L-Arginine Effect as an Additive on Overall Performance, Health Status, and Expression of Stress Molecular Markers in Nile Tilapia (Oreochromis niloticus) Under Chronic Salinity Exposure

Abstract

Growing freshwater fish in saline environments is being explored as a potential solution to the freshwater shortage. However, growing these organisms in suboptimal salinity conditions leads to chronic stress that can be challenging to manage. To address this goal, it is crucial to improve the health of fish through the use of dietary supplements. This study evaluated the effects of varying levels of arginine supplementation on the growth, health status, and expression of stress-related molecular markers in juveniles of Nile tilapia exposed to chronic salinity stress. The tilapia were fed four experimental diets supplemented with 0, 1, 2, and 3% of L-arginine (T0, T1, T2, and T3). After an acclimatization period, the tilapias were exposed to a salinity level of 20‰ for 57 days in a recirculating aquaculture system. Our findings revealed that overall performance parameters were significantly influenced by L-arginine supplementation, except for the condition factor, viscerosomatic index, and hepatosomatic index. Additionally, intermediate levels of L-arginine supplementation positively influenced various blood parameters, including hematological profiles (hemoglobin and leukocytes), blood chemistry (total protein, albumin, globulin, and triglycerides), and the frequency of certain nuclear abnormalities. Furthermore, L-arginine supplementation appeared to regulate the expression of molecular markers related to stress and the immune system. In conclusion, this study indicates that L-arginine supplementation can help alleviate the chronic stress caused by salinity in juvenile Nile tilapia.

1. Introduction

Climate change and population growth have recently been identified as two of the world’s most pressing challenges [1,2]. These issues contribute to a range of related problems that impact human well-being, including water shortage, ocean acidification, and food insecurity [1,2,3]. To address these challenges, international organizations such as the United Nations (UN) and the Food and Agriculture Organization (FAO) have proposed specific solutions. These include the implementation of aquaculture practices, which have the potential to address food security issues by providing high-quality meat at a low cost [1,4].

Aquaculture can be developed in various regions, utilizing both natural and artificial bodies of water [1,4,5]. However, this practice may be counterproductive in areas facing water shortages. Therefore, the goal should be to expand mariculture and promote aquaculture development in coastal areas [1,2,3,4,5,6]. The four species that are most commonly produced and consumed around the world are white-legged shrimp (Penaeus vannamei), oysters (Crassostrea spp.), Chinese carp (Ctenopharyngodon idella), and Nile tilapia (Oreochromis niloticus) [1]. However, the latter two are freshwater organisms [1].

The culture of tilapia and its hybrids in brackish and high-salinity waters is feasible, which opens up tropical and arid coastal areas to tilapia production and could significantly expand global production of this important group of species [7]. Among the aquaculture organisms, Nile tilapia stands out due to its versatility in feeding, low maintenance cost, rapid growth, wide adaptability to adverse conditions, tolerance for a broad range of temperatures, and easy reproduction [8,9,10]. While Nile tilapia is primarily a freshwater fish with an optimum salinity level of 0–8 parts per thousand (‰), it can thrive in waters with salinities up to 20‰ and shows remarkable tolerance at even higher salinity levels [7,10,11,12,13,14]. Under a pre-acclimation period and gradual increase in salinity, Nile tilapia could tolerate salinity over 30‰ [7,10,11,12,13,14]. However, to survive in elevated salinities, Nile tilapia require a higher protein intake [7,14,15]; in addition, it can be stressful [15,16,17]. Prolonged exposure to suboptimal or elevated salinity levels has been documented to lead to increased cortisol and glucose levels, along with reduced growth and survival rates [16,17,18,19]. Furthermore, freshwater organisms, when kept at salinity levels that exceed their optimal range, experience chronic stress [17,18,20,21].

Chronic stress in aquaculture is considered particularly detrimental because it requires a significant amount of energy from the organisms [20,21,22,23], which can compromise their overall performance. The consequences of this energy demand may include tissue damage, alteration in metabolic processes, reduced growth, changes in the antioxidant system, weakened immune response, and death in severe cases [19,20,21,22,23]. To mitigate these adverse effects, researchers have sought to implement dietary additives that help organisms cope with challenging conditions [23,24,25].

Dietary additives are additional components added into the diet that are not classified as but are included in smaller amounts to provide beneficial effects on the organism [23,25,26]. Some of the most studied dietary additives include vitamins, minerals, certain amino acids, and fatty acids [23,24,25,26,27]. Amino acids play a crucial role not only in constructing tissues but also in various metabolic processes. Consequently, there is increasing interest in using amino acids as dietary additives to enhance stress resistance.

Certain amino acids, including tryptophan, phenylalanine, methionine, taurine, glutamine, glycine, and arginine, have gained attention for their ability to mitigate the harmful effects of various stressors [25,27,28,29]. Arginine in particular plays a crucial role, being essential in protein synthesis, such as the production of important hormones (growth hormone, GH, and insulin-like growth factor 1 (IGF-1) [29]). Additionally, it works as a precursor of nitric oxide, which modulates blood circulation and enhances the viability of ATP production through phosphagen kinase. It also plays an indirect role in energy storage via gluconeogenesis [25,28,29]. Furthermore, arginine helps modulate immune responses, supports the antioxidant system, and reduces serum lipid levels [25,29,30,31,32,33,34,35,36,37,38,39].

The use of arginine as a dietary additive has been shown to enhance resistance to stressors in several species, including Chinese mitten crab (Eriocheir sinensis) [33] (stressed by high pH), Mrigal carp (Cirrhinus mrigala) [32] (stressed by hypoxia), turbot (Scophthalmus maximus) [37] (stressed by hypoxia and handling), Senegalese sole (Solea senegalensis) [34], Nile tilapia (Oreochromis niloticus) [40] (stressed by Streptococcus agalactiae), and common carp (Cyprinus carpio) [41] (stressed by ammonia toxicity). Additionally, arginine supplementation has been investigated regarding fatty acid oxidation [38,39], as well as its impact on hematological parameters, antioxidant levels, and immune system function [40,42,43]. Nevertheless, it remains unclear to what extent dietary supplementation with L-arginine may provide similar benefits to Nile tilapia cultured in brackish water.

Therefore, this study aims to assess the effect of varying levels of L-arginine supplementation on growth, health status, and the expression of molecular markers related to stress and immune system function in Nile tilapia exposed to chronic saline stress.

2. Materials and Methods

2.1. Experimental Design

The Nile tilapia (Oreochromis niloticus) juveniles were donated by an Aquamol aquaculture producer in Jamay, Jalisco. México. The experiment was conducted at the Instituto de Investigaciones Oceanológicas at the Universidad Autónoma de Baja California (IIO-UABC, Ensenada, B.C., México). A total of 25 juveniles per tank were randomly distributed. The juveniles (4.04 ± 0.72 g) were acclimatized to 20‰ over 4 days, with an increase of 5‰ per day. The experimental system consisted of 12 tanks, 500 L each, connected to a recirculation system (RAS) under a constant aeration system. The RAS system was integrated by a biofilter (PolyGeyser^®; Pneumatic Drop Bead Filter model PG7 International Filter Solutions, Midland, TX, USA), a protein skimmer, a UV lamp, settlers in each tank, and a 1000-L reservoir with a heater at constant temperature (27.41 ± 0.9 °C). Dissolved oxygen was monitored daily with a multi-parameter (YSI-55, YSI Inc., Yellow Springs, OH, USA), registering 8.0 ± 0.2 mg/L. The salinity was monitored with a portable refractometer (Portable refractometer WL0020-ATC, Agriculture Solutions LLC, Kingfield, ME, USA) and registered 20.5 ± 2.5‰. Ammonium (0.05 ± 0.1 mg/L) and nitrite (0 ± 0 mg/L) levels were monitored once a week (API test kits, Mars Fishcare Inc., Chalfont, PA, USA). The tanks were siphoned daily, whereas the RAS system was backwashing once a week. During the acclimatization period, the fish were fed the control diet (T0). After acclimatization was completed. The other treatments were supplied for the start of the feeding trial (

Table 1. Ingredient composition and proximate analysis of experimental diets with different arginine levels to feed Nile tilapia (Oreochromis niloticus). The arginine content in the diet was calculated from the arginine content of the ingredients, which LINDEAACUA previously analyzed.

Treatments
Ingredients	T0	T1	T2	T3
Poultry byproducts meal (68% CP) a	10	10	10	10
Bovine byproducts meal (50% CP) a	10	10	10	10
Fish meal (70% CP) b	24	24	24	24
Corn gluten meal (65% CP) c	10	10	10	10
Corn starch d	28.3	28.3	28.3	28.3
Glycine e	3	2	1	0
Arginine e	0	1	2	3
Beef tallow f	2.5	2.5	2.5	2.5
DHA Nature TM (24% DHA) g	5	5	5	5
Gelatin h	2.5	2.5	2.5	2.5
Methionine e	1	1	1	1
Rovimix i	3	3	3	3
Taurine j	0.1	0.1	0.1	0.1
Stay c k	0.5	0.5	0.5	0.5
TOTAL	100	100	100	100
Arginine on diet (%)	2.6	3.6	4.6	5.6
Arginine on crude protein (%)	4.3	5.91	7.54	9.16
Proximal composition (%)
Crude protein	45.72	45.52	44.92	45.83
Crude fat	10.40	10.57	10.35	10.46
Ash	10.58	10.06	10.06	10.23
NFE	34.95	33.85	35.16	33.46

NFE (%) = 100 − (% crude protein + % crude fat + % ash). ^a Pet food grade (65% CP) Scoular de México S. de R.L. de C.V. Originally from the USA (National Renderers Association); ^b Baja Marine Foods S.A.P.I. de C.V., El Sauzal de Rodríguez, Ensenada, Baja California, México; ^c INGREDION S.A. de C.V., México, 65% CP; ^d Maicena™, Unilever Food Solutions, México; ^e Future Foods, México; ^f Kindly donated by Grasas y Derivados de Tijuana; ^g kindly donated by ADM; ^h Progel Mexicana SA de CV, León, Guanajuato, México (commercial grade, 85% CP); ⁱ la vitamin and mineral mixture from DSM; ^j NUBIOT S.A. de C.V., Mexico; ^k Stay C from DSM.

). The experimental diets were fed four times a day (8:00, 11:00, 14:00, and 17:00 h) seven days a week, at apparent satiety.

2.2. Experimental Diet Design

Four isoproteic diets, each containing 45% crude protein and 10% crude lipid, were formulated as shown in Table 1. The crude protein requirements were adjusted according to those recommended by [8,14,15,16] for organisms of the same species in the 0.02–10 g range. The diets varied based on the levels of arginine included, with glycine (Gly) as a replacement. The diets were assigned as follows: T0 (control diet), T1 (1% arginine), T2 (2% arginine), and T3 (3% arginine). The selection of concentrations/percentages of dietary arginine addition was based on the optimal intake of Nile tilapia under unstressed conditions and the maximum dietary supplementation ranges reported for other fish species [8,35,36].

Diets were prepared at the LINDEAACUA plant at the II0-UABC facilities (Ensenada, Mexico), according to their internal protocols. Macronutrients were ground to 0.5 mm (Inmimex M-300, Tlaxcala, Mexico) and sieved (Kemutek-Gardner K300, Bristol, PA, USA). Mixing was then performed in a vertical cutter/mixer (Robot Coupe R-60, Ridgeland, MS, USA). Incorporation was performed in four steps. The first consisted of the incorporation of the macronutrients, the second consisted of the incorporation of the micronutrients and arginine/glycine, the third consisted of the gelatin and cooked starch, and the last consisted of the incorporation of the fat source (beef tallow). The dough was mixed until a homogeneous mixture was achieved. It was then pelletized to 5 mm in a commercial feed mill (Tor-Rey, model M32-5, San Nicolas, Mexico). They were dried in a forced air oven at 60 °C for 24 h and stored at 4 °C in plastic bags.

2.3. Proximal Composition

Experimental diets were analyzed in triplicate according to AOAC [44]. The dry weight of the diet was determined by the gravimetric method, drying the samples at 60 °C for 24 h. After that, the samples were ashed in a muffle furnace (Thermolyne 62700 muffle furnace) at 550 °C for 6 h and then weighed. Crude protein was determined by the micro-Kjeldahl method (rapid distillation unit, Labconco, Kansas City, MO, USA), and a nitrogen conversion (N*6.25) was made to calculate the protein content. Crude lipid was extracted and quantified by the Soxhlet method (Labconco, Kansas City, MO, USA), using petroleum ether as the solvent carrier. Finally, the nitrogen-free extract (NFE) was determined by the difference.

2.4. Sampling

Following a 57-day feeding trial, the organisms were quantitatively assessed and weighed. These data were used for the quantification of the following metrics.

Specific growth rate (SGR, %/d) = 100 × ((ln final weight–ln initial weight) × days)

Feed conversion ratio (FCR) = total feed consumed/wet weight gained

Condition factor (CF) = (final body weight/total body length³) × 100

Survival rate (SR, %) = Final number of fish × 100/initial number of fish

At the end of the biometry, three organisms per tank were euthanized according to UABC protocols for the utilization of animals for experimental purposes. The process to anesthetize fish was carried out with 2-phenoxyl-ethanol (100‰) at a dilution of 0.5 mL/L. A blood sample was collected from the caudal vein using tuberculin syringes (1 mL). The blood sample was subsequently divided into three parts: a tube with EDTA-K2 (Becton Dickinson^®, Gurgaon, Haryana) for hematological analysis, a 1.5 mL microcentrifuge tube (Eppendorf^®, Hamburg, Germany) for blood chemistry, and a drop in an object holder for blood smears (hematology). The sample without anticoagulant was centrifuged at 7000 rpm for 10 min. Subsequently, the serum was stored at −20 °C. Following the collection of blood samples, the organisms were dissected to quantify morphometric parameters.

Hepatosomatic index (HSI, %) = (liver weight/body weight) × 100

Viscerosomatic index (VSI, %) = (visceral weight/body weight) × 100

A tissue sample of approximately 1 cm³ was extracted from the liver and transferred into a centrifuge tube free of RNAases, containing RNA later (Ambion, Leicestershire, UK). The tubes were left at room temperature for 24 h and then stored at −80 °C.

2.5. Hematology Assay

The blood from the EDTA tube was used to calculate the hemoglobin (Hb), hematocrit (Hct), and blood cell count. The Hct was estimated using a 2/3 filled capillary tube (Leex Equipment, Santiago de Querétaro, Mexico). The tubes were sealed and placed in a micro-hematocrit centrifuge at 7000 rpm (Premiere^® XC-3012, Jalisco, Mexico) for 10 min. The packed cells were measured using the hematocrit reader and reported as percentages [45]. The Hb was measured using the HemoCue ^® Hb 201 (HemoCue AB; Angelholm, Sweden). Red blood cell (RBC) and white blood cell (WBC) counts were made with the Natt–Herrick method [46]. The blood sample was then placed in a Neubauer hemocytometer (Marienfeld-Superior, Lauda-Königshofen, Germany) using 20 μL of blood mixed with the Natt–Herrick solution in a 1:200 ratio, and the cells were counted using an optical microscope (Karl Zeiss, Primo Star, Coyoacán, México) at 40×. The mean corpuscular volume, mean corpuscular hemoglobin, and mean corpuscular hemoglobin concentration were calculated using standard formulas with data from Hct, RBC, and Hb.

Mean corpuscular volume (MCV, fL) = (Hct/RBC) × 10

Mean corpuscular hemoglobin (MCH, pg) = (Hb/RBC) × 10

Mean corpuscular hemoglobin concentration (MCHC, g/dL) = (Hb/Hct) × 100

For leukocyte cellular differentiation and micronucleus assay, we use the samples of the blood smears and implement the method of [45,46,47,48]. The staining was made with the Hemocrom-Fix kit^®, following the manufacturer’s instructions. Blood smears were mounted with Cytoseal™ 60 resin and observed in an optical microscope. From each blood smear, the percentage of each of the leukocyte cellular types was calculated.

Nuclear morphological alterations in erythrocytes were classified as follows: blebbed, notched, and binucleate. Only erythrocytes with intact nuclear and cytoplasmic membranes were taken into account, discarding those superimposed or damaged.

2.6. Serum Biochemical Parameters

The serum biochemical parameters assay was calculated using colorimetric kits (MexLab Group, Jalisco, Mexico) following the manufacturer’s instructions. Total protein was determined with the Biuret method at 540 nm. Albumin was determined using the bromocresol green method (BCG) at 620 nm. The glucose oxidase method (GOD-PAP) was measured at 505 nm for glucose concentration. While the triglycerides assay was performed with the glycerol-3-phosphate-oxidase method (GPO-PAP) at 505 nm, and cholesterol was analyzed with cholesterol esterase (CHOD-PAP) at 505 nm. The globulin was calculated by the contrast of total protein and albumin. All blood parameters analyzed in each sample were performed in triplicate, and the reader used a microplate reader (Multiskan GO, Thermo Scientific).

2.7. RNA Extraction and Quantitative PCR

The protocols followed for the RNA extraction and qPCR are described in detail in [49]. The liver tissue preserved in RNAlater was individually analyzed to extract the RNA with the PureLink RNAlink Minikit (Ambion). To homogenize the tissue, a micropistill was used. The quantity and quality of RNA were measured by spectrophotometry (Nanodrop^® LITE, Thermo Fisher Scientific Inc., Wilmington, DE, USA). Only the samples with an optical density ratio of 260 at 280 nm within the range of 1.90 to 2.10 were used.

The RNA extracted (500 ng) was reverse-transcribed with the High-Capacity cDNA reverse transcription kit in a 20 µL reaction, according to the manual (Applied Biosystems; Carlsbad, CA, USA).

The qPCR reaction was performed using the SYBR^® Select Master Mix (Applied Biosystems). PCR conditions were 10 min at 95 °C for an initial denaturation and polymerase activation step; 40 cycles of denaturation at 95 °C for 15 s; in the annealing and extension step, the temperature was 60 °C for 45 s; and the melting curve was from 60 °C to 95 °C for 20 min. The relative gene quantification was calculated using the 2^−ΔΔCT Method [49]. Primer efficiency was determined by five 1:10 dilution series. The specific primers used in this study are shown in

Table 2. Primer sequences used for the real-time PCR.

Gene	Forward Sequence (5′-3′)	Reverse Sequence (5′-3′)	e	NCBI Reference
hsp 70	CCGGTTTGATGACACAGTTG	CGAGGTAGGCTTCAGCAATC	0.94	XM_023404852
sod	GACGTGACAACACAGGTTGC	TACAGCCACCGTAACAGCAG	0.95	XM_003449940.5
il-10	CTGCTAGATCAGTCCGTCGAA	GCAGAACCGTGTCCAGGTAA	0.99	XM_013269189.3
Β-actin	TGGTGGGTATGGGTCAGAAAG	CTGTTGGCTTTGGGGTTCA	0.96	ENSONIG00000008505

e = primer efficiency values.

.

2.8. Statistical Analysis

The values are expressed as the mean ± standard deviation. Normality and homogeneity of variance were assessed using the Shapiro–Wilk and Levene tests, respectively. If the statistical assumptions were met, a one-way analysis of variance (ANOVA) was applied, with a post hoc Tukey test. Otherwise, a Kruskal–Wallis test was used. All tests were with the significance level set at 0.05. Additionally, polynomial regression analysis and orthogonal polynomial contrast were performed in all cases to observe the tendency of the different arginine levels used. Only regressions with R² greater than 0.7 were submitted. All statistical analyses, with the exception of the orthogonal polynomial contrast, were performed using SPSS Statistics^® V26.0.0^® (IBM Corporation, 1989, 2011, Armonk, NY, USA). The orthogonal polynomial contrast was performed using R Studio software version 4.3.2 (R Core Team, 2020, Vienna, Austria).

3. Results

3.1. Performance and Biological Index

As a result of a 57-day nutritional trial, organisms fed the 3% additional arginine diet had higher weight gain and SGR in contrast to the control treatment (p < 0.05;

Table 3. Productive performance of Nile tilapia (Oreochromis niloticus) fed diets with different levels of L-arginine (0, 1, 2, and 3%) and cultured at 20‰ for 57 days. Data are mean ± SD.

Treatments	Initial Weight (g)	Final Weight (g)	Final Length (cm)	Weight Gain (g)	Specific Growth Rate (%/d)	Feed Conversion Ratio	Survival Rate (%)
T0	4.06 ± 0.76 a	48.03 ± 19.17 a	13.43 ± 1.82 a	42.53 ± 4.38 a	4.27 ± 0.15 a	1.23 ± 0.08 a	76.0 ± 4.00 a
T1	4.05 ± 0.76 a	56.14 ± 23.09 a	13.96 ± 1.95 a	44.4 ± 3.23 ab	4.35 ± 0.13 ab	1.25 ± 0.02 a	83.7 ± 0.38 ab
T2	4.05 ± 0.73 a	45.87 ± 9.25 a	13.43 ± 1.11 a	48.34 ± 0.43 ab	4.49 ± 0.02 ab	1.16 ± 0.04 a	94.0 ± 2.82 b
T3	4.01 ± 0.66 a	68.16 ± 18.98 a	14.91 ± 1.39 a	52.44 ± 3.84 b	4.63± 0.11 b	1.05 ± 0.09 a	76.0 ± 8.00 a
p-value	0.44 A	0.09 A	0.24 K	0.04 A	0.04 A	0.24 K	0.01 A
				Regressions
Orthogonal contrast
Lineal (p-value)				0.01	0.007	0.10	0.84
Quadratic (p-value)				0.05	0.004	0.16	0.46
Lineal (R2)				0.97	0.98	0.79	0.02
Quadratic (R2)				0.99	0.99	0.98	0.78
Best model				Lineal p	Lineal t	Quadratic r	Quadratic r

Superscript letters show differences between the same column (p < 0.05). Superscript A or K letters in p-values represent ANOVA or Kruskal–Wallis analysis, respectively. p = Based on p-value, r = Based on R². t = Based on P and R².

). However, major differences were not shown by T1 and 2 (p > 0.05) compared to the other groups. The survival rate was significantly higher in T2 (94%) compared to T0 and T3 (p < 0.05), but not compared to T1 treatment (p > 0.05). The FCR ranged from 1.05 to 1.25, with no significant differences observed between treatments (p > 0.05). Additionally, there was no statistical significance observed in the correlation between total length and final weight of the organisms. However, weight gain (R² = 0.975) and specific growth rate (SGR) (R² = 0.998) exhibited a linear correlation. In contrast, strong quadratic correlations were recorded for feed conversion ratio (FCR) (R² = 0.983), and survival rate (R² = 0.781) (see Figure 1).

The organisms of the different experimental diets did not show significant differences in condition index, hepatosomatic index, and visceral index (p > 0.05;

Table 4. Biological indices of Nile tilapia (Oreochromis niloticus) fed diets with different levels of L-arginine (0, 1, 2, and 3%) and cultured at 20‰ for 57 days. Data are mean ± SD.

Treatments	Hepatosomatic Index	Visceral Index	Condition Index
T0	2.16 ± 0.47 a	12.65 ± 1.60 a	1.86 ± 0.15 a
T1	2.18 ± 0.87 a	13.55 ± 1.05 a	1.99 ± 0.39 a
T2	1.8 ± 0.43 a	13.72 ± 1.92 a	1.88 ± 0.15 a
T3	2.29 ± 0.34 a	13.30 ± 2.36 a	2.01 ± 0.22 a
p-value	0.25 K	0.63 K	0.54 K
	Regressions
Orthogonal contrast
Lineal (p-value)	0.99	0.41	0.42
Quadratic (p-value)	0.77	0.03	0.81
Lineal (R2)	0.00	0.33	0.33
Quadratic (R2)	0.77	0.99	0.33
Best model	Quadratic r	Quadratic t	None

Superscript letters show differences between the same column (p < 0.05). Superscript K letters in p-values represent Kruskal–Wallis analysis. r = Based on R². t = Based on P and R².

).

3.2. Hematology

The hematological results are summarized in

Table 5. Blood hematological values of Nile tilapia (Oreochromis niloticus) fed diets with different levels of L-arginine (0, 1, 2, and 3%) and cultured at 20‰ for 57 days. Data are mean ± SD.

Treatments	Hb (g/dL)	Hct (%)	RBC (×106/mm3)	WBC (×103/mm3)	MCV (fL)	MCH (pg)	MCHC (g/dL)
T0	6.76 ± 1.37 a	23.88 ± 5.79 a	1.39 ± 0.55 a	11.20 ± 2.11 a	183.21 ± 37.82 b	53.41 ± 17.11 a	28.88 ± 4.80 a
T1	8.15 ± 0.92 b	28.10 ± 4.13 a	1.59 ± 0.24 a	12.40 ± 1.13 ab	179.91 ± 39.41 b	52.22 ± 10.62 a	29.30 ± 3.10 a
T2	8.16 ± 0.53 b	23.50 ± 2.66 a	1.77 ± 0.22 a	13.00 ± 0.58 ab	134.18 ± 20.05 a	46.69 ± 6.18 a	34.90 ± 1.60 b
T3	8.25 ± 0.56 b	25.00 ± 4.20 a	1.80 ± 0.27 a	13.60 ± 0.99 b	140.87 ± 32.25 a	46.55 ± 7.82 a	34.20 ± 8.80 ab
p-value	0.01 A	0.14 K	0.16 K	0.02 K	0.02 K	0.67 K	0.02 K
				Regressions
Orthogonal contrast
Lineal (p-value)	0.19	0.92	0.03	0.01	0.12	0.06	0.12
Quadratic (p-value)	0.26	0.92	0.08	0.07	0.47	0.34	0.46
Lineal (R2)	0.65	0.01	0.92	0.96	0.75	0.87	0.77
Quadratic (R2)	0.93	0.14	0.99	0.99	0.77	0.88	0.78
Best model	Quadratic r	None	Lineal p	Lineal p	Quadratic r	Quadratic r	Quadratic r

Superscript letters show differences between the same column (p < 0.05). Superscript A or K letters in p-values represent ANOVA or Kruskal–Wallis analysis, respectively. p = Based on p-value, r = Based on R². t = Based on P and R².

. Hematocrit, RBC, and MCH do not show differences among treatments (p > 0.05). The study found that the hemoglobin concentration in the control group (6.7 g/dL) was significantly lower (p < 0.05) compared to the other treatment groups (8.15 to 8.25 g/dL). The white blood cell count was found to be significantly higher (p < 0.05) in the T3 group (13.6 × 10³/mm³) when compared to the T0 group (11.2 × 10³/mm³). However, treatments T1 (12.4 × 10³/mm³) and T2 (13.0 × 10³/mm³) did not show significant differences between the groups (p > 0.05). The MCV had a considerable decrease (p < 0.05) in the T2 (134.1 fL) and T3 (140.8 fL) treatments in contrast to the T0 (183.2 fL) and T1 (179.9 fL) groups. On the other hand, MCHC showed a significant increase (p < 0.05) in the T2 group (34.9 g/dL) in contrast to the T0 (28.8 g/dL) and T1 (29.3 g/dL) groups. There were no significant differences (p > 0.05) between the T3 (34.2 g/dL) group and the other groups.

3.3. Differential Leukocyte Count

The percentages of neutrophils, basophils, and eosinophils failed to demonstrate significant differences (p > 0.05; see

Table 6. Blood cell types (leukocytes and thrombocytes) of Nile tilapia (Oreochromis niloticus) fed diets with different levels of L-arginine (0, 1, 2, and 3%) and cultured at 20‰ for 57 days. Data are mean ± SD.

Treatments	Lymphocytes (%)	Monocytes (%)	Neutrophils (%)	Basophil (%)	Eosinophils (%)	Thrombocytes (%)
T0	64.95 ± 13.73 a	27.25 ± 9.19 b	7.42 ± 5.91 a	0.00 ± 0.00 a	1.16 ± 0.55 a	75.78 ± 6.14 b
T1	57.54 ± 14.18 a	29.23 ± 11.62 b	11.43 ± 5.18 a	0.19 ± 0.40 a	2.55 ± 1.05 a	66.25 ± 6.14 a
T2	75.50 ± 10.69 b	16.79 ± 4.51 a	7.70 ± 7.002 a	0.00 ± 0.00 a	0.00 ± 0.00 a	66.36 ± 5.77 a
T3	61.57 ± 19.49 a	27.77 ± 12.29 b	8.92 ± 7.13 a	0.29 ± 0.47 a	2.69 ± 1.62 a	59.71 ± 5.86 a
p-value	0.037 K	0.01 K	0.166 K	0.07 K	1.00 K	0.00 A
			Regressions
Orthogonal contrast
Lineal (p-value)	0.86	0.75	0.94	0.39	0.79	0.06
Quadratic (p-value)	0.96	0.85	0.86	0.76	0.93	0.32
Lineal (R2)	0.01	0.06	0.00	0.36	0.04	0.88
Quadratic (R2)	0.07	0.26	0.19	0.40	0.13	0.89
Best model	None	None	None	None	None	Quadratic r

Superscript letters show differences between the same column (p < 0.05). Superscript A or K letters in p-values represent ANOVA or Kruskal–Wallis analysis, respectively. The lymphocytes, monocytes, neutrophils, basophils, and eosinophils are in percent of each of the leukocyte cellular types, without thrombocytes. Thrombocytes are the percentage of total leukocytes and the thrombocyte count. r = Based on R².

). However, differences were found in the lymphocyte count, where the T2 treatment resulted in a significantly higher (p < 0.05) increase (75.5%) compared to the other treatments (<65%). Furthermore, a significantly lower monocyte count was found in the T2 group (p < 0.05). Regarding the thrombocyte levels, the control group resulted in a significantly higher amount (75.7%) than the other treatments (<66.4%, p < 0.05).

3.4. Micronucleus and Nuclear Aberrations Assay

The different diets did not affect the presence of micronuclei, blebbel, and notched nuclear aberrations of erythrocytes (p > 0.05; see

Table 7. Micronucleus and nuclear aberrations of erythrocytes of Nile tilapia (Oreochromis niloticus) fed diets with different levels of arginine (0, 1, 2, and 3%) and cultured at 20‰ for 57 days. Data are mean ± SD.

Treatments	Micronucleus (%)	Binucleated (%)	Blebbel (%)	Notched (%)
T0	0.488 ± 0.25 a	0.33 ± 0.14 b	0.60 ± 0.47 a	2.95 ± 2.01 a
T1	0.190 ± 0.01 a	0.20 ± 0.00 a	0.31 ± 0.14 a	2.23 ± 2.19 a
T2	0.197 ± 0.01 a	0.50 ± 0.50 ab	0.28 ± 0.22 a	2.71 ± 1.32 a
T3	0.177 ± 0.04 a	0.42 ± 0.26 b	0.35 ± 0.27 a	2.47 ± 1.76 a
p-value	0.13 K	0.03 K	0.09 K	0.22 A
		Regressions
Orthogonal contrast
Lineal (p-value)	0.52	0.42	0.31	0.6
Quadratic (p-value)	0.57	0.81	0.14	0.8
Lineal (R2)	0.22	0.32	0.47	0.16
Quadratic (R2)	0.66	0.33	0.98	0.36
Best model	None	None	Quadratic r	None

Superscript letters show differences between the same column (p < 0.05). Superscript A or K letters in p-values represent ANOVA or Kruskal–Wallis analysis, respectively. r = Based on R².

). A reduced incidence of binucleated nuclear aberrations has been observed in the T1 dietary treatment, in contrast to the T0 and T3 treatments (p < 0.05). The T2 group did not show any major differences (p > 0.05) compared to the other groups.

3.5. Serum Biochemistry Parameters

The present study revealed that cholesterol and glucose levels remained unchanged across all experimental groups (p > 0.05; see

Table 8. Serum biochemistry of Nile tilapia (Oreochromis niloticus) fed diets with different levels of L-arginine (0, 1, 2, and 3%) and cultured at 20‰ for 57 days. Data are mean ± SD.

Treatments	Cholesterol (mg/dL)	Triglycerides (mg/dL)	Glucose (mg/dL)	Total Protein (g/dL)	Globulin (g/dL)	albumin (g/dL)
T0	106.99 ± 12.72 a	138.26 ± 55.86 ab	105.85 ± 24.65 a	2.68 ± 0.37 bc	1.39 ± 0.39 ab	1.26 ± 0.26 ab
T1	100.83 ± 14.31 a	115.93 ± 39.98 a	92.17 ± 20.78 a	3.17 ± 0.59 b	1.78 ± 0.48 b	1.38 ± 0.17 a
T2	94.89 ± 11.61 a	120.87 ± 45.25 ab	93.59 ± 18.63 a	2.22 ± 0.49 a	1.13 ± 0.54 a	1.08 ± 0.13 b
T3	97.63 ± 17.61 a	182.75 ± 99.97 b	93.72 ± 27.76 a	2.74 ± 0.56 bc	1.41 ± 0.36 ab	1.32 ± 0.24 a
p-value	0.10 K	0.04 K	0.48 K	0.00 K	0.00 A	0.00 K
			Regressions
Orthogonal contrast
Lineal (p-value)	0.15	0.41	0.29	0.74	0.71	0.88
Quadratic (p-value)	0.20	0.12	0.33	0.966	0.95	0.95
Lineal (R2)	0.71	0.34	0.50	0.06	0.08	0.01
Quadratic (R2)	0.95	0.98	0.89	0.06	0.09	0.08
Best model	Quadratic r	Quadratic r	Quadratic r	None	None	None

Superscript letters show differences between the same column (p < 0.05). Superscript A or K letters in p-values represent ANOVA or Kruskal–Wallis analysis, respectively. r = Based on R².

). Triglyceride levels in groups T0 and T2 were significantly similar but differed from T1 and T4 (p > 0.05). However, a significant increase (p < 0.05) was observed in the T3 treatment (183 mg/dL), in contrast to the T1 group (138 mg/dL), which exhibited a decrease. The total protein content was found to be higher (p < 0.05) in the T1 (3.2 mg/dL) group compared to the T2 group (2.2 mg/dL). In contrast, there were no significant differences among the T0, T1, and T3 groups (p > 0.05). Similarly, in other comparisons, the T0 and T3 treatments failed to show a significant difference (p > 0.05). Globulin levels exhibited a significant increase (p < 0.05) in the T1 treatment group, in contrast to the T2 treatment group. There were no significant differences (p < 0.05) between T3 and the other treatments. The albumin levels were significantly higher in the T1 and T3 treatment groups (p < 0.05) than in the T2 group. In contrast to the other groups, the albumin level in T0 did not show a significant difference (p > 0.05).

3.6. Gene Relative Expression

Despite no significant differences being observed among the various levels of arginine inclusion and the relative expression of il-10, hsp 70, and sod (p > 0.05), a strong quadratic trend correlation was noted in the relative gene expression levels. The expression of il-10 (R² = 0.861; p > 0.05; Figure 2A) decreased when arginine increased. Whereas the sod (R² = 0.935; p > 0.05; Figure 2B) increased at intermediate arginine levels, hsp 70 (R² = 0.962; p > 0.05; Figure 2C) decreased at higher arginine levels (Figure 2).

4. Discussion

The results of this study demonstrate that increasing levels of arginine lead to a higher SGR. The highest SGR was observed in the T3 treatment group, which is a trend that aligns with previous studies in Chinese perch (Siniperca chuatsi) [30], Mrigal carp (Cirrhinus mrigala) [32], Chinese mitten crab (Eriocheir sinensis) [33], and Nile tilapia grown in freshwater [43]. However, in this study, maximum growth was observed at concentrations of 9.16% total arginine, corresponding to T3, which differs from previous reports.

For instance, Nile tilapia cultured in freshwater reached maximum growth at arginine concentrations of 6.24%, while S. chuatsi achieved this at 2.61%. This discrepancy may be attributed to arginine’s role in counteracting saline stress as a promoter of protein synthesis, in particular for the increase of GH and IGF-1 levels [36].

In Nile tilapia culture, it has been reported that a salinity stress above 15‰ can increase the mortality rate to 16.67%, which can reach 33.33% at salinity levels of 20‰ [50]. In the present study, organisms from T1 and T2 dietary treatments had an increased survival rate, with mortality rates of 15% and 8%, respectively. The improved survival observed at these arginine concentrations (3.6% and 4.6% of the dry diet) is similar to those reported for Chinese perch [30] and Chinese mitten crab [33], where the highest survival rates were observed at concentrations of 3.37% [30] and 4.01% [33] of the dry diet, despite not having significant differences among treatments. The higher survival rates observed in T1 and T2 may be linked to an increased requirement for arginine in stressful situations. Other studies have indicated that plasma arginine levels decrease when facing nitrogen-ammonia stress and pathogen exposure [25,35]. However, there is insufficient corroborating data to support these findings.

Hematological parameters are crucial fish health indicators, allowing for the assessment of stressors to identify the impact on the organism’s health [17,45]. In this study, hemoglobin concentrations were significantly lower in the control group, in accordance with Mohamed et al.’s [51] observations, who reported reduced hemoglobin levels at high salinity. Those authors attributed the decrease in Hb to an increase in osmoregulatory dysfunction caused by high salinity levels. The mean corpuscular volume increased with higher arginine concentration, while the mean corpuscular hemoglobin concentration also rose alongside arginine levels. This pattern is consistent with previous findings for juveniles of the same species [42]. The relationship between Hb and MVC is significant, as both indicate a compensatory response to elevated salinity levels. This response is characterized by an increase in cell volume resulting from low Hb concentration [51].

One of the most widely studied functions of dietary arginine supplementation is its role as an immunostimulant [25,29,36,52]. Arginine acts as a precursor for the synthesis of nitric oxide and polyamines, which promote cell proliferation. It plays a crucial role in modulating the inflammatory response, influencing the TOR signaling pathways, and supporting lymphocyte proliferation [25,29,35,36,52]. Supplementing with arginine promotes the biosynthesis of polyamines, resulting in an increased number of leukocytes [35,36]. In this study, a significant increase in white blood cells was observed alongside higher concentrations of arginine. This effect has been previously observed in Jian carp [53], turbot (S. maximus) [37], and Nile tilapia [54]. Interestingly, the dietary treatment T2 led to an increase in leukocytes and a decrease in monocytes, contrasting with the other dietary treatments. This finding is consistent with previous reports on the turbot [37], where organisms exhibited a similar response to T2 from the present study. A study on catfish (Ictalurus punctatus) [55] evaluated the components of the innate immune system and found that supplementing 4% arginine led to an increase in lysozyme levels. An increase that may be associated with a rise in monocytes and granulocytes [55].

Additionally, higher levels of lymphocytes and monocytes are closely related with arginine’s role in polyamine synthesis, which is essential for cell proliferation [37]. Considering the importance of these cells in both the innate and adaptive immune systems, this increase is beneficial for preventing stress-related illness.

Nevertheless, no significant differences were observed in the presence of micronuclei, blebbels, and notched cells. The number of binucleated erythrocytes was higher in both the T0 and T3 groups. Responses that are similar to those reported in silver barb (Barbonymus gonionotus) exposed to sublethal concentrations of profenofos for one day [56]. This similarity may indicate that the T0 group experienced a molecular-level change due to the saline stress, while the result in the T3 group could be attributed to excessive arginine intake. It has been reported that a higher incidence of nuclear abnormalities is regarded as a bioindicator of genotoxic events, chromosomal instability, or inadequate DNA repair [17,47,48,56]. These abnormalities are also associated with an increase in ROS resulting from salinity stress. Such processes can compromise cell integrity, leading to an increased presence of nuclear abnormalities [17,56]. Although we did not analyze these bioindicators in our study, they may be a contributing factor to our observations. Furthermore, Fujimoto et al. [54] reported that arginine concentrations greater than 4.1% in the diet (dry weight) can lead to liver necrosis in Nile tilapia. However, insufficient information exists to verify the effects of excessive arginine intake.

No significant differences were found in glucose levels along the dietary treatments. The glucose response to different arginine concentrations is similar to findings reported in Nile tilapia [42] and Nile tilapia GIFT [57], where increased arginine resulted in decreased serum glucose. In the present study, glucose concentrations were slightly higher than those reported in freshwater Mossambica and Nile tilapias [45,50]. Nevertheless, the glucose levels were comparable to those reported in Nile tilapia cultured at 20‰ by Metwaly et al. [50]. The increase in glucose at salinities over 20‰ likely reflects a stress response in Nile tilapia. When under stress, the organism releases catecholamines and cortisol, which stimulate the release of energy substrates through glycolysis [25,36]. As a result, elevated glucose levels and insulin are required to promote the glucose absorption by tissues [58]. An increase in insulin in response to higher arginine availability has been reported in species such as largemouth bass (Micropterus salmoides) [59], Atlantic salmon (Salmo salar) [60], and other salmonids [36]. Likewise, the role of arginine in glucose is associated with the activation of glucose transporter-4 translocation [35], as well as its subsequent oxidation [36,60]. However, further studies are needed to clarify this interaction.

No significant differences were observed in cholesterol levels among the dietary treatments, but triglyceride levels were significantly lower in T1 and higher in T3. The decrease in triglyceride concentrations observed in the T1 and T2 treatments aligns with that reported by Li et al. for the same species [39]. Conversely, organisms fed diets containing 3.1% and 4.5% arginine exhibited reduced triglyceride levels [39]. Nonetheless, there is limited information regarding triglyceride responses at higher arginine concentrations. Triglycerides play a key role in how the body responds to stress, as they serve as the primary energy reserve. During stressful situations, the demand for energy increases, leading to a rise in triglyceride levels. This increase signifies greater energy availability for growth and the maintenance of homeostasis within the organism [39,61].

The T1 diet supplementation resulted in the highest concentrations of total protein, albumin, and globulin. These results are comparable to those observed in Mrigal carp [32] and Nile tilapia GIFT [62], where higher concentrations of these metabolites were noted in diets containing 2.78–3.4% arginine for carp and 1.75–2% of the dry diet for Nile tilapia GIFT. Serum protein is primarily composed of globulin and albumin, which play a crucial role in the immune response [32,45]. Their increase is often related to an increase in the innate immune system, which is consistent with previous reports regarding leukocyte concentration and the role of arginine as an immunostimulant [32].

No statistical differences were observed in molecular markers of the immune system (il-10), stress response (hsp 70), and antioxidant defense (sod). However, cytokine il-10 exhibits a quadratic trend, showing higher il-10 expression in the control group with a tendency to increase in the subsequent diets. This result is similar to that reported in Jian carp [53], where the highest il-10 expression was observed in the basal diet, increasing after reaching an arginine level of 1.61% in the diet on a dry weight basis. The decrease in the expression of this gene indicates that it is expressed after the expression of pro-inflammatory cytokines [63], suggesting that excess arginine may lead to tissue necrosis, although further research is needed to confirm this.

The highest levels of sod expression were noted in the T1 and T2 diets, while T0 and T3 had quite similar concentrations. An increase in sod expression with rising dietary arginine has also been reported in species such as the juvenile Chinese mitten crab [33], turbot [37], red drum (Sciaenops ocellatus) [35], and common carp (Cyprinus carpio) [41]. hsp 70 expression was followed by a decrease in the T1 and T2 groups and a slight increase in the T3 group. In common carp [41], a diet containing 4–4.63% arginine resulted in underexpression of the hsp 70 gene after exposure to ammonia stress.

Overall, dietary supplementation with L-arginine at moderate concentrations may offer beneficial effects on Nile tilapia cultured in brackish water. However, the molecular-level effects of the T0 and T3 dietary treatments raise concerns about questions regarding the impact of high concentrations. The presence of binuclear aberrations, along with the expression levels of il-10 and hsp 70 at elevated concentrations, suggests a potential stress response in the organism, warranting further investigations to confirm these findings.

5. Conclusions

Supplementing the diet with L-arginine may help reduce the adverse effects of saline stress on Nile tilapia. A diet containing 7–9% arginine relative to total amino acids could improve the growth of Nile tilapia while lowering the feed conversion ratio. Additionally, this supplementation may stimulate their immune system, improving their health under chronic salinity stress. However, further studies are needed to investigate the effects of excessive dietary arginine to determine whether arginine supplementation has similar benefits for other types of abiotic stressors or even higher salinity levels. While this study focused on Nile tilapia, it is advisable to explore dietary L-arginine supplementation in native species to alleviate stress and promote sustainable aquaculture practices that maintain ecosystem integrity.