40S | F: TGATTGTGACAGACCCTCGTG R: CACAGAGCAATGGTGGGGAT | 2.0 | 60 °C | HE978789.1 |
| Diets | SEM | ANOVA p-Value | ||||
|---|---|---|---|---|---|---|
| CTR | COD | COD30 | COD60 | |||
| G6PDH | 1.50 | 1.69 | 1.09 | 0.97 | 0.063 | 0.052 |
| SOD | 686.9 ab | 968.5 b | 856.8 ab | 570.7 a | 28.078 | 0.013 |
| CAT | 550.1 | 563.4 | 566.2 | 522.9 | 9.828 | 0.812 |
| GPX | 13.3 | 12.9 | 14.1 | 13.6 | 0.233 | 0.777 |
| GR | 0.92 ab | 0.89 ab | 1.03 b | 0.85 a | 0.013 | 0.021 |
| LPO | 73.4 ab | 95.7 bc | 102.7 c | 68.1 a | 2.305 | 0.001 |
| tGSH | 87.7 bc | 111.3 c | 76.0 ab | 56.7 a | 2.806 | <0.001 |
| GSH | 32.3 a | 62.4 b | 37.4 a | 42.4 a | 1.704 | <0.001 |
| GSSG | 64.6 b | 48.9 b | 38.5 ab | 18.1 a | 2.736 | 0.002 |
| OSI | 143.0 b | 85.4 a | 94.2 ab | 62.9 a | 4.919 | 0.004 |
| Diets | SEM | ANOVA p-Value | ||||
|---|---|---|---|---|---|---|
| CTR | COD | COD30 | COD60 | |||
| G6PDH | 110.0 | 88.2 | 74.0 | 88.7 | 3.017 | 0.104 |
| SOD | 292.0 ab | 394.9 b | 309.8 ab | 247.1 a | 9.739 | 0.012 |
| CAT | 105.8 | 88.0 | 90.0 | 84.2 | 2.053 | 0.146 |
| GPX | 12.0 | 8.95 | 9.83 | 8.29 | 0.660 | 0.209 |
| GR | 0.16 | 0.18 | 0.15 | 0.17 | 0.005 | 0.598 |
| LPO | 48.7 | 51.3 | 53.2 | 52.9 | 1.028 | 0.477 |
| tGSH | 1585.5 ab | 1789.9 bc | 2011.2 c | 1268.0 a | 40.57 | <0.001 |
| GSH | 1385.3 ab | 1645.6 b | 1726.0 b | 1113.9 a | 38.70 | 0.002 |
| GSSG | 183.6 | 138.3 | 285.2 | 168.2 | 13.57 | 0.139 |
| OSI | 26.1 | 15.0 | 29.2 | 25.2 | 1.809 | 0.417 |
| Diets | SEM | ANOVA p-Value | ||||
|---|---|---|---|---|---|---|
| CTR | COD | COD30 | COD60 | |||
| Peroxidase activity (U mL−1) | 51.4 | 57.9 | 45.9 | 54.8 | 2.620 | 0.855 |
| Antiprotease activity (%) | 70.7 | 71.2 | 68.3 | 68.9 | 0.291 | 0.105 |
| Protease activity (%) | 22.3 | 24.8 | 23.2 | 24.1 | 0.267 | 0.290 |
| Lysozyme (U mL−1) | 2.03 a | 2.15 a | 5.19 b | 3.14 a | 0.257 | 0.010 |
| Diets | SEM | ANOVA p-Value | ||||
|---|---|---|---|---|---|---|
| CTR | COD | COD30 | COD60 | |||
| Digesta | ||||||
| OTUs | 14.3 | 12.3 | 11.3 | 13.0 | 0.409 | 0.349 |
| Richness | 1.51 | 1.34 | 1.24 | 1.43 | 0.041 | 0.426 |
| Diversity | 2.57 | 2.37 | 2.28 | 2.44 | 0.037 | 0.273 |
| Similarity (%) | 61.4 ab | 56.2 a | 81.1 b | 74.2 ab | 2.659 | 0.039 |
| Mucosa | ||||||
| OTUs | 4.00 | 3.33 | 4.33 | 4.00 | 0.105 | 0.085 |
| Richness | 0.37 | 0.29 | 0.41 | 0.37 | 0.013 | 0.081 |
| Diversity | 1.25 | 1.09 | 1.32 | 1.27 | 0.024 | 0.073 |
| Similarity (%) | 97.8 | 92.9 | 90.1 | 95.5 | 0.822 | 0.069 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Ramos-Oliveira, C.; Magalhães, R.; Serra, C.; Belo, I.; Oliva-Teles, A.; Peres, H. Comparative Effects of Untreated and High-Solid Loading Pre-Treated Codium tomentosum on Oxidative and Immune Responses in European Seabass (Dicentrarchus labrax). Fishes 2026, 11, 151. https://doi.org/10.3390/fishes11030151
Ramos-Oliveira C, Magalhães R, Serra C, Belo I, Oliva-Teles A, Peres H. Comparative Effects of Untreated and High-Solid Loading Pre-Treated Codium tomentosum on Oxidative and Immune Responses in European Seabass (Dicentrarchus labrax). Fishes. 2026; 11(3):151. https://doi.org/10.3390/fishes11030151
Chicago/Turabian StyleRamos-Oliveira, Catarina, Rui Magalhães, Cláudia Serra, Isabel Belo, Aires Oliva-Teles, and Helena Peres. 2026. "Comparative Effects of Untreated and High-Solid Loading Pre-Treated Codium tomentosum on Oxidative and Immune Responses in European Seabass (Dicentrarchus labrax)" Fishes 11, no. 3: 151. https://doi.org/10.3390/fishes11030151
APA StyleRamos-Oliveira, C., Magalhães, R., Serra, C., Belo, I., Oliva-Teles, A., & Peres, H. (2026). Comparative Effects of Untreated and High-Solid Loading Pre-Treated Codium tomentosum on Oxidative and Immune Responses in European Seabass (Dicentrarchus labrax). Fishes, 11(3), 151. https://doi.org/10.3390/fishes11030151

