Next Article in Journal
Morphometric, Nutritional, and Blood Analyses in Hybrid Striped Bass (Morone chrysops x Morone saxatilis, Walbaum 1972) Reared in a Recirculating Aquaculture System (RAS) Implant in Sicily, Italy
Previous Article in Journal
Catch Losses and Reduction of Bycatch for Jellyfish Using Marine Mammal Bycatch Reduction Devices in Midwater Trawl Gear
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Dietary ARA/EPA Ratio on Growth Performance, Antioxidant Capacity and Lipid Metabolism-Related Genes of Juvenile Fat Greenling (Hexagrammos otakii)

Key Laboratory of Applied Biology and Aquaculture of Northern Fishes in Liaoning Province, Dalian Ocean University, Dalian 116023, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Fishes 2025, 10(6), 277; https://doi.org/10.3390/fishes10060277
Submission received: 18 March 2025 / Revised: 13 May 2025 / Accepted: 26 May 2025 / Published: 6 June 2025
(This article belongs to the Section Nutrition and Feeding)

Abstract

Essential fatty acids are extremely important nutrients in the diet of fish, and the balance between arachidonic acid (ARA) and eicosapentaenoic acid (EPA) is crucial for the healthy growth of fish. Six isonitrogenous and isolipidic basal diets were given to 540 juvenile fat greenling (Hexagrammos otakii) (31.4 ± 1.5 g) for 8 weeks to investigate the effects of dietary ARA/EPA ratio on growth performance, antioxidant capacity and lipid metabolism-related genes of juvenile H. otakii. The control group (A) had 7% fish oil added as the main fat source, while the experimental groups had 4% fish oil as the basic fat source, with varying proportions of ARA and EPA concentrates added to formulate five diets with varying ARA/EPA ratios (B 2.66; C 1.34; D 1.01; E 0.47; F 0.19). The experimental results revealed that adding ARA and EPA to the diet increased the percent weight gain (PWG) and feed conversion ratio (FCR) of juvenile H. otakii, and the PWG and FCR were greatest under Group E dietary conditions. The specific activities (U/mg protein) of superoxide dismutase (SOD), catalase (CAT), and total antioxidant capacity (T-AOC) in the liver, as well as serum SOD and CAT were significantly higher in Groups D and E than those in other groups (p < 0.05). Malondialdehyde (MDA, nmol/g protein) content in the liver and serum was significantly lower in Group E than that in other groups (p < 0.05). Moreover, groups D and E exhibited significant increases in the specific activities (U/mg protein) of intestinal trypsin, lipase, and amylase, as well as in the intestinal villus length (p < 0.05). The incorporation of ARA and EPA into the feed reduced the expression levels of fat synthesis genes such as fas, scd1, accα, and srebp1, as well as the expression of lipolysis genes atgl and hsl. However, it also increased the expression of the lipolytic genes cpt1 and ppara. The ARA/EPA ratios in the dietary were 0.47 and 1.01, respectively, which are appropriate for enhancing growth efficiency, antioxidant enzyme activity, intestinal digestive enzyme activity and lipid metabolism regulation.
Key Contribution: This study comprehensively evaluated various indices, including growth performance, muscle fatty acid composition, liver and serum antioxidant capacity, liver and intestinal tissue health, intestinal digestive enzyme activity, and the expression of fat metabolism-related genes. The aim was to identify the appropriate dietary ARA/EPA ratio for optimizing the feed formulation of juvenile fat greenling and to provide a theoretical basis for subsequent nutritional experiments on juvenile fat greenling.

1. Introduction

To date, the rapid expansion of the aquaculture sector has resulted in a surge in the demand for aquafeeds. Nevertheless, there is a scarcity of top-notch feed resources such as fish meal and fish oil [1]. To address this issue, both the academic and industrial realms explore diverse technical approaches to increase the feed energy supply ratio. Fish oil, in particular, is highly valuable because of its composition of highly unsaturated fatty acids (HUFAs), such as eicosapentaenoic acid (EPA, 20:5n-3), docosahexaenoic acid (DHA, 22:6n-3) and arachidonic acid (ARA, 20:4n-6), which play pivotal roles in the growth and development of fish [2,3]. Fish rely on dietary HUFAs for normal growth and physiological development. Studies show that ARA and EPA competitively regulate key physiological processes in fish [4,5]. Extensive research conducted over the past twenty years has unequivocally demonstrated the significant influence of ARA and EPA on the fluidity of cell membranes, as well as their involvement in various physiological processes, including fish growth, oxidative stress, and the regulation of genes related to lipid metabolism [6,7,8].
Numerous studies have confirmed that DHA has a positive effect on the growth performance of marine fish and the health of their liver and intestines [9,10,11]. When DHA levels are adequate, EPA and ARA, along with the ARA/EPA ratio, play a crucial role in the growth and health of fish [6,7,8]. Optimizing the ratios of dietary ARA/EPA is crucial, as diverse species exhibit distinct physiological reactions to such changes. In a recent study, as the dietary ARA content increased from 0.08% to 0.36%, there was a significant increase and subsequent decrease in the final body weight (FW) and specific growth rate (SGR) of juvenile Japanese seabass (Lateolabrax japonicus). Additionally, the hepatosomatic index (HSI) of fish in the diet group with an ARA content higher than 0.22% was significantly lower than that of the control group (p < 0.01) [12]. However, when the diets of juvenile yellow catfish (Pelteobagrus fulvidraco) were studied, it was found that the survival rate, FCR, liver somatic index (LSI), and visceral index (VSI) were not significantly affected by ARA levels [13]. Although specific dietary requirements for DHA and EPA in H. otakii have not yet been formally established, related marine species, such as Japanese seabass [12,14] and Japanese eels (Anguilla japonica) [12,14], have shown a clear physiological dependence on adequate provisioning of n-3 HUFA. Consequently, comprehending the roles of individual fatty acids, and their ratios is crucial for developing species-specific nutritional strategies in marine fish aquaculture. The inclusion of different levels of ARA and EPA in the fish diet can affect the antioxidant capacity of the fish. For example, when ARA/EPA ratios of 0.22 and 0.26 were added to the diet, the livers of juvenile yellow catfish presented a greater concentration of malondialdehyde (MDA) than did those of fish fed other diets [13]. Similarly, compared with feeding other groups of feeds, feeding feed with an ARA/EPA ratio of 3 resulted in a significant increase in SOD specific activity [14]. Another study conducted on juvenile grass carp (Ctenopharyngodon idellus) revealed that a relatively high dietary intake of 0.3% ARA reduced MDA concentrations and significantly increased SOD levels [15]. Dietary fatty acids influence liver fat metabolism and health [16]. The addition of ARA and EPA at ARA/EPA ratios of 2.04 and 4.01 in feed has been shown to reduce lipid accumulation in the liver of sea bass [17]. Adequate intake of ARA can also regulate the relative expression levels of genes associated with lipid metabolism in the liver of yellow catfish juveniles. For example, 12.64% ARA intake significantly decreased the relative gene expression of the lipid synthesis-related genes accα and evovl5a while increasing the relative gene expression of the lipid decomposition-related genes atgl and hslb [13]. Moreover, LC-PUFAs have been shown to affect various physiological processes in fish, including reproduction, stress resistance, pigmentation, and bone development [18,19,20,21,22,23]. However, most existing studies have concentrated on overall n-3 HUFA levels or the balance between DHA and EPA. In contrast, fewer studies have investigated the specific physiological effects of varying ARA/EPA ratios in contexts where the provision of DHA is deemed sufficient [24]. Different species have different physiological responses to changes in dietary ARA/EPA ratios, highlighting the need to optimize these ratios for each species.
H. otakii is a bottom-dwelling fish that lives in cold-temperature oceans. This species is distributed mainly in the offshore areas of China, North Korea, Japan, Russia and other regions. Its meat is tender and highly nutritious, and the market demand is strong. It has the prospect and potential for commercial breeding. Owing to the slow growth rate of juvenile H. otakii, investigating the appropriate ARA/EPA ratio and its effects on growth performance, antioxidant capacity, and lipid metabolism-related genes is crucial.
This study hypothesizes that adjusting the ARA/EPA ratio in feed can significantly influence the growth performance, antioxidant capacity and lipid metabolism-related genes in juvenile H. otakii, thereby determining the appropriate ARA/EPA ratio. By adding different proportions of EPA and ARA to the diet of juvenile H. otakii, we hope to determine the most appropriate feed ratio for juvenile H. otakii. This approach can not only reduce the cost of raw feed materials but also ensure the healthy breeding of fish. Moreover, the results of this study can also provide an important theoretical basis for studying the nutritional needs of marine fish and developing feed.

2. Materials and Methods

2.1. Experimental Diets

In this experiment, six types of isonitrogenous (49%) and isolipidic (11%) diets were formulated by modifying the lipid compositions: A (7% fish oil), B (4% fish oil, 3% ARA), C (4% fish oil, 2% ARA, 1% EPA), D (4% fish oil, 1.5% ARA, 1.5% EPA), E (4% fish oil, 1% ARA, 2% EPA), and F (4% fish oil, 3% EPA), the ingredients and proximate composition of the experimental diets are presented in Table 1. The control group (A) was supplemented with 7% fish oil as the primary fat source, while the experimental groups utilized 4% fish oil as the base fat source, incorporating varying proportions of ARA and EPA to create five diets with distinct ARA/EPA ratios (B 2.66; C 1.34; D 1.01; E 0.47; F 0.19), the dietary fatty acid composition is presented in Table 2. Fish oil (provided by Dalian Yuelan Biotechnology Co., Ltd., Dalian, China) was added to the control diet, while the other five diets were supplemented with ARA-enriched oil (with approximately 40% ARA relative to the total fatty acid content; sourced from ARA-methyl ester, Hubei Fuxing Biotechnology Co., Ltd., Wuhan, China) or EPA-enriched oil (with approximately 40% EPA relative to the total fatty acid content; obtained from Shanghai McLean Biochemical Technology Co., Ltd., Shanghai, China) to replace the fish oil (obtained from Shandong Provincial Improved Meiweiyuan Biotechnology Co., Qingdao, China) and fulfil the lipid requirements.
The feed was produced in the feed room of the Northern Fish Applied Biology and Breeding Laboratory of Liaoning Province, Dalian Ocean University. The dry ingredients were pulverized via a hammer mill. The pulverized ingredients were subsequently weighed and extensively blended in a Hobart-type mixer after being sifted through an 80-mesh sieve. The resulting mixture was cold-extruded to form floating pellets, which were subsequently cut into uniformly sized strands (2 mm diameter pellets were prepared). The feeding trial utilized dried pellets, which were subjected to forced air at room temperature for 24 h, followed by storage at −20 °C until use.

2.2. Growth Trial

This experiment was conducted in the live breeding room on the first floor of the No. 12 Marine Breeding Building of Dalian Ocean University. At the beginning of the experiment, 540 juvenile H. otakii (purchased from Dalian Bay Commercial Fish Farm, Dalian, China) with an initial mean body weight of 31.4 ± 1.5 g and a body length of 12.8 ± 0.1 cm were randomly distributed into 18 tanks (volume: 100 L; water flow: 600 L/h; rearing temperature: 15 °C; dissolved oxygen: 7 mg/L; salinity: 25; pH: 7.4). Prior to the commencement of the feeding trial, a 24-h fasting period was imposed on the fish, after which their initial body length and weight were measured.
To ensure randomization, each diet was assigned to one of three separate tanks. The fish were manually fed twice daily with the intention of reaching a state of apparent satiation, which occurred at 09.00 and 16.30 h, over a duration of 8 weeks. The fish were allowed to consume food until their feeding activity ceased, and no feed was left in the tank. The amount of feed consumed was meticulously documented.

2.3. Sampling

After 8 weeks of feeding, the fish were fasted for 24 h. Then, the fish were bath anaesthetized with tricaine methane sulfonate (MS-222, 0.08 g/L) within a synchronized time window (9:00–10:00) to minimize diurnal variation interference. The fish were weighed, and their body lengths were measured. Blood was collected from the caudal vein, and serum samples were collected after centrifugation for 10 min (8000 rpm/min, 4 °C) and then stored at −80 °C until analysis. The fish were killed and dissected. After the total visceral weight was measured, the kidney, muscle and intestine were removed. Afterwards, samples of muscle were stored at −20 °C for fatty acid composition analyses; samples of hepatopancreas and intestine were frozen in liquid N2 and then stored at −80 °C for gene expression or enzyme activity measurements; additionally, three samples were stored for histomorphological evaluation in paraformaldehyde.

2.4. Growth Performance

The growth performance was calculated via the following formula.
Percent   Weight   Gain   ( PWG ,   % ) = W t W 0 W 0 × 100
Hepatosomatic   index   ( HSI ,   % ) = W l W × 100
Viscerosomatic   index   ( VSI ,   % ) = W v W × 100
Condition   factor   ( CF ,   g / cm 3 ) = W L 3 × 100
Feed   conversion   ratio   ( FCR ) = W f W t W 0 × 100
Specific   growth   rate   ( SGR ,   % / d ) = ln W t ln W 0 t × 100
Wt: Final body weight (g); W0: Initial body weight (g); Wl: Liver wet weight (g); Wv: Visceral wet weight; W: Body wet weight (g); L: Body length; Wf: Total feed consumption; t: Feeding trial days.

2.5. Proximate Composition and Fatty Acid Composition Analysis

The analysis of the diets and muscles was performed via the standard method to determine their proximate composition. The analytical procedures for this experiment were based on guidelines established by the National Feed Industry Standardization Technical Committee of China. The moisture content was measured by oven drying at a constant temperature of 105 °C until a stable weight was reached, while the ash content was determined after the muffle furnace treatment of the samples at 550 °C for 5 h. Acid digestion followed by the Kjeldahl method was employed to determine the crude protein content. For the determination of crude lipids, extraction was conducted using petroleum ether.
The muscle and feed were hydrolysed with hydrochloric acid, fat was extracted, and potassium hydroxide-methanol was used to saponify and methylate the mixture to obtain fatty acids, which were analysed via gas chromatography. FAMEs were separated via gas–liquid chromatography (GC2010 pro, Fisons, Shimadzu, Kyoto, Japan) via a 30 m × 30 mm × 0.25-μL capillary column (DK802T, Acrichi, Shanghai, China). Individual methyl esters were identified by comparison with the mixed labelling of 37 fatty acid methyl esters from Wuhan Pronets Testing Technology Co., Ltd. (Wuhan, China).

2.6. Intestinal, Liver, and Serum Biochemical Parameter Measurements

The liver and serum metabolic enzymes included superoxide dismutase (SOD, U/mg protein), catalase (CAT, U/mg protein), malondialdehyde (MDA, nmol/g protein), and total antioxidant (T-AOC, U/mg protein); the intestinal digestive enzymes included lipase (U/mg protein), amylase (U/mg protein), and trypsin (U/mg protein), and the enzyme activities were determined through the use of assay kits (Jiancheng Biotech Co., Nanjing, China) following the procedures outlined in the specifications.

2.7. Histological Morphological Evaluation

Servicebio Technology Company (Wuhan, China) cut hepatic sections to for hematoxylin and eosin (HE) staining. The hepatic and intestinal sections were examined under a magnification of ×20. Quantification was carried out via three slides from each group, with five randomly chosen fields on each slide. Photographs were captured, and a scale was included for reference. Villus length was measured via ImageJ software (version 1.53q; National Institutes of Health, Bethesda, MD, USA), while rough results were obtained by observing the number of droplets.

2.8. Real-Time Quantitative PCR

To conduct mRNA level assessments of the liver, three fish were sampled from each tank. TRIzol reagent (Vazyme, Nanjing, China) was utilized for extracting total RNA following the instructions provided by the manufacturer. The quality and quantity of the RNA were subsequently evaluated through 1% agarose gel electrophoresis and Ultra-microphotometer (Biochrom Technologies, Cambridge, UK). The resulting total RNA concentration was adjusted to 0.5 μg/8 μL H2O. cDNA was produced via an First-Strand cDNA Synthesis Kit (Baisai Biotechnology Co., Shanghai, China). Quantitative real-time PCR (qRT-PCR) analysis was performed using a Roche LightCycler 96 thermal cycler (Basel, Switzerland) with 2× qPCR Master Mix (Tiangen, Beijing, China). The 2−ΔΔCt method was used for analysis. The relevant genes and primers are listed in Table 3. The coding DNA sequences (CDS) for the relevant genes were obtained from our laboratory’s complete transcriptome data of H. otakii. The primers were designed using Primer Premier software (version 5.0), with β-actin as the housekeeping gene.

2.9. Statistical Analysis

The data are presented as the mean ± standard error of the mean. We utilized one-way analysis of variance (ANOVA) to assess and compare the variations among the experimental groups, followed by Duncan’s post hoc tests. For all the statistical analyses, we employed SPSS 18.0 software. A significance level of p < 0.05 was used for all tests.

3. Results

3.1. Growth Performance and Muscle Composition

The overall survival rate was 97.96%, with no statistically significant differences observed among the groups. Compared with those in the control group, the dietary supplementation with EPA and ARA had an effect on the growth performance of juvenile H. otakii. However, no significant influence of dietary treatment on muscle component parameters was observed (Table 4). The PWG, SGR and FCR of Groups B, D and E were significantly greater than those of Group A, and the CF was significantly lower than that of Group A (p < 0.05). Furthermore, the HSI and VSI in Group B were significantly greater than those in Groups D and E (p < 0.05).
The results showed that dietary supplementation with ARA and EPA significantly reduced the contents of SFAs and MUFAs in the muscles of juvenile H. otakii and significantly increased the levels of PUFAs (p < 0.05). When the ARA/EPA ratio was 0.47, the n-3 PUFA content in the muscle of juvenile H. otakii was the highest and was significantly greater than that in the muscle of the other groups. However, the n-6 PUFA content was the lowest and was significantly lower than that in the other groups (p < 0.05). The EPA concentration in muscle increased with decreasing ARA/EPA ratio; however, the ARA concentration exhibited the opposite trend (Table 5).

3.2. Tissue Sections of the Liver and Intestine

As shown in Figure 1a, H&E staining revealed hepatic steatosis in the fish from the B and F groups. Scoring results were obtained for the assessment of hepatic health status in juvenile H. otakii based on the degree of vacuolization [25]. No obvious tissue damage or abnormalities were observed in Groups D or E compared with Group A. Fish in diet Group B presented more severe liver vacuolization than fish in the other groups did (p < 0.05). The liver vacuolation scores in the D and E diet groups were the same, and the tissue status was normal (Figure 1b).
The intestine serves as the primary interface between external substances and the body of an animal, directly influencing nutrient absorption. Figure 2a displays the HE staining results for the intestinal tissue of juvenile H. otakii in this study. Groups A and C exhibited intestinal villus damage, whereas the remaining groups showed no apparent lesions and maintained a relatively intact intestinal structure.
The intestinal tissue structure indicators are shown in Figure 2b. The VL in Groups D and E was significantly greater than that in Group A (p < 0.05). There was no significant difference in the VL between the other groups and Group A. The VW was not significantly different between the groups. The MT of Group D was significantly greater than that of Group A and the other experimental groups (p < 0.05).

3.3. Liver and Serum Biochemical Parameters

The effects of the dietary ARA/EPA ratio on the liver and serum antioxidant capacity of juvenile H. otakii are shown in Table 6. The activities of SOD, CAT, and T-AOC in the liver, as well as serum SOD and CAT of Groups D and E were significantly higher than those in other groups (p < 0.05). MDA content in the liver and serum was significantly lower in Group E than that in other groups (p < 0.05). The activities of CAT and T-AOC in the liver and serum of Groups B, C and F were significantly lower than those in Group A (p < 0.05).
The effects of different dietary ARA/EPA ratios on the intestinal trypsin, α-amylase, and lipase contents of juvenile H. otakii are presented in Table 7. Compared with those in Group A, the trypsin, lipase and amylase activities of the juvenile H. otakii in Groups D and E were significantly greater (p < 0.05). There was no significant change in the activity of intestinal digestive enzymes in Groups C or F compared with that in Group A. In addition to amylase, the activities of lipase and trypsin were also significantly increased in Group B (p < 0.05).

3.4. Expression of Genes Involved in Lipid Metabolism

Figure 3 shows the expression of lipid metabolism-related genes in the liver of juvenile H. otakii. Figure 3a shows that adding ARA and EPA to the diet significantly inhibited the expression of fas, scd1, accα and srebp1; when the ARA/EPA ratio was 0.47, the expression of scd1, accα and srebp1 was significantly lower than that in the other experimental groups (p < 0.05). Figure 3b shows that adding ARA and EPA to the diet increased the expression of cpt1 and pparα and significantly inhibited the expression of atgl and hsl; the expression of cpt1 and pparα increased with decreasing ARA addition and increasing EPA addition to the diet. When the ARA/EPA ratio was 0.47, the expression reached a maximum; when the ARA/EPA ratio was 0.47, the expression of atgl and hsl was significantly lower than that in all the other experimental groups (p < 0.05).

4. Discussion

ARA and EPA are reported to be involved in the complex and competitive regulation of physiological processes in fish [26]. In marine fish, competitive inhibition occurs during the synthesis of n-3 and n-6 HUFA. The synthesis of ARA and EPA is subject to competitive inhibition, which prevents their inter-conversion [3]. ARA represents the final product of the n-6 series fatty acids, while EPA can be readilyconverted into DHA, which serves as the end product of the n-3 series fatty acids [24]. Consequently, different dietary ARA/EPA ratios may lead to different metabolic patterns in juvenile H. otakii, potentially affecting physiological functions such as growth performance, oxidative stress, and lipid metabolism-related gene expression. Therefore, determining the appropriate amounts and ratios of ARA and EPA to be incorporated into fish feed is of great significance. The results of this study demonstrated that varying the dietary ARA/EPA ratio influenced the growth performance and feed conversion ratio (FCR) of juvenile H. otakii. It is important to note that although the study focused on ARA and EPA, DHA was present at baseline levels across all experimental diets, ensuring that essential DHA requirements were not a limiting factor for growth. This context allows for a more reliable interpretation of the specific effects associated with ARA/EPA variation. In a study on juvenile black seabass (Acanthopagrus schlegelii), researchers added different levels of ARA to the diet along with high levels of EPA and DHA, finding that ARA supplementation in the range of 0–6% significantly enhanced the fish’s growth and survival rates. It was also noted that DHA and EPA can undergo partial interconversion via enzymatic elongation-desaturation pathways, with EPA showing better regulatory capacity than DHA in lipid metabolism and inflammatory responses [26]. Therefore, the purpose of this study was to investigate the effects of the dietary ARA/EPA ratio on juvenile H. otakii. The results showed that different ARA/EPA ratios had different effects on the PWG and FCR of juvenile H. otakii. It should be emphasized that the observed enhancements in PWG and FCR may not be solely attributable to the ARA/EPA ratio itself, but rather to complex interactions among dietary n-3 and n-6 HUFAs, including the underlying presence of DHA.
Previous studies have shown that the growth and feed efficiency of juvenile H. otakii were optimal when the diet contained 12–17 g/kg of n-3 HUFA, and excessive n-3 HUFA supplementation would impair fish growth [27]. This finding is similar to the studies on cobia (Rachycentron canadum) [28] and the female blue gourami (Trichopodus trichopterus) [29]. As the ARA/EPA ratio in cobia feed increased, the PWG and FCR increased. When the ratio was 1.91, the best effect was achieved [28]. In addition, when the dietary ARA/EPA ratios for fat greenling were 1.34 and 0.19, the FCR and CF were not significantly different from those in the control group, and better results were observed in the other groups (p < 0.05).However, in studies of juvenile grass carp [15] and Malabar red snapper (Lutjanus malabaricus) [30], the different ratios of ARA and EPA in each experimental group had no statistically significant differences in FCR or CF. Moreover, adding higher contents of ARA and EPA in this experiment caused significant increases in the VSI and HSI (p < 0.05). Similar conclusions were red for blue gourami [31] and juvenile yellow catfish [13]. The varying experimental outcomes observed across different species might be attributed to differences in growth stages and species characteristics. Previous research has shown that adjusting the fatty acid composition of feed can effectively change the fatty acid profile in fish [32]. Similar results were obtained in this study. Therefore, different ARA/EPA ratios in the diet have an impact on the growth performance of juvenile H. otakii.
Owing to the high degree of unsaturation of ARA and EPA, they are easily attacked by free radicals, causing lipid peroxidation and damaging the functional integrity and enzyme activity of cell membranes [26,33,34]. SOD, T-AOC, CAT and MDA are important parameters for assessing the antioxidant status of organisms [35,36]. SOD is thought to play a key antioxidant role by catalyzing the conversion of O2 to H2O2, which can be removed by the activity of CAT or GSH-Px [26,37]. The T-AOC can reflect the defense status of organisms with intracellular antioxidant capacity [38]. MDA is a useful biomarker of lipid peroxidation [39]. The fish liver is the metabolic center of the body [17], and serum biochemistry is an important indicator of body health [40]. We found that when the feed was supplemented with ARA/EPA at a ratio of 0.47, the MDA content in the liver and serum of juvenile H. otakii was significantly lower than that in the other groups. The decrease in their content indicates that ARA and EPA have a positive effect on reducing oxidative damage. Moreover, the levels of two important antioxidant enzymes, SOD and CAT, also increased significantly. However, interestingly, the opposite phenomenon was observed in Group B, which may be caused by the difference in the feed ratio. The above results are the same as those for the liver score. The liver score of Group B was significantly lower than that of the other experimental groups, while the scores of Groups D and E were somewhat better (Figure 1b). Liver histology supported these results: when the dietary ARA/EPA ratios for juvenile H. otakii was 2.66 showed hepatocyte vacuolization and cell damage, while the dietary ARA/EPA ratios for juvenile H. otakii were 1.01 and 0.47 showed no obvious pathology. Liver health scores matched these trends. Similarly, intestinal villus length and muscular thickness were improved at moderate ARA/EPA ratios. These findings suggest that appropriate ARA/EPA ratios can help maintain oxidative balance and tissue integrity. However, elevated antioxidant activity may also reflect oxidative stress. Additionally, rising dietary ARA levels altered the overall n-6/n-3 ratio, which may have further influenced oxidative metabolism and warrants deeper investigation. These results are similar to those of Japanese eel (Anguilla japonica) [14], juvenile yellow catfish [13], juvenile turbot (Scophthalmus maximus L.) [41], Malabar red snapper fingerlings [30], juvenile grass carp (Ctenopharyngodon idellus) [15] and juvenile Japanese seabass [12], which suggests that the choice of the ARA/EPA ratio may have an important impact on their effects. Different ratios may have different effects on the antioxidant capacity of juvenile fat greenling.
The intestine plays a crucial role in the absorption and metabolism of dietary lipids, where digestive enzymes break them down into fatty acids and glycerol, which are subsequently absorbed into the blood to engage in diverse physiological functions [42,43]. Therefore, the activity and expression levels of intestinal digestive enzymes are important indicators for evaluating feed utilization efficiency [44,45]. When the dietary ARA/EPA ratio was 1.01 and 0.47, VL was significantly greater than those in the other experimental groups and the control group A (p < 0.05). The experimental results of VL were similar to those of turbot [41]. Compared to the fish oil blank group, VL progressively increased with the addition of ARA concentrate in the diet and with an increase in its concentration. Conversely, the villus width in the low-concentration ARA concentrate group of this experiment was significantly reduced. It might be caused by proinflammatory cytokines [41]. Longer VL can increase the absorption area, accommodate more digestive enzymes, and facilitate the attachment of immune cells, thus benefiting fish growth [46]. According to the results of this study, the intestinal lipase and amylase activities reached their highest levels when only ARA was added to the feed. However, indicators such as MH, MW and MT did not show similar results, which may be related to the degree of oxidative stress. When the ARA/EPA ratio was higher or lower than the specific value, the activity of digestive enzymes decreased. Similar results were also observed in Pangasianodon hypophthalmus juveniles [47] and juvenile small yellow croaker (Larimichthys polyactis) [46]. Numerous studies have revealed that the contents of protein, fat, and other nutrients in feed exert a significant influence on the intestinal health and function of marine fish [9,48]. Therefore, further studies of the exact mechanism of HUFA effects on intestinal health are needed to understand their role in fish. However, it’s unclear if these effects directly result from the ARA/EPA ratio or broader metabolic adjustments involving DHA and other n-3 HUFAs. Future studies are needed to clarify the molecular mechanisms linking dietary fatty acid profiles to intestinal health and nutrient assimilation. Previous studies have focused on the respective functions of ARA and EPA and their direct effects on lipid metabolism. However, determining an optimally conducive to the overall metabolic well-being ARA/EPA ratio for juvenile H. otakii in a broader metabolic context remains a challenging problem. Lipid metabolism is interrelated with multiple physiological processes such as carbohydrate metabolism and protein metabolism, so it is necessary to understand the effect of the ARA/EPA ratio on lipid metabolism from a more comprehensive perspective.
srebp1 is a transcription factor that activates the transcription of key downstream genes involved in de novo fatty acid synthesis [49]. Current research has shown that srebp1 regulates the expression of accα, fas and scd1 and affects fat synthesis [50,51]. After activation, srebp1 is cleaved by lyase to form mature srebp1, which is subsequently transferred to the nucleus by the endoplasmic reticulum to play a regulatory role [52]. Malonyl-CoA synthesis is catalysed by accα, fas catalyses the elongation of malonyl-CoA to synthesize saturated fatty acids, and scd1 catalyses the oxidative dehydrogenation of saturated fatty acids to synthesize unsaturated fatty acids such as MUFAs [53,54]. Studies have shown that triglycerides decompose diacylglycerol (DG) and fatty acids under the action of atgl, and DG is decomposed from hsl into MG and fatty acids. Therefore, atgl and hsl are the rate-limiting enzymes for the decomposition of TG [55]. Almost every step in the process of mitochondrial and peroxisomal fatty acid β-oxidation is regulated by pparα [56,57]. Moreover, pparα can promote the complete oxidative decomposition of acyl-CoA into mitochondria by regulating the expression of cpt [58]. The n-3/n-6 fatty acid balance, closely related to the ARA/EPA ratio, is vital in this regard.Prolonged imbalance in this ratio may induce physiological perturbations. Specifically, an elevated n-6/n-3 ratio (more ARA than EPA) upregulates lipid synthesis-related genes such as scd1, accα, and srebp1. This was evidenced by a comparative analysis of dietary groups with ARA/EPA ratios of 1.34 and 0.47, where marked differences in the expression of these genes were observed, potentially driving hepatic lipid deposition and steatosis [24]. Conversely, an excessively high n-3/n-6 ratio may cause excessive fat oxidation, resulting in slow growth or reduced immunity in fish [15,49]. The results of this experiment showed that the addition of ARA and EPA to the diet significantly inhibited the expression of the lipid synthesis-related genes fas, scd1, accα and srebp1; promoted the expression of the lipid decomposition-related genes cpt1 and pparα; and inhibited the expression of atgl and hsl. Research on gilthead sea bream has shown that the expression of fas and srebp1 tends to first increase and then decrease with decreasing ARA/EPA ratio [10]. Research on juvenile yellow catfish showed that adding ARA to the diet inhibited the expression of fas, accα, cpt1 and hsl but had no significant effect on that of fas. The expression of srebp1, atgl and pparα varied with the amount of ARA added [13]. The results of these studies on juvenile black seabream are opposite to those on yellow croaker. As the ARA content in the diet increases, the expression level of accα increases, while the expression of srebp1 decreases; moreover, the expression levels of the TG decomposition rate-limiting enzymes atgl and hsl are inhibited, which is the same as the results of this experiment [59]. When adjusting the ARA/EPA ratio to influence gene expression, the pros and cons associated with the n-3/n-6 balance must be weighed. The regulatory effects observed in this study may arise from the integrated actions of multiple fatty acids, rather than solely from the ARA/EPA ratios in isolation. Additionally, these effects may reflect broader metabolic adjustments involving DHA and other n-3 HUFAs. Future studies are necessary to elucidate the impact of dietary ARA/EPA/DHA ratios on gene expression related to lipid metabolism and evaluate how gene expression changes, affected by the ARA/EPA and n-3/n-6 ratios, impact fish growth, reproduction, and health, so as to determine the most suitable ARA/EPA ratio for the culture of juvenile H. otakii.

5. Conclusions

In summary, the findings of our current study indicated that the appropriate ARA/EPA ratio in dietary could improve the intestinal trypsin, lipase, and amylase activities, as well as the intestinal villus length, and thus reduced FCR and promote the growth rate. Further, it enhanced the liver and serum antioxidant capacity evidenced by the elevations of antioxidant enzymes and the declination of MDA content. Furthermore, We suggest the appropriate ARA/EPA ratio in diet were 0.47 and 1.01, respectively based on the present experimental conditions.

Author Contributions

W.W. and J.H. designed the experiments, supervised the projects, and revised the manuscripts. F.L. and Y.G. performed the experiments. W.H. and D.C. analyzed data and wrote the manuscript. S.W., L.P. and Y.C. acquired financial support and supervised the project. The final manuscript was approved by all the authors. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Liaoning Province Applied Basic Research Program Project (2022JH2/101300139) and the Fundamental Research Funds for the Provincial Universities of Liaoning (LJ212410158049, 2024JBQNZ017).

Institutional Review Board Statement

The animal study was reviewed and approved by The Animal Ethics Committee of Dalian Ocean University (Dalian, China) approved all experimental protocols used in this study. All animal procedures follow the “Guidelines for Ethical Treatment of Experimental Animals” prepared by the Ministry of Science and Technology of China. Approval Code: DLOU2023014 Approval Date: 10 December 2023.

Informed Consent Statement

Not applicable. This study did not involve human participants. All procedures involving animals were conducted in accordance with institutional and national guidelines for the care and use of laboratory animals.

Data Availability Statement

Data will be made available on request. Data supporting this study’s findings are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Food and Agriculture Organization of the United Nations. The State of World Fisheries and Aquaculture 2022—In Brief: Utilization and Processing of Fisheries and Aquaculture Production. Available online: https://openknowledge.fao.org/server/api/core/bitstreams/9df19f53-b931-4d04-acd3-58a71c6b1a5b/content/sofia/2022/utilization-processing-fisheries-production.html (accessed on 25 May 2025).
  2. Noori, F.; Morshedi, V.; Mozanzadeh, M.T.; Hamedi, S.; Bahabadi, M.N.; Jafari, F.; Azodi, M.; Agh, N. Enrichment of live foods with arachidonic acid enhanced stress resistance, digestive enzyme activity, and total antioxidant capacity in yellowfin seabream (Acanthopagrus latus) larvae. Aquac. Int. 2023, 32, 3747–3766. [Google Scholar] [CrossRef] [Scilit]
  3. Norambuena, F.; Rombenso, A.; Turchini, G.M. Towards the optimization of performance of Atlantic salmon reared at different water temperatures via the manipulation of dietary ARA/EPA ratio. Aquaculture 2016, 450, 48–57. [Google Scholar] [CrossRef] [Scilit]
  4. Calder, P.C. Marine omega-3 fatty acids and inflammatory processes: Effects, mechanisms and clinical relevance. Biochim. Biophys. Acta (BBA)—Mol. Cell Biol. Lipids 2015, 1851, 469–484. [Google Scholar] [CrossRef] [Scilit]
  5. Izquierdo, M.S.; Obach, A.; Arantzamendi, L.; Montero, D.; Robaina, L.; Rosenlund, G. Dietary lipid sources for seabream and seabass: Growth performance, tissue composition and flesh quality. Aquac. Nutr. 2003, 9, 397–407. [Google Scholar] [CrossRef] [Scilit]
  6. Magalhaes, R.; Guerreiro, I.; Santos, R.A.; Coutinho, F.; Couto, A.; Serra, C.R.; Olsen, R.E.; Peres, H.; Oliva-Teles, A. Oxidative status and intestinal health of gilthead sea bream (Sparus aurata) juveniles fed diets with different ARA/EPA/DHA ratios. Sci. Rep. 2020, 10, 13824. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Torrecillas, S.; Betancor, M.B.; Caballero, M.J.; Rivero, F.; Robaina, L.; Izquierdo, M.; Montero, D. Supplementation of arachidonic acid rich oil in European sea bass juveniles (Dicentrarchus labrax) diets: Effects on growth performance, tissue fatty acid profile and lipid metabolism. Fish Physiol. Biochem. 2018, 44, 283–300. [Google Scholar] [CrossRef] [Scilit]
  8. Xu, H.; Meng, X.; Wei, Y.; Ma, Q.; Liang, M.; Turchini, G.M. Arachidonic acid matters. Rev. Aquac. 2022, 14, 1912–1944. [Google Scholar] [CrossRef] [Scilit]
  9. Magalhães, R.; Martins, N.; Fontinha, F.; Couto, A.; Serra, C.R.; Santos, R.A.; Olsen, R.E.; Peres, H.; Oliva-Teles, A. Effects of dietary ARA, DHA, and carbohydrates levels on gilthead sea bream liver and intestine oxidative stress, tissue histomorphology, and gut microbiota. Aquaculture 2022, 552, 738014. [Google Scholar] [CrossRef] [Scilit]
  10. Magalhães, R.; Guerreiro, I.; Coutinho, F.; Moutinho, S.; Sousa, S.; Delerue-Matos, C.; Domingues, V.F.; Olsen, R.E.; Peres, H.; Oliva-Teles, A. Effect of dietary ARA/EPA/DHA ratios on growth performance and intermediary metabolism of gilthead sea bream (Sparus aurata) juveniles. Aquaculture 2020, 516, 734644. [Google Scholar] [CrossRef] [Scilit]
  11. Yadav, A.K.; Rossi, W.; Habte-Tsion, H.-M.; Kumar, V. Impacts of dietary eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) level and ratio on the growth, fatty acids composition and hepatic-antioxidant status of largemouth bass (Micropterus salmoides). Aquaculture 2020, 529, 735683. [Google Scholar] [CrossRef] [Scilit]
  12. Xu, H.; Ai, Q.; Mai, K.; Xu, W.; Wang, J.; Ma, H.; Zhang, W.; Wang, X.; Liufu, Z. Effects of dietary arachidonic acid on growth performance, survival, immune response and tissue fatty acid composition of juvenile Japanese seabass, Lateolabrax japonicus. Aquaculture 2010, 307, 75–82. [Google Scholar] [CrossRef] [Scilit]
  13. Ma, H.-n.; Jin, M.; Zhu, T.-t.; Li, C.-c.; Lu, Y.; Yuan, Y.; Xiong, J.; Zhou, Q.-c. Effect of dietary arachidonic acid levels on growth performance, fatty acid profiles and lipid metabolism of juvenile yellow catfish (Pelteobagrus fulvidraco). Aquaculture 2018, 486, 31–41. [Google Scholar] [CrossRef] [Scilit]
  14. Shahkar, E.; Yun, H.; Lee, S.; Kim, D.-J.; Kim, S.-K.; Lee, B.I.; Bai, S.C. Evaluation of the optimum dietary arachidonic acid level and its essentiality based on growth and non-specific immune responses in Japanese eel, Anguilla japonica. Aquaculture 2016, 452, 209–216. [Google Scholar] [CrossRef] [Scilit]
  15. Tian, J.J.; Lei, C.X.; Ji, H.; Kaneko, G.; Zhou, J.S.; Yu, H.B.; Li, Y.; Yu, E.M.; Xie, J. Comparative analysis of effects of dietary arachidonic acid and EPA on growth, tissue fatty acid composition, antioxidant response and lipid metabolism in juvenile grass carp, Ctenopharyngodon idellus. Br. J. Nutr. 2017, 118, 411–422. [Google Scholar] [CrossRef] [Scilit]
  16. Hodson, L.; Rosqvist, F.; Parry, S.A. The influence of dietary fatty acids on liver fat content and metabolism. Proc. Nutr. Soc. 2020, 79, 30–41. [Google Scholar] [CrossRef] [Scilit]
  17. Xu, H.; Wang, C.; Zhang, Y.; Wei, Y.; Liang, M. Moderate levels of dietary arachidonic acid reduced lipid accumulation and tended to inhibit cell cycle progression in the liver of Japanese seabass Lateolabrax japonicus. Sci. Rep. 2018, 8, 10682. [Google Scholar] [CrossRef] [Scilit]
  18. Alves Martins, D.; Engrola, S.; Morais, S.; Bandarra, N.; Coutinho, J.; Yúfera, M.; Conceição, L.E.C. Cortisol response to air exposure in Solea senegalensis post-larvae is affected by dietary arachidonic acid-to-eicosapentaenoic acid ratio. Fish Physiol. Biochem. 2011, 37, 733–743. [Google Scholar] [CrossRef] [Scilit]
  19. Boglino, A.; Darias, M.J.; Andree, K.B.; Estévez, A.; Gisbert, E. The effects of dietary arachidonic acid on bone in flatfish larvae: The last but not the least of the essential fatty acids. J. Appl. Ichthyol. 2014, 30, 643–651. [Google Scholar] [CrossRef] [Scilit]
  20. Ljubobratović, U.; Péter, G.; Demény, F.; Kugyela, N.; Horváth, Á.; Pataki, B.; Horváth, Z.; Sándor, Z.J.; Rónyai, A. Reproductive performance in virgin pikeperch (Sander lucioperca L.) females fed different dietary levels of arachidonic acid with respect to the duration of spawning induction. Aquac. Rep. 2020, 18, 100430. [Google Scholar] [CrossRef] [Scilit]
  21. Norambuena, F.; Estevez, A.; Mananos, E.; Bell, J.G.; Carazo, I.; Duncan, N. Effects of graded levels of arachidonic acid on the reproductive physiology of Senegalese sole (Solea senegalensis): Fatty acid composition, prostaglandins and steroid levels in the blood of broodstock bred in captivity. Gen. Comp. Endocrinol. 2013, 191, 92–101. [Google Scholar] [CrossRef] [Scilit]
  22. Villalta, M.; EstÉVez, A.; Bransden, M.P.; Bell, J.G. Arachidonic acid, arachidonic/eicosapentaenoic acid ratio, stearidonic acid and eicosanoids are involved in dietary-induced albinism in Senegal sole (Solea senegalensis). Aquac. Nutr. 2008, 14, 120–128. [Google Scholar] [CrossRef] [Scilit]
  23. Boglino, A.; Wishkerman, A.; Darias, M.J.; de la Iglesia, P.; Estévez, A.; Andree, K.B.; Gisbert, E. The effects of dietary arachidonic acid on Senegalese sole morphogenesis: A synthesis of recent findings. Aquaculture 2014, 432, 443–452. [Google Scholar] [CrossRef] [Scilit]
  24. Tian, J.-J.; Lei, C.-X.; Ji, H. Influence of dietary linoleic acid (18:2n-6) and α-linolenic acid (18:3n-3) ratio on fatty acid composition of different tissues in freshwater fish Songpu mirror carp, Cyprinus Carpio. Aquac. Res. 2016, 47, 3811–3825. [Google Scholar] [CrossRef] [Scilit]
  25. Xi, L.; Lu, Q.; Liu, Y.; Su, J.; Chen, W.; Gong, Y.; Han, D.; Yang, Y.; Zhang, Z.; Jin, J.; et al. Effects of fish meal replacement with Chlorella meal on growth performance, pigmentation, and liver health of largemouth bass (Micropterus salmoides). Anim. Nutr. 2022, 10, 26–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Tocher, D.R. Metabolism and Functions of Lipids and Fatty Acids in Teleost Fish. Rev. Fish. Sci. 2010, 11, 107–184. [Google Scholar] [CrossRef] [Scilit]
  27. Lee, S.M.; Cho, S.H. Influences of dietary fatty acid profile on growth, body composition and blood chemistry in juvenile fat cod (Hexagrammos otakii Jordan et Starks). Aquac. Nutr. 2009, 15, 19–28. [Google Scholar] [CrossRef] [Scilit]
  28. Araújo, B.C.; Honji, R.M.; Rombenso, A.N.; Souza, G.B.d.; Mello, P.H.d.; Hilsdorf, A.W.S.; Moreira, R.G. Influences of different arachidonic acid levels and temperature on the growth performance, fatty acid profile, liver morphology and expression of lipid genes in cobia (Rachycentron canadum) juveniles. Aquaculture 2019, 511, 734245. [Google Scholar] [CrossRef] [Scilit]
  29. Masoudi Asil, S.; Abedian Kenari, A.; Rahimi Mianji, G.; Van Der Kraak, G. Estimation of Arachidonic Acid Requirement for Improvement of Pre-maturation Growth and Egg and Larval Quality in the Female Blue Gourami (Trichopodus trichopterus; Pallas, 1770): A Model for the Anabantidae Family. J. World Aquac. Soc. 2019, 50, 359–373. [Google Scholar] [CrossRef] [Scilit]
  30. Chee, W.-L.; Turchini, G.M.; Teoh, C.-Y.; Ng, W.-K. Dietary arachidonic acid and the impact on growth performance, health and tissues fatty acids in Malabar red snapper (Lutjanus malabaricus) fingerlings. Aquaculture 2020, 519, 734757. [Google Scholar] [CrossRef] [Scilit]
  31. Masoudi Asil, S.; Abedian Kenari, A.; Rahimi Miyanji, G.; Van Der Kraak, G. The influence of dietary arachidonic acid on growth, reproductive performance, and fatty acid composition of ovary, egg and larvae in an anabantid model fish, Blue gourami (Trichopodus trichopterus; Pallas, 1770). Aquaculture 2017, 476, 8–18. [Google Scholar] [CrossRef] [Scilit]
  32. Fountoulaki, E.; Alexis, M.N.; Nengas, I.; Venou, B. Effects of dietary arachidonic acid (20:4n-6), on growth, body composition, and tissue fatty acid profile of gilthead bream fingerlings (Sparus aurata L.). Aquaculture 2003, 225, 309–323. [Google Scholar] [CrossRef] [Scilit]
  33. Brash, A.R. Arachidonic acid as a bioactive molecule. J. Clin. Investig. 2001, 107, 1339–1345. [Google Scholar] [CrossRef] [Scilit]
  34. Martínez-Álvarez, R.M.; Morales, A.E.; Sanz, A. Antioxidant Defenses in Fish: Biotic and Abiotic Factors. Rev. Fish Biol. Fish. 2005, 15, 75–88. [Google Scholar] [CrossRef] [Scilit]
  35. Desvergne, B.; Wahli, W. Peroxisome proliferator-activated receptors: Nuclear control of metabolism. Endocr. Rev. 1999, 20, 649–688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Qi, C.; Zhu, Y.; Reddy, J.K. Peroxisome proliferator-activated receptors, coactivators, and downstream targets. Cell Biochem. Biophys. 2000, 32, 187–204. [Google Scholar] [CrossRef] [Scilit]
  37. Glorieux, C.; Calderon, P.B. Catalase, a remarkable enzyme: Targeting the oldest antioxidant enzyme to find a new cancer treatment approach. Biol. Chem. 2017, 398, 1095–1108. [Google Scholar] [CrossRef] [Scilit]
  38. Najafian, L.; Babji, A.S. A review of fish-derived antioxidant and antimicrobial peptides: Their production, assessment, and applications. Peptides 2012, 33, 178–185. [Google Scholar] [CrossRef] [Scilit]
  39. Tsikas, D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Anal. Biochem. 2017, 524, 13–30. [Google Scholar] [CrossRef] [Scilit]
  40. Nicula, M.; Bura, M.; Simiz, E.; Banateandunea, I.; Patruica, S.; Marcu, A.; Lunca, M.; Szelei, Z. Researches Concerning Reference Values Assessment of Serum Biochemical Parameters in some Fish Species from Acipenseridae, Cyprinidae, Esocidae and Salmonidae Family. Lucr. Stiintifice Zooteh. Si Biotehnol. 2010, 43, 498. [Google Scholar]
  41. Wei, C.; Liu, C.; Wang, X.; Zhou, H.; Mai, K.; He, G. Dietary arachidonic acid supplementation improves the growth performance and alleviates plant protein-based diet-induced inflammation in juvenile turbot (Scophthalmus maximus L.). Aquac. Nutr. 2020, 27, 533–543. [Google Scholar] [CrossRef] [Scilit]
  42. Khoshbin, K.; Camilleri, M. Effects of dietary components on intestinal permeability in health and disease. Am. J. Physiol.-Gastrointest. Liver Physiol. 2020, 319, G589–G608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Wu, S.; Pan, M.; Zan, Z.; Jakovlić, I.; Zhao, W.; Zou, H.; Ringø, E.; Wang, G. Regulation of lipid metabolism by gut microbiota in aquatic animals. Rev. Aquac. 2023, 16, 34–46. [Google Scholar] [CrossRef] [Scilit]
  44. Ma, X.; Bi, Q.; Kong, Y.; Xu, H.; Liang, M.; Mai, K.; Zhang, Y. Dietary lipid levels affected antioxidative status, inflammation response, apoptosis and microbial community in the intestine of juvenile turbot (Scophthalmus maximus L.). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2022, 264, 111118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Trenzado, C.E.; Carmona, R.; Merino, R.; García-Gallego, M.; Furné, M.; Domezain, A.; Sanz, A. Effect of dietary lipid content and stocking density on digestive enzymes profile and intestinal histology of rainbow trout (Oncorhynchus mykiss). Aquaculture 2018, 497, 10–16. [Google Scholar] [CrossRef] [Scilit]
  46. Ma, B.; Wang, L.; Lou, B.; Tan, P.; Xu, D.; Chen, R. Dietary protein and lipid levels affect the growth performance, intestinal digestive enzyme activities and related genes expression of juvenile small yellow croaker (Larimichthys polyactis). Aquac. Rep. 2020, 17, 100403. [Google Scholar] [CrossRef] [Scilit]
  47. Sivaramakrishnan, T.; Sahu, N.P.; Jain, K.K.; Muralidhar, A.P.; Saravanan, K.; Ferosekhan, S.; Praveenraj, J.; Artheeswaran, N. Optimum dietary lipid requirement of Pangasianodon hypophthalmus juveniles in relation to growth, fatty acid profile, body indices and digestive enzyme activity. Aquac. Int. 2016, 25, 941–954. [Google Scholar] [CrossRef] [Scilit]
  48. Huang, J.; Zhou, C.; Xu, F.; Luo, X.; Huang, X.; Huang, Z.; Yu, W.; Xun, P.; Wu, Y.; Lin, H. Effects of partial replacement of fish meal with porcine meat meal on growth performance, antioxidant status, intestinal morphology, gut microflora and immune response of juvenile golden pompano (Trachinotus ovatus). Aquaculture 2022, 561, 738646. [Google Scholar] [CrossRef] [Scilit]
  49. Shao, W.; Espenshade, P.J. Expanding roles for SREBP in metabolism. Cell Metab. 2012, 16, 414–419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Horton, J.D.; Goldstein, J.L.; Brown, M.S. SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Investig. 2002, 109, 1125–1131. [Google Scholar] [CrossRef]
  51. Horton, J.D.; Bashmakov, Y.; Shimomura, I.; Shimano, H. Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice. Proc. Natl. Acad. Sci. USA 1998, 95, 5987–5992. [Google Scholar] [CrossRef] [Scilit]
  52. Liu, H.; Zhang, H.; Zheng, H. Regulatory roles of sterol regulatory element-binding protein (SREBP) on lipid metabolism in marine invertebrate Chlamys nobilis. Aquaculture 2018, 493, 251–257. [Google Scholar] [CrossRef] [Scilit]
  53. Kim, Y.M.; Shin, H.T.; Seo, Y.H.; Byun, H.O.; Yoon, S.H.; Lee, I.K.; Hyun, D.H.; Chung, H.Y.; Yoon, G. Sterol regulatory element-binding protein (SREBP)-1-mediated lipogenesis is involved in cell senescence. J. Biol. Chem. 2010, 285, 29069–29077. [Google Scholar] [CrossRef] [Scilit]
  54. Leonard, A.E.; Pereira, S.L.; Sprecher, H.; Huang, Y.S. Elongation of long-chain fatty acids. Prog. Lipid Res. 2004, 43, 36–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Cerk, I.K.; Wechselberger, L.; Oberer, M. Adipose Triglyceride Lipase Regulation: An Overview. Curr. Protein Pept. Sci. 2018, 19, 221–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Corrales, P.; Vidal-Puig, A.; Medina-Gomez, G. PPARs and Metabolic Disorders Associated with Challenged Adipose Tissue Plasticity. Int. J. Mol. Sci. 2018, 19, 2124. [Google Scholar] [CrossRef] [Scilit]
  57. Varga, T.; Czimmerer, Z.; Nagy, L. PPARs are a unique set of fatty acid regulated transcription factors controlling both lipid metabolism and inflammation. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2011, 1812, 1007–1022. [Google Scholar] [CrossRef] [Scilit]
  58. Brandt, J.M.; Djouadi, F.; Kelly, D.P. Fatty acids activate transcription of the muscle carnitine palmitoyltransferase I gene in cardiac myocytes via the peroxisome proliferator-activated receptor alpha. J. Biol. Chem. 1998, 273, 23786–23792. [Google Scholar] [CrossRef] [Scilit]
  59. Jin, M.; Li, X.; Shen, Y.; Bao, Y.; Yang, B.; Wu, Z.; Jiao, L.; Zhou, Q. The Benefit of Optimal Dietary Lipid Level for Black Seabream Acanthopagrus schlegelii Juveniles under Low-Salinity Environment. Aquac. Nutr. 2022, 2022, 2222029. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effect of dietary ARA/EPA on the liver tissue of juvenile H. otakii. Group A–F: A: 7% fish oil; B–F: 4% fish oil plus ARA/EPA ratios of 2.66, 1.34, 1.01, 0.47 and 0.19, respectively. (a) Red arrows represent adipose vacuolation; green arrows represent cell wall rupture; blue arrows represent normal hepatocytes; ovals represent pancreatic cells; (b) The liver-related health status of juvenile H. otakii was scored according to the degree of vacuolization (0 to 20: severe damage; 20 to 40: moderate; 40 to 60: mild; 60 to 80: slight; 80 to 100: normal). The values are the means ± SEM of three replicates; means with different subscripts are significantly different (p < 0.05). Duncan’s multiple range test was used to detect significance. Values marked with different superscripts above the bars indicate significant differences (p < 0.05).
Figure 1. Effect of dietary ARA/EPA on the liver tissue of juvenile H. otakii. Group A–F: A: 7% fish oil; B–F: 4% fish oil plus ARA/EPA ratios of 2.66, 1.34, 1.01, 0.47 and 0.19, respectively. (a) Red arrows represent adipose vacuolation; green arrows represent cell wall rupture; blue arrows represent normal hepatocytes; ovals represent pancreatic cells; (b) The liver-related health status of juvenile H. otakii was scored according to the degree of vacuolization (0 to 20: severe damage; 20 to 40: moderate; 40 to 60: mild; 60 to 80: slight; 80 to 100: normal). The values are the means ± SEM of three replicates; means with different subscripts are significantly different (p < 0.05). Duncan’s multiple range test was used to detect significance. Values marked with different superscripts above the bars indicate significant differences (p < 0.05).
Fishes 10 00277 g001
Figure 2. Effects of dietary ARA/EPA on the intestinal histomorphology of juvenile H. otakii. Group A–F: A: 7% fish oil; B–F: 4% fish oil plus ARA/EPA ratios of 2.66, 1.34, 1.01, 0.47 and 0.19, respectively. (a) VL: villus length; VW: villus width; MT(MLT): muscular layer thickness; (b) Effects of the dietary ARA/EPA ratio on the intestinal tissue structure of juvenile fat greenlings. Values in the same line with different superscripts are significantly different (p < 0.05).
Figure 2. Effects of dietary ARA/EPA on the intestinal histomorphology of juvenile H. otakii. Group A–F: A: 7% fish oil; B–F: 4% fish oil plus ARA/EPA ratios of 2.66, 1.34, 1.01, 0.47 and 0.19, respectively. (a) VL: villus length; VW: villus width; MT(MLT): muscular layer thickness; (b) Effects of the dietary ARA/EPA ratio on the intestinal tissue structure of juvenile fat greenlings. Values in the same line with different superscripts are significantly different (p < 0.05).
Fishes 10 00277 g002
Figure 3. Effects of the dietary ARA/EPA ratio on the relative mRNA expression of genes involved in lipid metabolism pathways in the liver of juvenile H. otakii. Group A–F: A: 7% fish oil; B–F: 4% fish oil plus ARA/EPA ratios of 2.66, 1.34, 1.01, 0.47 and 0.19, respectively. (a) fas, scd1, accα, srebp1 are related to anabolism; (b) cpt1, pparα, atgl, hsl. are related to catabolism. The gene expression of the Group A diet was set at 1. The values are presented as the means (n = 3), with their standard errors represented by vertical bars. Mean values for the same gene with different letters are significantly different (p < 0.05).
Figure 3. Effects of the dietary ARA/EPA ratio on the relative mRNA expression of genes involved in lipid metabolism pathways in the liver of juvenile H. otakii. Group A–F: A: 7% fish oil; B–F: 4% fish oil plus ARA/EPA ratios of 2.66, 1.34, 1.01, 0.47 and 0.19, respectively. (a) fas, scd1, accα, srebp1 are related to anabolism; (b) cpt1, pparα, atgl, hsl. are related to catabolism. The gene expression of the Group A diet was set at 1. The values are presented as the means (n = 3), with their standard errors represented by vertical bars. Mean values for the same gene with different letters are significantly different (p < 0.05).
Fishes 10 00277 g003
Table 1. Basic composition of the experimental feed (%).
Table 1. Basic composition of the experimental feed (%).
IngredientsGroups
ABCDEF
Fish meal a404040404040
Soybean meal b303030303030
Casein c15.815.815.815.815.815.8
Vitamin premix d111111
Mineral premix e111111
Sodium alginate f111111
Cr2O3 g0.20.20.20.20.20.2
Corn starch h444444
ARA-enriched oil i0321.510
EPA-enriched oil j0011.523
Fish oil k744444
Proximate composition (%)
Protein49.03 ± 0.0349.20 ± 0.0649.20 ± 0.0649.07 ± 0.0349.10 ± 0.0648.87 ± 0.09
Lipid10.78 ± 0.3610.69 ± 0.3110.73 ± 0.3310.75 ± 0.3310.65 ± 0.2410.66 ± 0.38
Ash13.46 ± 0.2812.97 ± 0.0713.34 ± 0.0913.14 ± 0.1113.65 ± 0.3813.29 ± 0.04
a Fish meal (58% crude protein, 7.2% crude lipid). Shandong Provincial Improved Meiweiyuan Biotechnology Co., Qingdao, China. b Soybean meal (42.5% crude protein, 2.1% crude lipid). Shandong Provincial Improved Meiweiyuan Biotechnology Co., Qingdao, China. c Casein (86.2% crude protein, 1.5% crude lipid). Shandong Provincial Improved Meiweiyuan Biotechnology Co., Qingdao, China. d Vitamin premix, 1 kg: vitamin A, 7000 IU; vitamin E, 50 mg; vitamin D3, 2000 IU; vitamin K3, 10 mg; vitamin B1, 20 mg; vitamin B2, 20 mg; vitamin B6, 30 mg; vitamin B12, 0.1 mg; nicotinic acid, 80 mg; vitamin C, 100 mg; Ca pantothenate, 50 mg; folic acid, 6 mg; inositol, 80 mg. e Mineral premix, 1 kg: MgSO4·7H2O, 5782 mg; FeSO4·7H2O, 1000 mg; NaCl, 3000 mg; ZnSO4·7H2O, 150 mg; MnSO4·4H2O, 50.3 mg; CuSO4·5H2O, 15 mg; CoCl2·6H2O, 1.2 mg; KI, 1.5 mg. f Sodium alginate. Shandong Provincial Improved Meiweiyuan Biotechnology Co., Qingdao, China. g Cr2O3. Improved McLin Biotech Co., Shanghai, China. h Corn starch (0.3% crude protein, 0.1% crude lipid). Shandong Provincial Improved Meiweiyuan Biotechnology Co., Qingdao, China. i ARA-enriched oil (approximately 40% of total fatty acids), in the form of ARA-methylester; Wuhan, China. j EPA-enriched oil (approximately 40% of total fatty acids), in the form of EPA-methylester, ShangHai, China. k Fish oil. Shandong Provincial Improved Meiweiyuan Biotechnology Co., Qingdao, China.
Table 2. Fatty acids (% total fatty acids) in the diets.
Table 2. Fatty acids (% total fatty acids) in the diets.
ItemsGroups
ABCDEF
C14:05.27 ± 0.114.62 ± 0.064.6 ± 0.064.64 ± 0.074.63 ± 0.125.17 ± 0.10
C16:027.88 ± 0.4725.09 ± 0.0425.83 ± 0.3824.95 ± 0.3626.14 ± 0.3726.78 ± 0.46
C16:15.83 ± 0.135.09 ± 0.045.1 ± 0.085.14 ± 0.075.35 ± 0.095.62 ± 0.08
C18:06.51 ± 0.186.24 ± 0.156.3 ± 0.076.46 ± 0.136.52 ± 0.086.78 ± 0.10
C18:1n-9c17.15 ± 0.2215.8 ± 0.2716.32 ± 0.3216.32 ± 0.4116.61 ± 0.2315.95 ± 0.21
C18:2n-6c15.46 ± 0.2214.57 ± 0.2415.15 ± 0.0315.07 ± 0.0715.24 ± 0.1914.14 ± 0.07
C18:3n-60.14 ± 0.000.36 ± 0.020.34 ± 0.010.34 ± 0.010.21 ± 0.010.12 ± 0.00
C18:3n-31.6 ± 0.031.63 ± 0.031.65 ± 0.031.79 ± 0.111.67 ± 0.041.59 ± 0.01
C20:01.02 ± 0.020.93 ± 0.011.02 ± 0.021.06 ± 0.040.93 ± 0.010.9 ± 0.04
C20:4n-62.16 ± 0.129.61 ± 0.266.65 ± 0.035.81 ± 0.153.5 ± 0.111.99 ± 0.09
C20:3n-30.08 ± 0.000.06 ± 0.000.08 ± 0.000.08 ± 0.000.06 ± 0.000.07 ± 0.00
C20:3n-60.06 ± 0.000.06 ± 0.000.09 ± 0.000.07 ± 0.000.06 ± 0.000.06 ± 0.00
C20:5n-35.92 ± 0.093.62 ± 0.114.94 ± 0.045.73 ± 0.047.51 ± 0.1310.69 ± 0.18
C22:1n-90.58 ± 0.010.57 ± 0.010.64 ± 0.010.47 ± 0.010.71 ± 0.030.53 ± 0.01
C22:6n-310.35 ± 0.0611.79 ± 0.0711.29 ± 0.0312.07 ± 0.0210.85 ± 0.19.58 ± 0.14
n-3 PUFA17.95 ± 0.1417.09 ± 0.0417.97 ± 0.0319.68 ± 0.1620.09 ± 0.2121.93 ± 0.24
n-6 PUFA17.82 ± 0.1124.58 ± 0.4822.2 ± 0.0221.29 ± 0.2119.01 ± 0.2616.32 ± 0.02
ARA/EPA0.37 ± 0.032.66 ± 0.041.34 ± 0.011.01 ± 0.030.47 ± 0.020.19 ± 0.01
Values are the means ± SEM of three replicates.
Table 3. Primers Used for Gene-specific Reverse Transcription and Quantitative Real-time.
Table 3. Primers Used for Gene-specific Reverse Transcription and Quantitative Real-time.
GeneNucleotide Sequence 5–3Size (bp)
1fas-FTCTGCCTTTAAGACGCTTGC192
fas-RGCACATTTCAAACGCCACAC
2scd1-FTCCTCATCATTGCCAACACC187
scd1-RTTTCCGCCCTTCTCTTTGAC
3accα-FAAACGCTTCCAGGCTCAATC206
accα-RAAGGCAACCATTCCCACATC
4srebp1-FTGTCCAGTTGCTCTTGTGTG222
srebp1-RAGGAACAATCTTCGCATCGC
5cpt1-RTCGTGTGCTTTCAACCAGTG158
cpt1-FTCATTTGTGTGTGCCTTGCG
6pparα-RAAGCAGATACCCATCCAAGAGC158
pparα-FAAACGCAGCTCCAAAGTGTC
7atgl-RACCCAAACCTGCTAGTTGTG88
atgl-FTTTCCCTCCATTCTGTTGCC
8hsl-RGGCGTGTTTTGTTGCTTTGTG80
hsl-FAACTCTTCGCTCTCCTGGAAAG
9β-actin-RCTGGTCTGGATTGGCTGTGA292
β-actin-FGGAAGGAAGGCTGGAAGAGG
fas, fatty acid synthase; scd1, stearoyl-CoA desaturase 1; accα, acetyl-CoA carboxylase alfa; srebp1, sterol regulatory element-binding protein-1; cpt1, carnitine palmitoyl transferase 1; pparα, peroxisomeproliferators-activated receptor alpha; atgl, adipose triglyceride lipase and hsl, hormone-sensitive lipase.
Table 4. Effects of dietary ARA/EPA on the growth performance and muscle components of juvenile H. otakii.
Table 4. Effects of dietary ARA/EPA on the growth performance and muscle components of juvenile H. otakii.
ItemsGroups
ABCDEF
Growth performance
IBW (g)31.58 ± 0.6831.99 ± 0.5632.02 ± 0.0632.09 ± 0.430.86 ± 1.0932.31 ± 0.74
FBW (g)46.4 ± 0.3849.84 ± 1.1247.49 ± 0.4949.73 ± 0.8348.63 ± 0.4847.72 ± 0.39
PWG (%)46.99 ± 4.38 c55.81 ± 3.98 a48.29 ± 1.79 bc54.99 ± 3.3 ab57.68 ± 5.7 a47.75 ± 3.87 bc
SGR (%/d)0.69 ± 0.05 c0.79 ± 0.05 ab0.7 ± 0.02 bc0.78 ± 0.04 abc0.81 ± 0.07 a0.7 ± 0.05 c
FCR1.69 ± 0.12 a1.4 ± 0.09 b1.62 ± 0.06 a1.42 ± 0.07 b1.41 ± 0.1 b1.63 ± 0.09 a
CF (g/cm3)1.38 ± 0.05 a1.13 ± 0.05 bc1.26 ± 0.11 ab1.11 ± 0.08 c1.16 ± 0.08 bc1.38 ± 0.04 a
HSI (%)1.14 ± 0.03 c1.39 ± 0.05 ab1.33 ± 0.06 b1.13 ± 0.26 c1.19 ± 0.02 c1.44 ± 0.04 a
VSI (%)6.22 ± 0.37 c7.51 ± 0.29 a7.15 ± 0.08 ab6.41 ± 0.16 c6.47 ± 0.16 c7.11 ± 0.07 b
Proximate composition (%)
Crude protein (%)15.67 ± 0.0615.47 ± 0.2115.43 ± 0.1515.4 ± 0.215.47 ± 0.2115.53 ± 0.21
Crude lipid (%)2.23 ± 0.092.27 ± 0.112.21 ± 0.042.18 ± 0.12.23 ± 0.122.15 ± 0.1
Ash (%)1.18 ± 0.09 b1.29 ± 0.08 ab1.27 ± 0.07 ab1.24 ± 0.11 ab1.36 ± 0.05 a1.24 ± 0.09 ab
IBW: initial body weight; FBW: final body weight; PWG: percent weight gain; SGR: specific growth rate; FCR: feed conversion ratio; CF: condition factor; HSI: hepatosomatic index; VSI: viscerosomatic index; The values are the means ± SEM of three replicates; means with different subscripts are significantly different (p < 0.05).
Table 6. Effects of the dietary ARA/EPA ratio on the liver and serum antioxidant capacity of juvenile H. otakii.
Table 6. Effects of the dietary ARA/EPA ratio on the liver and serum antioxidant capacity of juvenile H. otakii.
ItemsGroups
ABCDEF
Liver
SOD (U/mg protein)356.36 ± 6.68 c295.75 ± 0.54 e318.78 ± 1.24 d371.35 ± 7.22 b412.04 ± 6.32 a326.14 ± 3.41 d
MDA (nmol/mg protein)2.16 ± 0.08 b2.43 ± 0.13 a2.13 ± 0.05 b2.12 ± 0.05 b1.92 ± 0.07 c2.1 ± 0.05 b
CAT (U/mg protein)24.14 ± 0.64 c23.39 ± 1.37 c23.59 ± 0.56 c26.07 ± 0.21 b28.65 ± 0.44 a23.22 ± 0.53 c
T-AOC (U/mg protein)0.26 ± 0.01 d0.27 ± 0.00 c0.28 ± 0.00 c0.32 ± 0.00 a0.29 ± 0.00 b0.2 ± 0.01 e
Sercum
SOD (U/mg protein)331.04 ± 15.83 b256.36 ± 4.72 d303.19 ± 3.26 c369.39 ± 5.08 a361.96 ± 0.36 a299.64 ± 11.14 c
MDA (nmol/mg protein)2.31 ± 0.07 a2.33 ± 0.07 a2.41 ± 0.09 a2.17 ± 0.05 b1.88 ± 0.06 c2.18 ± 0.08 b
CAT (U/mg protein)24.92 ± 0.99 a20.91 ± 1.45 b19.63 ± 0.05 b23.83 ± 0.95 a25.17 ± 0.8 a19.78 ± 1.97 b
T-AOC (U/mg protein)0.72 ± 0.01 b0.67 ± 0.02 c0.64 ± 0.00 d0.72 ± 0.01 b0.75 ± 0.01 a0.61 ± 0.01 e
SOD: superoxide dismutase; MDA: malondialdehyde: CAT: catalase: T-AOC: total antioxidant capacity; Values are means ± SEM of three replicates; means with different subscripts are significantly different (p < 0.05).
Table 5. Effects of dietary ARA/EPA on muscle fatty acids in juvenile H. otakii.
Table 5. Effects of dietary ARA/EPA on muscle fatty acids in juvenile H. otakii.
ItemsGroups
ABCDEF
C14:01.54 ± 0.01 b1.4 ± 0.02 c1.43 ± 0.02 c1.54 ± 0.07 b1.58 ± 0.02 ab1.65 ± 0.04 a
C16:033.28 ± 0.17 b34.5 ± 0.44 a33.8 ± 0.47 b34.53 ± 0.13 a33.74 ± 0.23 b32.44 ± 0.64 c
C18:024.6 ± 0.1 a22.79 ± 0.71 c21.64 ± 0.25 d22.59 ± 0.19 c23.1 ± 0.19 bc23.61 ± 0.36 b
C20:00.42 ± 0.03 c0.47 ± 0.01 b0.41 ± 0.01 c0.43 ± 0.01 bc0.62 ± 0.04 a0.36 ± 0.02 d
SFA59.84 ± 0.27 a59.16 ± 0.28 b57.27 ± 0.3 c59.09 ± 0.14 b59.05 ± 0.11 b58.06 ± 0.3 c
C16:1n-71.51 ± 0.02 c1.40 ± 0.02 d1.47 ± 0.02 c1.47 ± 0.04 c1.58 ± 0.06 b1.72 ± 0.02 a
C18:1n-912.18 ± 0.31 b11.96 ± 0.22 b12.32 ± 0.32 b12.37 ± 0.2 b11.95 ± 0.06 b13.26 ± 0.21 a
C22:1n-92.71 ± 0.04 a2.52 ± 0.08 b2.72 ± 0.06 a2.22 ± 0.07 c2.47 ± 0.09 b2.25 ± 0.05 c
MUFA16.4 ± 0.35 bc15.88 ± 0.29 d16.52 ± 0.35 b16.05 ± 0.17 bcd16.00 ± 0.07 cd17.23 ± 0.26 a
C18:3n-30.71 ± 0.06 cd0.69 ± 0.01 c1.41 ± 0.02 a1.28 ± 0.02 b0.64 ± 0.03 d0.22 ± 0.02 e
C20:5n-38.68 ± 0.39 b7.90 ± 0.23 d8.40 ± 0.08 bc8.27 ± 0.13 cd9.07 ± 0.15 a9.19 ± 0.16 a
C22:6n-33.03 ± 0.08 b2.90 ± 0.02 c3.08 ± 0.08 b3.03 ± 0.05 b3.36 ± 0.05 a3.37 ± 0.03 a
n-3 PUFA12.42 ± 0.49 c11.48 ± 0.2 d12.89 ± 0.1 ab12.58 ± 0.13 bc13.07 ± 0.1 a12.78 ± 0.2 abc
C18:3n-68.17 ± 0.27 b7.72 ± 0.11 c8.11 ± 0.15 b8.53 ± 0.14 a8.35 ± 0.16 ab8.13 ± 0.16 b
C20:4n-63.17 ± 0.16 e5.75 ± 0.06 a5.22 ± 0.21 b3.75 ± 0.16 cd3.52 ± 0.08 d3.80 ± 0.08 c
n-6 PUFA11.34 ± 0.42 c13.47 ± 0.08 a13.32 ± 0.08 a12.28 ± 0.17 b11.88 ± 0.14 b11.93 ± 0.23 b
PUFA23.76 ± 0.58 c24.96 ± 0.21 b26.21 ± 0.15 a24.86 ± 0.24 b24.95 ± 0.07 b24.72 ± 0.06 b
ARA/EPA0.37 ± 0.02 e0.73 ± 0.03 a0.62 ± 0.02 b0.45 ± 0.01 c0.39 ± 0.00 de0.41 ± 0.02 d
SFA: saturated fatty acids; MUFA: monounsaturated fatty acids; PUFA: polyunsaturated fatty acid; EPA: eicosapentaenoic acid; ARA: arachidonic acid. The values are the means ± SEM of three replicates; means with different subscripts are significantly different (p < 0.05).
Table 7. Effects of the dietary ARA/EPA ratio on intestinal digestive enzymes in juvenile H. otakii.
Table 7. Effects of the dietary ARA/EPA ratio on intestinal digestive enzymes in juvenile H. otakii.
ItemsGroups
ABCDEF
Trypsin (U/mg protein)289.09 ± 10.41 d318.86 ± 4.78 c282.82 ± 6.78 d391.93 ± 5.22 b424.45 ± 7.90 a285.16 ± 12.69 d
Lipase (U/mg protein)2.97 ± 0.09 b3.88 ± 0.06 a1.97 ± 0.05 c4.06 ± 0.05 a4.14 ± 0.19 a1.84 ± 0.09 c
Amylase (U/mg protein)2.40 ± 0.31 b2.99 ± 0.15 b2.44 ± 0.12 b3.97 ± 0.13 a3.97 ± 0.05 a2.44 ± 0.23 b
The values are the means ± SEM of three replicates; means with different subscripts are significantly different (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lu, F.; Guo, Y.; Cui, D.; Hua, W.; Wang, S.; Peng, L.; Chen, Y.; Han, J.; Wang, W. Effects of Dietary ARA/EPA Ratio on Growth Performance, Antioxidant Capacity and Lipid Metabolism-Related Genes of Juvenile Fat Greenling (Hexagrammos otakii). Fishes 2025, 10, 277. https://doi.org/10.3390/fishes10060277

AMA Style

Lu F, Guo Y, Cui D, Hua W, Wang S, Peng L, Chen Y, Han J, Wang W. Effects of Dietary ARA/EPA Ratio on Growth Performance, Antioxidant Capacity and Lipid Metabolism-Related Genes of Juvenile Fat Greenling (Hexagrammos otakii). Fishes. 2025; 10(6):277. https://doi.org/10.3390/fishes10060277

Chicago/Turabian Style

Lu, Fengzhi, Yafeng Guo, Dandan Cui, Wenyuan Hua, Shuai Wang, Lei Peng, Yan Chen, Jian Han, and Wei Wang. 2025. "Effects of Dietary ARA/EPA Ratio on Growth Performance, Antioxidant Capacity and Lipid Metabolism-Related Genes of Juvenile Fat Greenling (Hexagrammos otakii)" Fishes 10, no. 6: 277. https://doi.org/10.3390/fishes10060277

APA Style

Lu, F., Guo, Y., Cui, D., Hua, W., Wang, S., Peng, L., Chen, Y., Han, J., & Wang, W. (2025). Effects of Dietary ARA/EPA Ratio on Growth Performance, Antioxidant Capacity and Lipid Metabolism-Related Genes of Juvenile Fat Greenling (Hexagrammos otakii). Fishes, 10(6), 277. https://doi.org/10.3390/fishes10060277

Article Metrics

Back to TopTop