Mechanisms of Laurel (Laurus nobilis) Essential Oil on Oxidative Stress and Apoptosis in Hybrid Grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) During Keep Live Transport

Abstract

Anesthesia has emerged as a critical strategy for maintaining fish viability during transport, with natural anesthetics gaining increasing attention in recent research. The active ingredients in Laurus nobilis L. have antioxidant effects and reduce cell apoptosis. Studies have shown that they can upregulate expression of Nrf2 in mitochondrial biosynthetic factors. This study aimed to investigate the effects of laurel (Laurus nobilis) essential oil on oxidative stress and apoptosis mechanisms during the live transport of hybrid grouper (Epinephelus fuscoguttatus♀ × E. lanceolatus♂). The addition of laurel essential oil during transport activated the Nrf2-Keap1 antioxidant pathway, resulting in up-regulated expression of catalase (cat) and superoxide dismutase (sod) genes. This led to increased enzymatic activity and reduced levels of oxidative stress markers. The mitigation of oxidative stress contributed to physiological stability by downregulating apoptotic gene expression (Bax, Caspase 8), reducing gill and liver tissue damage, and lowering the activity of hepatocyte damage markers aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Metabolomic analysis revealed several key metabolic pathways affected during transport, with the FoxO signaling pathway demonstrating the most significant impact. Within this pathway, reduced glutamate levels appeared to inhibit apoptosis, while decreased ADP and AMP levels potentially influenced antioxidant capacity. The addition of laurel essential oil to transport water proved beneficial in reducing biochemical markers of stress responses in hybrid grouper during keep live transport.

1. Introduction

The hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) is a newly developed hybrid species. Its growth performance exceeds that of its maternal parent, making it one of the most widely farmed fish species in China. Due to its high environmental adaptability, rapid growth rate, nutritional richness, and strong disease resistance, the hybrid grouper has become a key species in the Chinese aquaculture industry, generating significant economic value [1]. The hybrid grouper production in 2023 surpassed 240,000 tons (China Fishery Statistical Yearbook 2024).

Live fish transport is becoming increasingly important in aquatic product trade [2]. The process can induce significant stress in fish, with key environmental factors, including hypoxia, abnormal temperatures, packaging damage, water turbulence, and pressure, playing critical roles [3,4]. Transport-induced environmental stress can lead to the accumulation of reactive oxygen species, which causes oxidative stress [5]. Oxidative stress can result in metabolic disorders and DNA damage in fish, reducing their survival rate [6,7]. Anesthetics, both natural and synthetic types, can reduce metabolic rates, fish activity, oxygen demand, and stress responses, thereby mitigating related adverse physiological reactions [8]. Synthetic anesthetics, such as tricaine mesylate (MS-222) and benzocaine, have been reported to induce corneal damage, stress, excessive mucus production, hyperactivity, and gill irritation [9]. In contrast, natural anesthetics, including essential oils and plants extracts, offer promising alternatives. For example, lemon balm (Melissa officinalis L.) has been shown to enhance survival rates and support the oxidative system during keep live transport [10]. The use of 10 mg/L Ocimum gratissimum L. during transport promotes a sedative effect in Lophiosilurus alexandri, reducing oxygen consumption, ammonia excretion, and biochemical changes while improving protection against oxidative damage [11]. Cinnamomum camphora var. linaloofera Fujita essential oil is as effective as or more effective than MS-222 in anesthetizing and sedating spotted bass and reducing transport stress [12]. Ginger extract and Ocimum basilicum have been demonstrated to alleviate stress in grouper during transport, improve water quality, and reduce energy metabolism [13]. Additionally, the essential oil of Hesperozygis ringens can moderate stress response associated with simulated transport, with 10 this should be µL/L Hesperozygis ringens decreasing cholesterol values, protein, and triglycerides in Oreochromis niloticus immediately post-transport [14].

Laurel (Laurus nobilis) exhibits antimicrobial, antioxidant, and sedative properties [15]. However, the use of laurel essential oil as a sedative substance in fish transport has been less studied. In terms of anesthetic effects, laurel essential oil has been shown to induce anesthetize in the blue dolphin cichlid (Cyrtocara moori) and trout [16]. Zaluzanin C isolated from Laurus nobilis L. inhibited LPS-induced mitochondrial ROS (mtROS) production and subsequent mtROS-mediated NF-κB activity in Kupffer cells and enhanced mRNA levels of Nrf2 in hepatocytes [17]. Many studies have shown that the expression of the Nrf2 and Keap1 genes in grouper is related to antioxidant activity [18,19]. Therefore, the effect of laurel essential oil on the expression of the Nrf2 and Keap1 genes can provide a deeper understanding of the antioxidant activity of laurel essential oil. Currently, research on the anesthetic effects of laurel essential oil on fish and the physiological mechanisms involved have not been sufficiently explored. This study aimed to investigate the combined effects of cold acclimation and laurel essential oil on survival, oxidative stress, and apoptosis in hybrid grouper, while identifying key physiological factors critical to the logistics of preservation.

2. Materials and Methods

2.1. Fish and Laurel Essential Oil

Hybrid groupers (E. fuscoguttatus♀ × E. lanceolatus♂; 700 g ± 50 g) were purchased from the Shanghai Luchao Port (Shanghai, China). Before the experiment, the fish were acclimated to the experimental environment in a 1000 L plastic tank for 24 h at a stocking density of 50 g/L. Environmental conditions refer to the temporary rearing environment for hybrid grouper in other studies: salinity at 20.0‰, water temperature at 23~25 °C, pH at 7.0 ± 0.5, dissolved oxygen at 7~8 mg/L, and a daily water exchange rate of 50% [13].

Laurel essential oil originates from Morocco and is a natural extract. The active ingredients include 35.36% Caryophyllene, 29.48% Eugenol, 7.85% Cinnamaldehyde, 6.56% Linalool, 2.19% α-Terpinyl acetate, 2.36% Caryophyllene oxide, and 1.74% Eucalyptol, which are specific isomers.

2.2. Experimental Design

After two weeks of acclimation, 60 fish were randomly assigned to two groups (

Table 1. Different treatment groups.

Group	Treatment
W	Transport; no additives
WG	Transport + 10 mg/L laurel oil

) and transported for 72 h. Each group consisted of 30 fish, which were randomly distributed into five containers (0.65 m × 0.49 m × 0.43 m), with six fish per container (fish-to-water of 1:4). The different concentrations of laurel essential oil used in this study were selected based on their ability to anesthetize hybrid grouper, and 10 mg/L of lauric essential oil has a better anesthetic effect. After thoroughly mixing the essential oil with Tween 80 and 50% alcohol, it can be added to water.

The fish were placed in a thermostatic shaker to simulate transport at 17 °C and 70 rpm for 72 h, with shaker speeds referenced to the methodology of Fang et al. [5]. The W and WG groups were sampled at 0, 12, 24, 36, 48, 60, 72 h after the simulated transport. At the end of simulated transport, three fish per group were randomly selected for sampling.

After the experiment, 2 mL of blood was collected from the tail vein and allowed to clot without anticoagulant for 6 h at 4 °C [20]. The coagulated blood was centrifuged at 10,951× g at 4 °C for 15 min. Liver tissue from hybrid grouper was collected to measure metabolite levels and mRNA expression. All samples were stored at −80 °C until analysis.

2.3. Methods

2.3.1. Analysis of Relevant Enzyme Activities and Oxidizing Substances

After removing the liver intact, it was immediately placed in a −80 °C ultra-low temperature freezer for storage. The activities of liver catalase (CAT), superoxide dismutase (SOD) (Inhibition percentage: 30% to 70%), malondialdehyde (MDA) and protein carbonyls in liver were measured using commercial test kits (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China).

2.3.2. Serum Biochemical Analysis

After taking blood from the tail of the fish, the serum was separated, and the LDH activity and LAC and COR content were measured. Serum cortisol (COR) (The kit contains reference standards; the detection limit of the kit is 0.5–200 ng/mL; precision: within-batch variation < 10%, between-batch variation < 12%), Lactate dehydrogenase (LDH) (The LDH kit contains reference standards), and L-lactic acid (LAC) (The LAC test kit contains standard samples; the detection limit of the LAC test kit is 0.55–13 mmol/L; precision: repeatability CV ≤ 5%) were determined by commercial test kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

2.3.3. Analysis of Enzymes Related to the Internal Environment

Aspartate aminotransferase (AST) (The AST kit contains reference standards), glutathione S-transferase (GST) (Sample absorbance value < 1), and alanine aminotransferase (ALT) (The ALT kit contains reference standards) in liver, as well as Na⁺/K⁺-ATPase in fish gills, were measured using commercial test kits (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). After removing the second gill arch of the fish, it was immediately placed in a −80 °C ultra-low temperature freezer for storage.

2.3.4. Histological Analysis

The second gill arch was soaked in paraformaldehyde for fixation for light microscopy observation and in 2.5% glutaraldehyde for tissue fixation for scanning electron microscopy observation. The gill tissue structure of hybrid grouper was examined using light microscopy and scanning electron microscopy (SEM), following the methods described by Wang et al. [21].

2.3.5. Transmission Electron Microscopy (TEM)

The liver was soaked in 2.5% glutaraldehyde for tissue fixation for transmission electron microscopy observation. The liver tissue structure of hybrid grouper was observed using transmission electron microscopy according to the methods described by Chen et al. [22].

2.3.6. Real-Time Quantitative PCR (qPCR)

RNA extraction and cDNA synthesis were performed according to the manufacturer’s instructions provided in the RNApure Fast Tissue & Cell Kit (Jiangsu CoWin Biotech Co., Ltd., Taizhou, China). Total RNA was extracted from liver tissue, and 2 μg of RNA was used to synthesize single-stranded cDNA (Jiangsu CoWin Biotech Co., Ltd., Taizhou, China). qPCR analysis was conducted using a 20 μL of reaction mixture (Jiangsu CoWin Biotech Co., Ltd, Wuhan, China). The cDNA loads were normalized using GAPDH as the reference gene. Gene expression levels were calculated using the 2^−ΔΔCT method [23]. Primers sequences for qRT-PCR analysis are listed in

Table 2. Primer sequence for quantitative PCR.

Gene	Forward Sequence	Reverse Sequence	GenBank Accession No.
gst	GGGTCTCCCCTCAAACACATCC	GGACCTGAATGGCTCACTGGAA	XM_033624859.1
gadph	CATCACTGCCACCCAGAAGA	GACAGCTTTAGCAGCACCAGTAGA	[24]
sod	GAGACCAGTGGGACCGTGTATTT	GCATCTTGTCCGTGATGTCTATCTT	AY735008.1
cat	CACATCACCGTCGTCAGGAACTA	CTATCATCCGTACTGATTCCTTGTT	KT884509.1
Nrf2	GTGGCAAGAACAAGGTAGC	GTATTCGGAGGGGGAGTAG	[18]
Keap1	TACGCTGTTTGGACTGCTCT	GCTGGACTCGGTGTTGTTTT	[18]
Bcl-2	CTCCCATCCTCTTTGGCTCTG	ATCGTAGGGCTTTTCGCTTTC
Bax	CGTCCTGAAGAAATCCAAACA	ACTGGGGAAGAATCATCGTG	KP335157.1
Caspase 8	TGCTTCTTGTGTCGTGATGTTG	GCGTCGGTCTCTTCTGGTTG	[25]

.

2.3.7. Nontargeted Metabolomics Analysis in Hybrid Grouper Under Transport Stress

Non-targeted metabolomics analyses refer to Chu et al. [26].

2.4. Statistical Analysis

Statistical analysis was performed using SPSS 25.0 software. One-way ANOVA followed by Tukey’s test and independent samples t-test were employed to analyze the data at a significance level of significance of p < 0.05. Results are presented as mean ± standard deviation in triplicate. Graphs were generated using Origin 2021. Functional pathway enrichment and topological analyses were conducted using MetaboAnalyst 5.0 to identify differential regulated metabolites. The enriched pathways were visualized with KEGG Mapper to explore the differential metabolite–pathway interactions.

3. Results

3.1. Oxidative Stress

The activity of SOD and CAT increased significantly (p < 0.05). The activity of SOD and CAT reached their highest level at 24th h after live transport, which was 13-fold and 2.6-fold higher than before transport, respectively. The superoxide SOD and CAT activities of the WG group were significantly higher than those of the W group, reaching a maximum of 3-fold and 2-fold, respectively, at 24th h after transport. (Figure 1a,b). To further investigate the role of laurel essential oil, the production of oxidative stress markers (MDA and protein carbonyl content) was analyzed. In the WG group, MDA and protein carbonyl levels initially increased during transport, then decreased to their lowest levels at 24th h, followed by a subsequent increase. By 72nd h, these markers showed a more stable trend (p < 0.05). Throughout the transport period, MDA and protein carbonyl levels in the WG group remained significantly lower than those in the W group (p < 0.05) (Figure 1c,d). At 24th h, the MDA and protein carbonyl levels of the W group were 5 and 1.9-fold higher than those of the WG group, respectively. These results indicate that the addition of laurel essential oil enhances antioxidant enzymes activities and reduces oxidative stress in hybrid groupers during keep live transport.

To better understand the mechanisms underlying antioxidant effects, we examined the expression of the Nrf2-Keap1 antioxidant gene pathway. During transport, the expression of cat, sod, and Nrf2 in the WG group showed an overall trend of increasing followed by a decrease, peaking at 24 h, which was 16-fold, 2.4-fold, and 2.8-fold higher than that in the W group, respectively (Figure 1e–g). Keap1 expression in the WG group reached its lowest level at 24th h, 0.4-fold of W Group (p < 0.05) (Figure 1h).

These results suggest that the Nrf2-Keap1 pathway was more actively engaged in the WG group, contributing to enhanced antioxidant capacity during transport.

3.2. Serum Biochemical Indicators

LDH enzyme activity increased in both the W and WG groups during transport up to 24 h, followed by a decline at 6th and 72nd h (p < 0.05) (Figure 2a). The LDH enzyme activity of the 36th h W group was 5-fold higher than that of the WG group. The LAC content of W group was higher than WG group, and was 5-fold higher at 48th h (p < 0.05) (Figure 2b). COR content in both the W and WG groups increased significantly during transport compared to pre-transport (p < 0.05). No significant changes in COR content were observed during the 60 h of transport (p > 0.05). However, the COR content decreased significantly from 60th h to 72nd h (p < 0.05) (Figure 2c).

3.3. Homeostasis of the Internal Environment

To assess the effects of transport stress on the liver tissue in hybrid groupers, this study measured relevant enzyme activities. The AST enzyme activity of the W group and WG group was 2.5-fold and 1.8-fold higher than that before transport at the 12th h of the transport, followed by a significant decrease, and then increased again at 72nd h (p < 0.05). AST activity in the WG group was significantly lower than in the W group (p < 0.05) (Figure 3a). The ALT activity showed a continuous increase within the first 24 h of transport, peaked at 36th h, then declined by 48th h before rising again (p < 0.05). The ALT enzyme activity of the W group was consistently higher than that of the WG group, at 1.5-fold and 1.7-fold at 12th h and 60th h, respectively. In the WG group, GST activity reached its lowest level at 24th h, which was 0.3-fold of that in the W group (p < 0.05). Gill Na⁺/K⁺-ATPase activity can indirectly reflect ammonia nitrogen levels. In this study, the enzyme activity of both the W group and the WG group increased significantly, reaching 8.5-fold and 6.7-fold that of the pre-transport level at 36th h, and then gradually decreased. The enzyme activity was significantly higher in the W group than in the WG group (p < 0.05) (Figure 3d). These results suggested that laurel essential oil could mitigate the adverse effects of the transport environment, including ammonia nitrogen stress.

In addition to investigating the oxidative effects of transport on hybrid grouper, this study also examined the genetic pathways involved in apoptosis, which help fish maintain internal stability under stressful environments. During transport, Bcl-2 expression in the WG group was significantly upregulated within the first 24 h after transport, reaching 2.7-fold that of pre-transport levels (p < 0.05), and then significantly downregulated within 48 h, after which it stabilized. Throughout the experiment, Bcl-2 expression levels in the WG group remained significantly higher than those in the W group, reaching a maximum of 2.7-fold at 24th h (Figure 3e). Bax expression in the WG group was 0.4-fold of that before transport at 12th h after transport (p < 0.05), then remained stable and was 0.5-fold of that before transport at 72nd h (p < 0.05). (Figure 3f). Caspase 8 expression in the WG group was downregulated to 0.2-fold of that before transport at 24th h after transport, upregulated to 0.7-fold of that before transport at 60th h, and then downregulated again to 0.3-fold of that before transport at 72nd h. (Figure 3g). These findings suggested that laurel essential oil can reduce apoptosis and help maintain the physiological stability of transported fish. The expression pattern of the gst gene in the WG group was consistent with the activity pattern of the corresponding enzyme. However, the expression level of gst in the W group was consistently higher than that in the WG group, reaching a maximum of 1.7-fold at 24th h. (Figure 3h).

3.4. Stress in Gill Filaments

The gill tissue structure provides a more intuitive response to the effects of transport on the gill tissue. Histological evaluation of H&E-stained gill tissues was performed using a light microscope after 36 h and 72 h of long-distance keep live transport. The gill filaments at 0 h were elongated, evenly distributed, and tightly arranged, and exhibited normal histomorphology. Epithelial cells remained undamaged, with mitochondria-rich moderately distributed and primarily concentrated at the base of the secondary gill lamellae. In the W group, gills at 36th h of transport showed had swollen epithelial cells, shortened gill filaments, reduced spacing between gill filaments, and fewer mitochondria-rich cells (Figure 4a). At 72nd h (Figure 4c), gill tissues exhibited more severe adverse changes, including epithelial cell hyperplasia compared to the 36th h time point. In the WG group, gill damage during transport mirrored the W group but was less severe. However, after 72 h of transport (Figure 4d), adverse changes in the WG group became more pronounced compared to those observed at 36 h (Figure 4b).

As shown in Figure 4b, the gills at 0 h exhibited an intact laminar epithelium, with secondary lamellae evenly distributed. In the W group, gill tissues at 36 h displayed mild epithelial sloughing, reduced lamellar gaps, and hypertrophied secondary lamellae in the primary gill laminar (Figure 4A). By 72 h, gills damage in the W group worsened compared to the 36 h (Figure 4C), with more pronounced epithelial degeneration and structural disorganization. In the WG group, gills at 36 h showed reduced lamellar gaps and hypertrophied secondary lamellae (Figure 4B), but these changes were significantly less severe than those observed in the W group at the same time point. By 72 h, gills damage in the WG group was more pronounced compared to 36 h but remained less severe than the damage observed in the W group at 72 h (Figure 4D). These findings indicate that the addition of laurel essential oil mitigated adverse histological changes in gill tissue during keep live transport

3.5. Electron Micrographs of Livers

Hepatic histology showed intact cellular morphology with well-defined boundaries in hybrid grouper before transport. The nuclei were elliptical in shape, and normally structured mitochondria were distributed throughout the cytoplasm. Clusters of abundant glycogen granules were observed near the plasma membrane (Figure 5a–c). In the WG group after 72 h of transport, cellular alterations were evident, including reduced nuclear pore density, mitochondrial swelling, and cristae fragmentation (Figure 5d–f). In contrast, the W group exhibited more severe ultrastructural damage, such as intercellular fusion, enlarged nucleoli, pronounced mitochondrial swelling with complete cristae loss, and mitochondrial fusion. Glycogen reserves were also significantly depleted in the W group (Figure 5g–i). These pathological changes indicate that laurel essential oil helps mitigate transport-induced disruptions in energy metabolism and reduces hepatic tissue damage in hybrid grouper. Overall, the findings suggest that laurel essential oil supplementation is effective in alleviating the adverse liver tissue changes.

3.6. Analysis of Metabolic Pathway

KEGG analysis plays a crucial role in elucidating potential metabolic pathways. The analysis identified and filtered 20 high-impact pathways (Figure 6a,d,g). The enriched pathways revealed significant metabolic changes after 72 h transport. Specifically, both the FoxO signaling pathway and alanine/aspartate/glutamate metabolism showed prominent enrichment in W and WG groups (72 h vs. 0 h), while oxidative phosphorylation emerged as a critical differentiating pathway between WG and W groups at 72 h. As illustrated in Figure 6b,c,e,f,h, transport significantly affected key metabolites, including glutamate, ADP, AMP, adenylosuccinate, fumarate, 2-oxoglutarate, L-glutamine, L-glutamate, and L-1-pyrroline-5-carboxylate in both W and WG groups, after 72 h. Notably, succinate and PiADP exhibited treatment-specific variations. These metabolites are strongly linked to energy production, oxidative stress, and apoptosis, all critical factors affecting hybrid grouper survival during transport. Among these, glutamate and ADP functioned as central nodes within the metabolic networks. In summary, the dynamic changes of these metabolites across the three core pathways establish a comprehensive framework for evaluating energy metabolism, antioxidant capacity, and apoptotic regulation in hybrid grouper under transport stress.

4. Discussion

Extensive research has demonstrated that fish exhibit significant stress responses during initial phases of transport; these responses gradually diminish as transport duration increases, while their capacity for self-recovery improves. Mortality occurs when stress exceeds a critical threshold [27].

It is well established that numerous regulators significantly influence intracellular antioxidant defense functions [28]. The Nrf2 transcription factor serves as a key regulator of antioxidant enzymes expression, mediating this control through binding to enhancer sequences called “antioxidant response elements” (AREs) [29]. Under oxidative stress conditions, chemopreventive compounds (H₂O₂, O²⁻, etc.) suppress the activity of Keap1-Cul3-Rbx1 E3 ubiquitin ligase, leading to elevated Nrf2 levels and activation of other oxidative response genes. During initial transport phases, laurel essential oil likely inhibits Keap1 expression in hybrid grouper while activating the Nrf-2 gene and other antioxidant genes (including cat and sod). Gene regulation enzyme activity, addition of lauric essential oil antioxidant enzyme CAT, and SOD enzyme activity peaked at 24th h. concurrent with minimal oxidative markers (MDA and carbonyl protein) levels. Subsequently, antioxidant efficacy declined while oxidative markers concentrations increased. The initial antioxidant enhancement may correlate with paradoxical excitation induced by laurel essential oil anesthesia [30]. However, prolonged oxidative stress likely depleted enzymatic reserves and energy stores, resulting in reduced enzyme activity during later transport stages. As cellular redox homeostasis is reestablished, Keap1 translocates to the nucleus, causing Nrf2 dissociation from ARE [31].

LDH catalyzes the interconversion of pyruvate to lactate, with serum LDH activity serving as a recognized stress indicator [13]. LAC functions not only as a crucial energy substrate but also an important signaling molecule for both the central nervous system and peripheral organs [32,33]. During transport, the WG group exhibited significantly lower LDH activity and LAC concentration compared to the W group. This reduction likely stems from diminished energy metabolism and decreased pyruvate availability, ultimately leading to reduced LAC synthesis. This may be due to reduced energy metabolism and low levels of pyruvic acid, resulting in a decrease in synthesized LAC levels. The observed LAC reduction may influence nervous system excitability, suggesting laurel essential oil possesses sedative properties. COR represents a primary physiological stress marker in fish [34,35]. Our results showed elevated COR levels in hybrid grouper following transport, consistent with the rapid corticosteroid secretion from the hypothalamus in response to stress stimuli [36]. Notably, the WG group demonstrated substantially lower serum COR levels than the W group, confirming the beneficial effects of laurel essential oil on hybrid grouper transport.

ALT and AST serve as reliable markers of hepatocellular injury, with elevated levels correlating with increased liver-related mortality [37,38]. GST plays a crucial role in xenobiotic detoxification [39]. We observed substantial reductions in AST and GST activity at 24th h during keep live transport, followed by decreased ALT activity at 36th h. Throughout transport, enzyme activities remained consistently lower in the WG group compared to the W group. These findings indicated that liver tissues damage in hybrid grouper was mitigated during 24 h–36 h through physiological adaptations, and reduced oxidative processes resulted in decreased production of toxic metabolites. Subsequently, probably due to diminished oxidative capacity oxidation resulting in toxic metabolite accumulation or prolonged drug exposure causing hepatic impairment [40], both the GST enzyme activity and gene expression were elevated. The inclusion of laurel essential oil proves advantageous for safeguarding liver tissue and diminishing toxic metabolite generation. Na⁺/K⁺-ATPase establishes an electrochemical gradient across the cellular membrane that is vital for sustaining signal transduction, cellular volume regulation, and secondary active nutrient transport [41]. These findings indicated that deteriorating conditions, particularly the accumulation of ammonia and nitrogen compounds coupled with declining oxygen availability, negatively impacted gill tissue function, prompting enhanced Na⁺/K⁺-ATPase activity that required greater ATP expenditure to sustain ionic transport processes [42,43]. Subsequently, enzymatic activity diminished as energy metabolism declined and ATP reserves became depleted [44]. Laurel essential oil treatment appears to mitigate environmental stress perception in hybrid grouper, thereby alleviating physiological stress responses.

Apoptosis is a hallmark feature of multi-cellular n organisms, playing essential roles in development, tissue homeostasis, and the removal of damaged or unnecessary cells [45]. Anti-apoptotic Bcl-2 homologs, including Bcl-w, Bcl-2, A1/Bfl-1, and Bcl-xL, inhibit Bak and pro-apoptotic Bax, the latter of which acts through oligomerization and perforation of outer mitochondrial membrane to facilitate cytochrome c release and subsequent caspases activation [46]. During transport, the expression of Caspase 8 and Bax was down-regulated compared to the control group, while Bcl-2 expression was up-regulated, peaking at 24 h. In the WG treatment group, Bcl-2 expression was further enhanced, whereas Bax and Caspase 8 expression was suppressed. Chlorogenic acid up-regulated Bcl-2, down-regulated Bax, and alleviated apoptosis of Amur ide cells induced by lipopolysaccharide [47]. The 10 mg/L lauric essential oil was able to alleviate cell apoptosis, demonstrating its potential to mitigate the pressures of unfavorable environments.

The gill mediates crucial physiological functions, including respiration, excretion, feeding, osmoregulation, and acid-base balance, that are affected by pathological alterations in gill tissues [48]. During transport, morphological changes occur in hybrid grouper gills, including swelling of epithelial cells, shortening of gillets, fewer mitochondria-rich cells, epithelial sloughing, reduced lamellar gaps in the primary laminar epithelium, and hypertrophy of the secondary lamellae. Damage severity increased proportionally with transport duration, while the WG group displayed significantly attenuated pathology compared to W group. Dar, et al. also found stress-dose-dependent gill damage in common carp (Cyprinus carpio). Similarly, Fang et al. [13] documented progressive gill remodeling in transported groupers, potentially representing an adaptive response to enhance oxygen uptake through filament proliferation. WG group demonstrated notable stress-mitigating effects, reducing both oxidative damage and metabolic disturbance in transported hybrid grouper.

Hepatocytes play critical roles in detoxification, protein synthesis, and metabolic regulation [49,50]. Post-transport observations revealed pathological changes in nuclei and mitochondria compared to pre-transport conditions, likely resulting from transport-induced stress responses that caused hepatocellular damage [51]. These alterations may also be associated with apoptosis suppression during transport [52]. Another possible explanation involves the metabolic overload from processing and excreting toxic metabolites. The reduced severity of hepatocellular lesions in the WG group suggests that essential oil treatment provides protection against transport stress. Following 72 h transport, the W group exhibited significantly greater depletion of hepatic glycogen granules in comparison with the WG group. These results corroborate the findings of Chen et al. [22], suggesting that laurel essential oil effectively suppressed metabolic activity in hybrid grouper during low-temperature transport, whereas the W group compensated by increasing hepatic glycogenolysis to maintain energy homeostasis.

The Forkhead box (Fox) family of transcription factors are evolutionarily conserved across species from yeast to humans. In Drosophila, FoxO promotes apoptosis through upregulation of pro-apoptotic factors, including B-cell lymphoma-2-like 11 (BIM), TRAIL, and Darley-like protein (DLP). This action has been found in various kinds of cells, including granule cells, Drosophila cells, tumor cells, and neurons [53]. The study suggested that reduced glutamate levels in the FoxO signaling pathway ultimately induce apoptosis, while FoxO can also exert anti-apoptotic effects through upregulation of survival genes.

In this study, the gene expressions of Bax and Caspase 8 of both WG and W group at 72 h were downregulated compared to those at 0 h, while Bcl-2 expression was upregulated. These gene expression patterns mirrored the observed changes in glutamate levels, consistent with the previous findings of Ma et al. [54]. At the molecular level, both AMP and ADP activate AMPK through binding to its CBS domain. As a central metabolic regulator, AMPK orchestrates numerous metabolic processes. AMPK specifically induces FOXO phosphorylation, which subsequently enhances the expression of multiple antioxidant genes [55,56]. Nrf2, a redox-sensitive transcription factor, may serve as a target of AMPK to initiate antioxidant responses [57]. During hybrid grouper transport, prolonged fasting caused nutrients deficiency that reduced ADP and AMP levels. The decrease in both ADP and AMP resulted in diminished AMPK activity, subsequently lowering sod and Nrf2 gene expressions, and ultimately reducing SOD enzyme activity. KEGG pathway enrichment analysis of the WG and W groups during transport revealed that oxidative phosphorylation played a critical role. Succinate may function as a metabolite marker for inflammation-related renal oxidative stress and associated cardiac co-injury. The high-energy electron flavin adenine dinucleotide generated from succinate can enter the electron transport chain at multiple sites, contributing to mitochondria ROS production [58]. Laurel essential oil supplementation increased succinic acid levels in hybrid grouper, probably by stimulating mitochondrial ROS production through succinic acid and enhancing the antioxidant capacity of the fish. These effects resulted in elevated antioxidant enzyme activity and up-regulated expression of antioxidant genes. Succinate is transformed into fumarate through the succinate dehydrogenase reaction. Consequently, after 72 h of transport, WG-treated hybrid grouper likely displayed enhanced immune activity and reduced energy metabolism compared to the W group.

In the alanine, aspartate, and glutamate metabolism pathway, reduced levels of adenylosuccinate, fumarate, 2-oxoglutarate, L-glutamate, L-1-pyrroline-5-carboxylate, and L-glutamine were observed. These metabolites are closely associated with energy metabolism, demonstrating that hybrid grouper experienced significant suppression of energy metabolism during the 72 h transport. This metabolic depression likely resulted from both temperature-induced reduction in energy expenditure and prolonged fasting during extended transport conditions.

5. Conclusions

This study used enzyme activity assays, gene expression analysis, histology, and metabolomics to examine how laurel essential oil protects hybrid grouper during transport. Results showed laurel essential oil reduced stress markers and maintained energy metabolism. It also lowered apoptosis and reduced gill and liver damage. These findings support using laurel essential oil to improve stress management in fish transport systems.