The Power of Preventive Protection: Effects of Vaccination Strategies on Furunculosis Resistance in Large-Scale Aquaculture of Maraena Whitefish
Abstract
1. Introduction
2. Materials and Methods
2.1. Maraena Whitefish
2.2. Diagnostics
2.2.1. Detection and Identification of Relevant Pathogens
2.2.2. Antimicrobial Susceptibility Testing
2.3. Vaccination of Maraena Whitefish
2.3.1. Immersion Vaccines
2.3.2. Injection Vaccines
2.4. Carcass Evaluation and Sampling of Vaccinated Whitefish
2.5. Gene Expression Profiling of Maraena Whitefish Tissues
3. Results
3.1. MALDI-TOF and PCR Enabled Reliable Detection of A. salmonicida in Whitefish Environments
3.2. Treatment with Immersion Vaccination Failed in Protecting Maraena Whitefish from Furunculosis
3.3. I.p. Vaccination with Herd-Specific Vaccine Induced High Mortalities
3.4. I.p. Vaccination with Alpha Ject 3000 Provides Resistance to Aeromonas at Low Mortality
3.5. I.p. Vaccination Triggers Distinct Immune Gene Signature in Maraena Whitefish
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BLAST | Basic local alignment search tool |
| CBA | Columbia blood agar |
| cd | Cluster of differentiation |
| CLSI | Clinical and laboratory standards institute |
| Dim | Dimension |
| ECOFF | Epidemiological cut-off value |
| dNTP | Deoxynucleoside triphosphates |
| i.p. | Intraperitoneal |
| MALDI-TOF | Matrix-assisted laser desorption ionisation–time-of-flight mass spectrometry |
| MIC | Minimum inhibitory concentration |
| PCA | Principal component analysis |
| qPCR | Quantitative real-time PCR |
| RAS | Recirculating aquaculture system |
References
- FAO. In Brief to The State of World Fisheries and Aquaculture 2022; FAO: Washington, DC, USA, 2022. [Google Scholar] [CrossRef] [Scilit]
- Bochert, R.; Horn, T.; Luft, P. Maraena whitefish (Coregonus maraena) larvae reveal enhanced growth during first feeding with live Artemia nauplii. Arch. Pol. Fish. 2017, 25, 3–10. [Google Scholar] [CrossRef] [Scilit]
- Boiteanu, C.-N.; Manthey-Karl, M.; Savu, C. Sensory Attributes and Chemical Composition of Maraena Whitefish (Coregonus maraena) from German Aquaculture. 2016. Available online: https://rombio.unibuc.ro/wp-content/uploads/2022/05/21-6-13.pdf (accessed on 10 December 2018).
- Baer, J.; Deweber, J.T.; Rösch, R.; Brinker, A. Aquaculture of coregonid species-quo vadis? Ann. Zool. Fenn. 2021, 58, 307–318. Available online: http://www.fao.org/fishery/statistics/soft- (accessed on 29 March 2022). [CrossRef] [Scilit]
- Rebl, A.; Schmachtl, F.; Brunner, R.M.; Kühn, C.; Swirplies, F.; Goldammer, T. More than just a pinch of salt? The impact of increasing salinity on maraena whitefish in different husbandry systems. Aquac. Rep. 2025, 42, 102758. [Google Scholar] [CrossRef] [Scilit]
- Paisley, L.G.; Ariel, E.; Lyngstad, T.; Jónsson, G.; Vennerström, P.; Hellström, A.; Østergaard, P. An Overview of Aquaculture in the Nordic Countries. J. World Aquac. Soc. 2010, 41, 1–172. [Google Scholar] [CrossRef] [Scilit]
- Lindholm-Lehto, P.; Koskela, J.; Kaseva, J.; Vielma, J. Accumulation of Geosmin and 2-methylisoborneol in European Whitefish Coregonus Lavaretus and Rainbow Trout Oncorhynchus Mykiss in RAS. Fishes 2020, 5, 13. [Google Scholar] [CrossRef] [Scilit]
- Minchenok, E.E.; Semenikhina, M.E.; Zhuravleva, N.G.; Trotsenko, A.A.; Aleksandrova, E.Y. Breeding of whitefish Coregonus Lavaretus L. at the Knyazhegubsky fish hatchery. BIO Web Conf. 2024, 121, 01001. [Google Scholar] [CrossRef] [Scilit]
- Charette, S.J. Microbe profile: Aeromonas salmonicida: An opportunistic pathogen with multiple personalities. Microbiology 2021, 167, 001052. [Google Scholar] [CrossRef] [Scilit]
- Martorell Ribera, J.; Nipkow, M.; Viergutz, T.; Brunner, R.M.R.M.; Bochert, R.; Koll, R.; Goldammer, T.; Gimsa, U.; Rebl, A. Early response of salmonid head-kidney cells to stress hormones and toll-like receptor ligands. Fish Shellfish. Immunol. 2020, 98, 950–961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pereira, C.; Duarte, J.; Costa, P.; Braz, M.; Almeida, A. Bacteriophages in the Control of Aeromonas sp. in Aquaculture Systems: An Integrative View. Antibiotics 2022, 11, 163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dallaire-Dufresne, S.; Tanaka, K.H.; Trudel, M.V.; Lafaille, A.; Charette, S.J. Virulence, genomic features, and plasticity of Aeromonas salmonicida subsp. salmonicida, the causative agent of fish furunculosis. Vet. Microbiol. 2014, 169, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Vendrell, D.; Balcázar, J.L.; Ruiz-Zarzuela, I.; de Blas, I.; Gironés, O.; Múzquiz, J.L. Lactococcus garvieae in fish: A review. Comp. Immunol. Microbiol. Infect. Dis. 2006, 29, 177–198. [Google Scholar] [CrossRef] [Scilit]
- Hickey, M.E.; Lee, J.L. A comprehensive review of Vibrio (Listonella) anguillarum: Ecology, pathology and prevention. Rev. Aquac. 2018, 10, 585–610. [Google Scholar] [CrossRef] [Scilit]
- Bondad-Reantaso, M.G.; MacKinnon, B.; Karunasagar, I.; Fridman, S.; Alday-Sanz, V.; Brun, E.; Le Groumellec, M.; Li, A.; Surachetpong, W.; Karunasagar, I.; et al. Review of alternatives to antibiotic use in aquaculture. Rev. Aquac. 2023, 15, 1421–1451. [Google Scholar] [CrossRef] [Scilit]
- Gebauer, T.; Gebauer, R.; Stejskal, V.; Verleih, M.; Folorunso, E.A.; Korytář, T.; Rebl, A. Current Status and Opportunities of Immunological Research on Percid Fishes. Rev. Fish. Sci. Aquac. 2025, 33, 286–318. [Google Scholar] [CrossRef] [Scilit]
- Adams, A. Progress, challenges and opportunities in fish vaccine development. Fish Shellfish Immunol. 2019, 90, 210–214. [Google Scholar] [CrossRef] [Scilit]
- Mondal, H.; Thomas, J. A review on the recent advances and application of vaccines against fish pathogens in aquaculture. Aquac. Int. 2022, 30, 1971–2000. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lönnström, L.-G.; Rahkonen, R.; Lundén, T.; Pasternack, M.; Koskela, J.; Gröndahl, A. Protection, immune response and side-effects in European whitefish (Coregonus lavaretus L.) vaccinated against vibriosis and furunculosis. Aquaculture 2001, 200, 271–284. [Google Scholar] [CrossRef] [Scilit]
- Koskela, J.; Rahkonen, R.; Pasternack, M.; Knuutinen, H. Effect of immunization with two commercial vaccines on feed intake, growth, and lysozyme activity in European whitefish (Coregonus lavaretus L.). Aquaculture 2004, 234, 41–50. [Google Scholar] [CrossRef] [Scilit]
- Luft, P.; Horn, T.; Schumacher, C.; Bissa, K. Die Etablierung von Nutzfischmodellen am Standort Born zur Entwicklung Robuster Zuchtlinien für die Regionale Aquakultur am Beispiel des Schnäpels (Coregonus maraena (Bloch, 1779)) in Mecklenburg-Vorpommern in den Jahren 2013 bis 2015. Available online: https://www.aquakultur-mv.de/static/AQUA/Dokumente/Forschen/Abschlussbericht_Ostseeschn%C3%A4pel%20Born.pdf (accessed on 10 March 2025).
- CLSI. Methods for Broth Dilution Susceptibility Testing of Bacteria Isolated From Aquatic Animals, Approved Guideline VET04-A2; Clin. Lab. Stand. Inst.: Wayne, PA, USA, 2014; VET03, USA; Available online: https://clsi.org/shop/standards/vet04/ (accessed on 21 May 2025).
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing of Bacteria Isolated From Aquatic Animals, 3rd ed.; CLSI supplement VET04; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
- Bricknell, I.; King, J.A.; Bowden, T.J.; Ellis, A.E. Duration of protective antibodies, and the correlation with protection in Atlantic salmon (Salmo salar L.), following vaccination with an Aeromonas salmonicida vaccine containing iron-regulated outer membrane proteins and secretory polysaccharide. Fish Shellfish Immunol. 1999, 9, 139–151. [Google Scholar] [CrossRef] [Scilit]
- ALPHA JECT 3000 Emulsion for Injection for Atlantic Salmon. Available online: https://medicines.health.europa.eu/veterinary/en/600000080418 (accessed on 14 April 2025).
- Midtlyng, P.J.; Reitan, L.J.; Speilberg, L. Experimental studies on the efficacy and side-effects of intraperitoneal vaccination of Atlantic salmon (Salmo salar L.) against furunculosis. Fish Shellfish Immunol. 1996, 6, 335–350. [Google Scholar] [CrossRef] [Scilit]
- Altmann, S.; Korytář, T.; Kaczmarzyk, D.; Nipkow, M.; Kühn, C.; Goldammer, T.; Rebl, A. Toll-like receptors in maraena whitefish: Evolutionary relationship among salmonid fishes and patterns of response to Aeromonas salmonicida. Fish Shellfish Immunol. 2016, 54, 391–401. [Google Scholar] [CrossRef] [Scilit]
- Austbø, L.; Aas, I.B.; König, M.; Weli, S.C.; Syed, M.; Falk, K.; Koppang, E.O. Transcriptional response of immune genes in gills and the interbranchial lymphoid tissue of Atlantic salmon challenged with infectious salmon anaemia virus. Dev. Comp. Immunol. 2014, 45, 107–114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altmann, S.; Rebl, A.; Kühn, C.; Goldammer, T. Identification and de novo sequencing of housekeeping genes appropriate for gene expression analyses in farmed maraena whitefish (Coregonus maraena) during crowding stress. Fish Physiol. Biochem. 2015, 41, 397–412. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. STRING v11: Protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef] [Scilit]
- Du, Y.; Hu, X.; Miao, L.; Chen, J. Current status and development prospects of aquatic vaccines. Front. Immunol. 2022, 13, 1040336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Papadopoulou, A.; Monaghan, S.J.; Bagwell, N.; Alves, M.T.; Verner-Jeffreys, D.; Wallis, T.; Davie, A.; Adams, A.; Migaud, H. Efficacy testing of an immersion vaccine against Aeromonas salmonicida and immunocompetence in ballan wrasse (Labrus bergylta, Ascanius). Fish Shellfish Immunol. 2022, 121, 505–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vaz Farias, T.H.; Arijo, S.; Medina, A.; Pala, G.; da Rosa Prado, E.J.; Montassier, H.J.; Pilarski, F.; Antonio de Andrade Belo, M. Immune responses induced by inactivated vaccine against Aeromonas hydrophila in pacu, Piaractus mesopotamicus. Fish Shellfish Immunol. 2020, 101, 186–191. [Google Scholar] [CrossRef] [Scilit]
- Chettri, J.K.; Jaafar, R.M.; Skov, J.; Kania, P.W.; Dalsgaard, I.; Buchmann, K. Booster immersion vaccination using diluted Yersinia ruckeri bacterin confers protection against ERM in rainbow trout. Aquaculture 2015, 440, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Bøgwald, J.; Dalmo, R.A. Review on Immersion Vaccines for Fish: An Update 2019. Microorganisms 2019, 7, 627. [Google Scholar] [CrossRef] [Scilit]
- Ma, J.; Bruce, T.J.; Jones, E.M.; Cain, K.D. A Review of Fish Vaccine Development Strategies: Conventional Methods and Modern Biotechnological Approaches. Microorganisms 2019, 7, 569. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tafalla, C.; Bøgwald, J.; Dalmo, R.A. Adjuvants and immunostimulants in fish vaccines: Current knowledge and future perspectives. Fish Shellfish Immunol. 2013, 35, 1740–1750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mechlaoui, M.; Nordstrand, E.; Strandskog, G.; Jensen, I.; Seternes, T. Vaccinated Atlantic salmon (Salmo salar L.) maintain a specific antibody response throughout the seasonal fluctuations of a full commercial production cycle in sea: A case study. Aquaculture 2025, 595, 741536. [Google Scholar] [CrossRef] [Scilit]
- Rømer Villumsen, K.; Dalsgaard, I.; Holten-Andersen, L.; Raida, M.K. Potential Role of Specific Antibodies as Important Vaccine Induced Protective Mechanism against Aeromonas salmonicida in Rainbow Trout. PLoS ONE 2012, 7, e46733. [Google Scholar] [CrossRef] [Scilit]
- Chettri, J.K.; Skov, J.; Jaafar, R.M.; Krossøy, B.; Kania, P.W.; Dalsgaard, I.; Buchmann, K. Comparative evaluation of infection methods and environmental factors on challenge success: Aeromonas salmonicida infection in vaccinated rainbow trout. Fish Shellfish Immunol. 2015, 44, 485–495. [Google Scholar] [CrossRef] [Scilit]
- Kristjansdottir, S.B.; Smaradottir, H.; Bjornsdottir, R. Humoral antibody response in Arctic charr (Salvelinus alpinus) against Aeromonas salmonicida ssp. achromogenes following vaccination with a novel autogenous vaccine. Aquaculture 2022, 561, 738676. [Google Scholar] [CrossRef] [Scilit]
- Mutoloki, S.; Alexandersen, S.; Gravningen, K.; Evensen, Ø. Time-course study of injection site inflammatory reactions following intraperitoneal injection of Atlantic cod (Gadus morhua L.) with oil-adjuvanted vaccines. Fish Shellfish Immunol. 2008, 24, 386–393. [Google Scholar] [CrossRef] [Scilit]
- Miryala, K.R.; Swain, B. Advances and Challenges in Aeromonas hydrophila Vaccine Development: Immunological Insights and Future Perspectives. Vaccines 2025, 13, 202. [Google Scholar] [CrossRef] [Scilit]
- Bjørgen, H.; Koppang, E.O. Anatomy of teleost fish immune structures and organs. Immunogenetics 2021, 73, 53–63. [Google Scholar] [CrossRef] [Scilit]
- Geven, E.J.W.; Klaren, P.H.M. The teleost head kidney: Integrating thyroid and immune signalling. Dev. Comp. Immunol. 2017, 66, 73–83. [Google Scholar] [CrossRef] [Scilit]
- Hansen, J.D.; Zapata, A.G. Lymphocyte development in fish and amphibians. Immunol. Rev. 1998, 166, 199–220. Available online: http://www.ncbi.nlm.nih.gov/pubmed/9914914 (accessed on 27 November 2014). [CrossRef] [Scilit] [PubMed]
- Avagyan, S.; Zon, L.I. Fish to Learn: Insights into Blood Development and Blood Disorders from Zebrafish Hematopoiesis. Hum. Gene Ther. 2016, 27, 287–294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parra, D.; Reyes-Lopez, F.E.; Tort, L. Mucosal immunity and B cells in teleosts: Effect of vaccination and stress. Front. Immunol. 2015, 6, 354. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Gene Symbol | Gene Name | Primer Sequence 5′→3′ (Sense, Antisense) | Nucleotide NCBI Acc.# | Specificity * (Number of 100% Identical BLAST Hits) | Fragment Lenght [bp] |
|---|---|---|---|---|---|
| recA | Recombi-nase A | AGAACGCCAACTGCCTCTGTAT, CAAGGTTGCCCCTCCCTTCAA | JN660361 | Aeromonas sp. (117) including A. salmonicida (93) and A. bestiarum (11); Escherichia coli (1) | 220 |
| tsfm | Elongation factor Ts | ATATCGCTGCGACCCAGAAAATT, GTTCCCGCATTGGTGTTATCAC | JN830095 | Aeromonas sp. (99) including A. salmonicida (70), A. veronii (20) and A. allosaccharophila (3); Tolumonas auensis (1); E. coli (1); Shewanella xiamenensis (1) | 196 |
| csy | Citrate synthase | CCTGCATGCGGATCACGAGC, AAGAGATCGGCTCGGTGGAAC | JN829318 | Aeromonas sp. (102) including A. salmonicida (83); Caldilineaceae sp. (1); Parasalinivibrio latis (1); Zobellella sp. (1); Sphingorhabdus contaminans (1) | 176 |
| rrnS | 16S rRNA | GCCACACTGGAACTGAGACAC, GCGAGGAGGAAAGGTTGGCG | AB680308 | Bacteria (103) comprising Pseudomanodota (51) including Aeromonas sp. (1); Bacillus sp. (6); Staphylococcus haemolyticus (1) | 152 |
| gyrB | DNA gyrase, subunit beta | TTTCTGCTATGAGGGCGGTATC, TGGAACGATGCCTATCAGGAAG | JN829513 | Aeromonas sp. (105) including A. salmonicida (48), A. hydrophila (33) and A. bestiarum (9); E. coli (1) | 144 |
| Gene Symbol | Protein Name | Primer Sequence 5′→3′ (Sense, Antisense) | Nucleotide NCBI Acc.#, Reference | Fragment Lenght [bp] |
|---|---|---|---|---|
| cd79a | Cd79a molecule | GCTTCTGGGCTGCAGGTGTC, AGATCACCTGGGTCACCCGC | XM_041901733 | 159 |
| cd83 | Cd83 molecule | TGACAGGTTGCCTTGAGTCCAC, GTTWTTGCAAAGGAGYAAGAAGTAT | XM_045219153, XM_045208658, XM_041881478, XM_045219152, XM_045208659 | 149 |
| cd8b | Cd8 beta | GCAACTAWSAAACCCCAAAAGGC, TTGAKCTMCACACTGTACTACTT | XM_041889298, XM_041893006 | 103 |
| ighd | Immunoglobulin delta, heavy chain | TCCTGTGTTCACTGTGAAGAACT, CTTGGATCCGACAACCTGCAG | XM_045221082 | 170 |
| ighm | Immunoglobulin mu, heavy chain | AGCTGGCTCAAAGGAAGTTATATT, TTCTACCCCGACGAGCTGAGT | XM_045210996 | 151 |
| ight | Immunoglobulin tau, heavy chain | CAACACTGACTGGAACAACAAGGT, TCCAAAACAGAACCACTGACG | XM_045210988 | 97 |
| il1b | Interleukin-1-beta | CGCCCGTCCCCATTGAGACT, AAGTCCATCAGCCAGCAGAGC | XM_041901577, LN624221 | 155 |
| mpo | Eosinophil peroxidase | TCTGCAACAACCTGAAGTACCC, GTAAGGGAGGTCTCTAACCGTA | XM_041851056, XM_041846164 [10] | 165 |
| pax5 | Paired box 5 | ATTCGCTGGTGCCAGGTCGAG, TACCTCCTCACTGACCGGCAT | XM_045215194 | 109 |
| tgfb | Transforming growth factor beta | GACTTCCGTAAGGACCTGGG, ACACAGCTCGATGCTGAGTCT | XM_041855149, XM_041847654 | 125 |
| tlr5 | Toll-like receptor 5 | TGCTTCCTGGTGGACTTTCT, CAGGAACTAAGGCTCTCGCT | LN610593 [27] | 185 |
| tlr9 | Toll-like receptor 9 | CCGCTCCTGCCAGGAAATCTAT, GACACAAGGGGTACACCCAGCT | LN610597 [27] | 159 |
| tlr22 | Toll-like receptor 22 (isoform a) | GCTGGTGAAGAGACGATCCT, TGGAGGCTCTGTGATTGTGA | LN876658 [27] | 151 |
| tnf | Tumour necrosis factor | CTGCTCTTTGTGTGGGGTCAG, CCATCCATTTAGAGGGTGAATAC | LT970869 | 156 |
| top2a | DNA topoisomerase II alpha | ATCTTTGACGAGATCCTTGTGAAT, CATTGACGCTGAGAACAACTCC | XM_041878213 | 96 |
| xbp1 | X-box binding protein 1 | AACTTCGCAGGAAACTCAAGAAC, GAAAACGGGCTGTTACGGCAAA | XM_045225948 | 147 |
| Date of Isolation | 11 October 2019 | 11 October 2019 | 17 October 2019 | 4 November 2019 | 4 November 2019 | 4 November 2019 | 12 November 2019 | 6 December 2019 | 6 December 2019 | 6 December 2019 | 6 December 2019 | 6 December 2019 | 30 January 2020 | 6 May 2020 | 30 June 2020 | 30 June 2020 | 30 June 2020 | 30 June 2020 | 30 December 2020 | 2 March 2021 | 12 August 2021 | 12 August 2021 | 12 August 2021 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Antimicrobial Substance | ||||||||||||||||||||||||
| Penicillin G | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | |
| Ampicillin | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Amoxillin | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Amoxicillin/clavulanic acid | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Oxacillin | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | |
| Cephalexin | S | S | S | S | S | S | R | R | R | I | S | R | R | S | R | R | S | R | S | S | S | I | S | |
| Cefovecin | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Clindamycin | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | |
| Lincomycin | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | |
| Chloramphenicol | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Florfenicol | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Enrofloxacin | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Marbofloxacin | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Pradofloxacin | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Erythromycin | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | |
| Gentamicin | S | S | S | N | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Sulfamethoxazole/trimethoprim | S | S | S | S | S | S | S | N | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Doxycyclin | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
| Tetracyclin | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | S | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Böttcher, K.; Luft, P.; Schönfeld, U.; Speck, S.; Gottschalk, T.; Rebl, A. The Power of Preventive Protection: Effects of Vaccination Strategies on Furunculosis Resistance in Large-Scale Aquaculture of Maraena Whitefish. Fishes 2025, 10, 374. https://doi.org/10.3390/fishes10080374
Böttcher K, Luft P, Schönfeld U, Speck S, Gottschalk T, Rebl A. The Power of Preventive Protection: Effects of Vaccination Strategies on Furunculosis Resistance in Large-Scale Aquaculture of Maraena Whitefish. Fishes. 2025; 10(8):374. https://doi.org/10.3390/fishes10080374
Chicago/Turabian StyleBöttcher, Kerstin, Peter Luft, Uwe Schönfeld, Stephanie Speck, Tim Gottschalk, and Alexander Rebl. 2025. "The Power of Preventive Protection: Effects of Vaccination Strategies on Furunculosis Resistance in Large-Scale Aquaculture of Maraena Whitefish" Fishes 10, no. 8: 374. https://doi.org/10.3390/fishes10080374
APA StyleBöttcher, K., Luft, P., Schönfeld, U., Speck, S., Gottschalk, T., & Rebl, A. (2025). The Power of Preventive Protection: Effects of Vaccination Strategies on Furunculosis Resistance in Large-Scale Aquaculture of Maraena Whitefish. Fishes, 10(8), 374. https://doi.org/10.3390/fishes10080374

