Next Article in Journal
Characterization and Differential Expression of Sex Genes in Adults of Tropical Gar (Atractosteus tropicus)
Previous Article in Journal
Carbon Nanotube-Based Drug Delivery System Increases Drug Content and Promotes Immune Response in Mandarin Fish
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Acute-Phase Serum Amyloid A Promotes Cytokines Production in Oyster Crassostrea gigas

1
Liaoning Key Laboratory of Marine Animal Immunology, Dalian Ocean University, Dalian 116023, China
2
Liaoning Key Laboratory of Marine Animal Immunology and Disease Control, Dalian Ocean University, Dalian 116023, China
3
Dalian Key Laboratory of Aquatic Animal Diseases Prevention and Control, Dalian Ocean University, Dalian 116023, China
4
Functional Laboratory of Marine Fisheries Science and Food Production Process, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266200, China
*
Authors to whom correspondence should be addressed.
Fishes 2025, 10(3), 93; https://doi.org/10.3390/fishes10030093
Submission received: 2 January 2025 / Revised: 8 February 2025 / Accepted: 20 February 2025 / Published: 23 February 2025
(This article belongs to the Section Aquatic Invertebrates)

Abstract

Serum amyloid A (SAA) is one of the most abundant acute-phase response proteins and has been extensively studied in vertebrates for its role in modulation of the inflammatory response and as a marker of disease diagnosis. By comparison, SAA is rarely identified in aquatic species and its physical functions are also not well studied. The present study identified the only one gene encoding SAA protein in oyster Crassostrea gigas. The open reading frame (ORF) of CgSAA was of 417 bp, encoding a putative polypeptide of 138 amino acid residues with a predicted molecular weight of 15.66 kDa. CgSAA was composed of a signal peptide (residues 1–22) and a conserved SAA domain (residues 36–138). The mRNA expression of CgSAA in normal individuals was detectable but at a low level, with the lowest expression level in the tissue of labial palp and a slightly higher expression level in hemocytes. The mRNA expression level of CgSAA was significantly up-regulated at 6 h (2.76-fold of that in control group, p < 0.01) post V. splendidus stimulation. It was also significantly induced under environmental stress at high temperature (34 °C) or low salinity (15‰ salinity). The recombinant protein rCgSAA was expressed in Escherichia coli and purified by affinity chromatography. After rCgSAA was injected into oysters or incubated with culture primary hemocytes, the mRNA expressions of the cytokines CgIL17-1, CgIL17-5, and CgTNF were all significantly up-regulated. The results collectively suggested that CgSAA, as a conserved acute-phase response protein in oyster, was quickly induced under environmental stress and promoted the expressions of cytokines, which provide fresh ideas for understanding the roles of SAA proteins in aquatic invertebrates.
Key Contribution: The study identified the sole gene encoding SAA in oyster Crassostrea gigas, and analyzed its structure and expression characteristics under normal and stress conditions. It demonstrated that CgSAA, as a conserved acute-phase response protein, was rapidly induced by environmental stresses and could promote the expressions of cytokines. It provides a basis for CgSAA to serve as a stress indicator in Crassostrea gigas.

1. Introduction

The acute-phase response (APR) is a well-documented phenomenon in vertebrates, characterized by the rapid synthesis and release of acute-phase proteins (APPs) in response to infection, inflammation, or tissue injury [1]. It has been widely used in the early diagnosis of diseases. Serum amyloid A (SAA), one of the most abundant APPs, has been extensively studied in vertebrates for its role in opsonization, phagocytosis, and modulation of the inflammatory response [2,3]. In vertebrates, SAA is primarily synthesized in the liver during the APR and is secreted into the bloodstream. It binds to high-density lipoprotein (HDL) and accumulates in the tissues, particularly at sites of inflammation. SAA exhibits multiple functions, including opsonization of Gram-negative bacteria, modulation of cytokine production, and stimulation of the innate immune system [4,5]. Its role in innate immunity is further underscored by its ability to induce the production of other immune mediators, such as complement components and reactive oxygen species [6].
Despite the well-documented roles of SAA in vertebrates, the existence and function of SAA-like proteins in invertebrates remain largely unknown. The primary challenge lies in the fact that invertebrates lack a liver, the primary site of SAA synthesis in vertebrates [7]. In analysis using transcriptome and genome data, and in several protostome taxa made up of 21 marine bivalve species and basal metazoans, 51 SAA-like proteins were retrieved [7]. These SAA-like proteins share certain structural features with vertebrate SAA, including a conserved N-terminal region and a variable C-terminal region [7,8,9,10,11]. They are typically small, with molecular weights ranging from 10 to 20 kDa. Recently, proteins with structural and functional similarities to SAA have been identified in some invertebrate species. They are often synthesized in response to immune challenges, such as bacterial or viral infections, and are secreted into the hemolymph or other body fluids [8,9]. For example, in oyster Crassostrea hongkongensis, SAA was found highest expressed in the mantle, and was significantly up-regulated in hemocytes following bacterial challenge [9]. In Tridacna crocea, the recombinant protein rTcSAA was found to bind to bacteria Vibrio coralliilyticus and Vibrio alginolyticus and reduce the mortality rate of the clams after bacterial challenge [10]. Currently, the information of SAA in invertebrates is still limited.
The Pacific oyster Crassostrea gigas is a filter-feeding bivalve and globally important economically farmed species. However, infectious diseases have become the main obstacle to the development of the oyster farming industry, and a variety of diseases have seriously threatened the farming output of Crassostrea gigas [12]. Given that the rearing environments of oysters are usually coastal and estuarine areas, it is a big challenge for environmental management and control when dealing with the outbreak of infectious diseases [13,14]. The early diagnosis of oyster infection is critical to prevent large-scale mortality, and the acute-phase response related SAA might provide a fresh idea [15]. However, the molecular features and potential functions of SAA protein in Crassostrea gigas are still not clear. The present study identified the only saa gene (CgSAA) from oyster C. gigas and its molecular characteristics, expression pattern, as well as possible functions were further investigated with the aim of exploring the evolution of SAAs and the possible role of CgSAA in the immune response.

2. Materials and Methods

2.1. Oysters, Treatments and Tissues Collection

Adult Crassostrea gigas with an average shell length of about 7–10 cm were collected from a commercial aquaculture farm in Zhuanghe, Liaoning Province, China, and then placed in filtered seawater at 20 ± 2 °C for temporary rearing.
To explore the expression characteristics of the CgSAA gene in Crassostrea gigas, one week after temporary rearing, tissue samples were taken from 6 adult oysters for mRNA detection. The tissues included the labial palp, hepatopancreas, muscle, gill, ganglion, mantle, and hemocytes. Male and female Crassostrea gigas individuals with mature gonads were selected for an oyster breeding experiment. Subsequently, samples at the embryonic and larval stages were collected for mRNA detection.
The immune stimulation protocol was modified according to previous reports [16]. The oysters were randomly divided into two groups with 36 individuals in each group. The oysters stimulated with 100 µL (2.0 × 107 CFU) of Vibrio splendidus were used as the V. splendidus group, while the oysters in SW group received an injection of 100 μL sterilized sea water (SW). Subsequently, the hemolymph of the Pacific oysters Crassostrea gigas in each group was collected at 0, 6, 12, and 24 h after stimulation, respectively. Then, under the conditions of 4 °C and 800× g, it was centrifuged for 15 min to obtain hemocytes, and 1 mL of Trizol reagent was added for RNA extraction.
The environmental stress experiment in oysters was conducted according to a previous report [17]. Briefly, thirty-six oysters formed one group, and a total of three groups were used. The oysters cultured in seawater of 34 °C, 30‰ salinity (high temperature stress), seawater of 18 °C, 15‰ salinity (hypotonic stress), and normal seawater (18 °C, 30‰ salinity) were used as the hyperthermia group, low salinity group, and SW group, respectively. Then, hemocytes were collected from nine C. gigas in each group at 0, 6, 12, and 24 h after stimulation for RNA extraction according to the above method.

2.2. cDNA Synthesis, Cloning and Sequence Analysis of the CgSAA

After total mRNA extraction using a Trizol reagent, the integrity and concentration of mRNA were analyzed by agarose gel electrophoresis and a Nanodrop 2000. Samples in which the brightness of the 28S rRNA band is approximately twice that of the 18S rRNA band on 1% agarose gel electrophoresis of total RNA and where the A260/A280 ratio measured by a spectrophotometer is between 1.8 and 2.2 are regarded as qualified samples. The cDNA was synthesized by reverse transcription kit (TransGen Biotech, Beijing, China), and the reaction conditions were 42 °C for 15 min and 85 °C for 5 s, and the obtained cDNA was stored at −80 °C.
Based on the sequence information of CgSAA (GenBank accession number: XM_066077310.1) in the NCBI database (https://www.ncbi.nlm.nih.gov/ (accessed on 15 January 2024)), specific primers CgSAA-F and CgSAA-R were designed (Table 1). The obtained PCR products were gel-purified, cloned into pMD19-T simple vector (Takara), and transferred into competent cells of Trans 5α (Sangon Biotech, Shanghai, China) for massive amplification. Then, they were confirmed by Sanger sequencing. (The amino acid sequence was predicted using the Expert Protein Analysis System (http://www.expasy.org (accessed on 15 January 2024)). The SAA domain was predicted with SMART (http://smart.embl-heidelberg.de/ (accessed on 15 January 2024)), and the neighbor-joining phylogenetic tree was constructed using MEGA-X software (version 10.1.7). GeneDoc 2.7 and DNAMAN 10.0 were utilized to conduct multiple sequence alignments for CgSAA.

2.3. Real-Time PCR Analysis of mRNA Expression

The expression levels of CgSAA in the tissues, embryos, and larvae of Crassostrea gigas, as well as those in response to Vibrio splendidus, high temperature stress, and low salt stress were detected by qRT-PCR. CgIL17-1, CgIL17-5, and CgTNF specific RT-PCR primers were designed using Primer Premier 5 (Table 1) to detect the mRNA expression of candidate genes in hemocytes treated with rCgSAA. Taking CgEF (CGI_10012474) as an internal control, the analysis was carried out using the 2−ΔΔCT method.

2.4. Recombinant Expression and Purification of CgSAA Protein

The recombinant expression and purification of the CgSAA protein were carried out according to the previous report [18]. The simplified process was as follows: PCR amplification was performed using primers CgSAA-EXF and CgSAA-EXR (Table 1). The PCR product was inserted into pET-30a (+) from Novagen in the USA. Then, pET-30a-CgSAA was transformed into E. coli (DE3) cells (TransGen Biotech, Beijing, CN) for culturing. A single colony was picked from the solid medium and inoculated into 200 mL of LB liquid medium. The culture was shaken at 220 rpm at 37 °C until the OD600 = 0.6, and 0.5 mM IPTG was added for rCgSAA expression.
The bacterial cell pellet was resuspended in 35 mL of buffer I solution (50 mmol L−1 Tris—HCl buffer, pH 7.4; 50 mmol L−1 NaCl; 8 mol L−1 urea), and then subjected to ultrasonic disruption on ice. After that, the suspension was centrifuged at 12,000× g for 30 min at 4 °C. The supernatant was collected, filtered through a 0.45-μm filter, and stored at 4 °C for later use. The Ni-NTA Sepharose was equilibrated with 50 mL of buffer I solution. The target protein was eluted and collected successively using buffer II (50 mmol L−1 Tris—HCl buffer, pH 7.4; 50 mmol L−1 NaCl; 8 mol L−1 urea; 50 mmol L−1 imidazole) and buffer III (50 mmol L−1 Tris—HCl buffer, pH 7.4; 50 mmol L−1 NaCl; 8 mol L−1 urea; 400 mmol L−1 imidazole). The collected denatured and purified products were subjected to dialysis renaturation using a solution containing 2 mM reduced glutathione, 0.4 mM oxidized glutathione, 1 mM EDTA, 50 mM Tris—HCl, 100 mM NaCl, 10% glycerol, 1% glycine, and a gradient of decreasing urea concentrations. The protein concentration was measured using a BCA kit and stored at −80 °C [18].

2.5. rCgSAA Treatment and Sample Collection

The in vivo and in vitro rCgSAA treatment experiments in oysters were conducted according to previous report [19,20]. To explore how CgSAA induces an immune response in oysters, a total of 30 oysters were divided into two groups. In one group, each oyster was injected with 100 μL of rCgSAA at a concentration of 500 μg mL−1. In another group, each oyster was injected with 100 μL of PBS as a negative control, and the individuals without an injection served as the blank control. Random samples were taken from each group at 6 h and 12 h after injection, respectively. The hemocytes of C. gigas were collected, and then RNA was extracted according to the subsequent methods to detect the gene expression levels.
The in vitro impaction of rCgSAA on gene expression of hemocyte were also conducted. The collected hemocytes were washed twice with M-L15, then they were resuspended in the M-L15 and inoculated into a 12-well microplate (1 mL per well). The inoculated cells were then cultured at 18 °C for 6 h, then 0 μg, 5 μg, 10 μg, or 50 μg of the recombinant protein rCgSAA was added to each well. The 12-well microplate was taken out after an additional 6 h of incubation at 18 °C. Then, the hemocytes were collected from the 12-well plates with three parallels for each treatment to extract mRNA, and the mRNA expression levels of CgIL17-1 [17], CgIL17-5 [21], and CgTNF [22] genes were detected as formerly mentioned.

2.6. Statistical Analysis

Data were recorded as mean ± SD, and these were tested by SPSS 19.0 software for their normal distribution and equal variance before analysis. Significant difference was determined by a two-tailed Student’s t-test, or by one-way analysis of variance (ANOVA) followed by a post hoc multiple-comparisons (Tukey’s) test which was significant at p < 0.05.

3. Results

3.1. The Molecular Characters of CgSAA Gene

The open reading frame (ORF) of CgSAA measured 417 bp, which was responsible for encoding a presumed polypeptide composed of 138 amino acid residues. This polypeptide had an estimated molecular weight of 15.66 kDa and a theoretical isoelectric point (pI) of 9.84 (Figure 1A). The structural prediction of the amino acid sequence indicates that the oyster CgSAA is composed of two parts. The signal peptide covers the amino acid residues from residues 1–22, the CgSAA domain extends from residues 36–138 (Figure 1B).
Upon conducting multiple sequence comparisons, it was revealed that the SAA domain of the CgSAA gene exhibited a significant degree of similarity to those found in both chordates and invertebrates. Notably, the similarity was most pronounced (99%) with respect to that of Crassostrea hongkongensis (Figure 2A). For the purpose of phylogenetic analysis, twelve SAA-5 sequences from diverse species of vertebrates and invertebrates were chosen, and CgSAA-5 was clustered with CvSAA-5 from C. hongkongensis (Figure 2B).

3.2. The Distribution of CgSAA mRNA Transcripts

Analysis of the expression of CgSAA in different tissues of Crassostrea gigas. The mRNA expression of CgSAA in normal individuals was detectable in all the sampled tissues but at a low level, including hepatopancreas, mantle, gill, hemocytes, ganglion, adductor muscle, and labial palp. In contrastive analysis, the expression level of CgSAA was detected to be lowest in the labial palp. Conversely, hemocytes exhibited a relatively greater expression level of CgSAA, which was 3.85-fold higher than that in the labial palp (p < 0.01). It was also expressed higher in ganglions and adductor muscles, which were 3.42-fold (p < 0.05) and 2.99-fold (p < 0.05) of that in labial palp, respectively. However, expression was relatively lower in gill and mantle, which were 2.14-fold (p < 0.05), 1.89-fold (p < 0.05) of labial palp, respectively (Figure 3A).
During the early developmental process of the oyster Crassostrea gigas, the expression level of CgSAA in the larval stage was higher than that in the embryonic stage, and the expression level of CgSAA was the lowest at the blastula stage. When the embryos of the oyster developed to the trochophore stage, the expression level began to rise, which was 19.11-fold (p < 0.05) that of the blastula stage. The expression level was the highest at the pediveliger stage, which was 275.32-fold (p < 0.05) that of the blastula stage (Figure 3B).

3.3. The Response of CgSAA in Oyster Under Immune Stimulation or Environmental Stress

The mRNA expressions of CgSAA in hemocytes were detected at 0, 6, 12, and 24 h after V. splendidus stimulation. The mRNA expression level of CgSAA was up-regulated at 6 h (2.76-fold, p < 0.01), surged at 12 h (7.88-fold, p < 0.05), and ascended to the peak level at 24 h, which was 21.85-fold (p < 0.05) higher than that in control group post V. splendidus stimulation, respectively (Figure 4A).
After being subjected to high temperature stress (34 °C), the expression level of CgSAA in the Crassostrea gigas remained relatively unchanged in the first 6 h. Then, it was significantly unregulated and peaked at 12 h, reaching 21.77-fold (p < 0.01) of that in the control group, and kept at a high level at 24 h (14.6-fold of that in the control group, p < 0.05) (Figure 4B). Under hypotonic stress, the expression of CgSAA in hemocytes was quickly induced, with the highest expression level at 6 h in the low salinity group, which was 3.58-fold (p < 0.01) that of the control group. Then, the expression level of CgSAA decreased sharply with the prolongation of treatment time and reached the lowest at 24 h (Figure 4C).

3.4. The Expressions of Cytokines Following Injection of rCgSAA in Oysters

The recombinant protein of the CgSAA (rCgSAA)-containing SAA domain was expressed and purified by the His-tag Protein Fusion and Purification System. The band with a molecular weight of 22 kDa was observed (pET-30a is about 6 kDa), which was consistent with the predicted molecular weight (15.66 kDa) of CgSAA (Figure 5). Then, the purified rCgSAA protein was used for oyster injection.
The mRNA expression of cytokine CgIL17-1, CgIL17-5, and CgTNF was detected after rCgSAA injection. The expression level of CgIL17-1 increased at 6 h after rCgSAA stimulation and peaked at 12 h, which was 10.29-fold (p < 0.01) that of expression in the control group (Figure 6A). The relative expression level of CgIL17-5 was significantly induced at 12 h and 24 h, which were 1.5- and 22.18-fold of that in the control group, respectively, p < 0.05 (Figure 6B). Within 12 h after PBS injection, the expression levels of CgIL17-1 and CgIL17-5 did not change significantly. The relative expression level of CgTNF was up-regulated at 6 h and 12 h after rCgSAA injection, which was 1.64-fold (p > 0.05) and 2.48-fold (p < 0.01) higher than that of blank group, respectively (Figure 6C).

3.5. The Expressions of Cytokines in Haemocytes Following Incubation with rCgSAA

To explore how rCgSAA induces an immune response in oysters, the cultured primary hemocytes were incubated with rCgSAA for 6 h, and the expression of CgIL17-1, CgIL17-5, and CgTNF mRNA in hemocytes was detected. When the concentration of rCgSAA reached 50 μg/mL, it could significantly (p < 0.01) induce the expression of CgIL17-1 and CgIL17-5 in hemocytes, which were 2.48-fold or 2.55-fold that of the 0 μg mL−1 group, respectively, (Figure 6D). In particular, when the concentration of rCgSAA reaches 10 μg/mL, the expression level of CgTNF in hemocytes is significantly enhanced, which is 1.77-fold (p < 0.05) that of the 0 μg mL−1 group.

4. Discussion

The acute-phase serum amyloid A (SAA), a major acute-phase protein in vertebrates, plays a crucial role in the innate immune response and inflammation. It was isolated and named over 50 years ago and has a striking relationship to the acute-phase response with serum levels rising as much as 1000-fold in 24 h [8,15]. SAA proteins are encoded in a family of closely related genes and have been remarkably conserved throughout vertebrate evolution [3]. However, the study of SAA in invertebrates is relatively nascent. Though more and more components of the invertebrate immune system resembling vertebrate counterparts have been discovered, the presence of SAA has been reported so far in a very limited number of invertebrates, especially in aquatic species. The present study identified the only saa gene (CgSAA) from oyster C. gigas, and its molecular characteristics, expression pattern, as well as possible functions, were further investigated, with the aim of exploring the evolution of SAAs and the possible role of CgSAA in the immune response.
There are a varied number of SAA genes in different organisms, and SAA-related proteins and genes constitute a closely related family. In human, there are four SAA genes identified and all of them are clustered on a single chromosome 11p [2]. In mice, there are four functional SAA genes and one pseudogene, which are located in chromosome 7. By genomic and transcriptomic analysis, 51 SAA-like proteins were retrieved in several protostome taxa comprising 21 marine bivalve species and basal metazoans [7]. Most of these organisms only harbor one SAA gene. In oyster C. gigas, only one SAA gene was screened, which was consistent with that in its sister species Crassostrea hongkongensis. Invertebrate SAA-like proteins share certain structural features with vertebrate SAA, including a conserved N-terminal region and a variable C-terminal region. These proteins are typically small, with molecular weights ranging from 10 to 20 kDa [4,7]. In oyster C. gigas, the open reading frame of CgSAA encoded a putative polypeptide of 138 amino acid residues with a predicted molecular weight of 15.66 kDa. By structural prediction, CgSAA was found to contain a signal peptide (residues 1–22) and a structural SAA domain (residues 36–138). Multiple sequence comparisons showed that the SAA domain of the CgSAA gene shared high similarity with those of chordates and invertebrates, with the highest similarity (99%) to that of Crassostrea virginica [9]. Ten SAA-5 from various species of vertebrates and invertebrates were selected for phylogenetic analysis, and CgSAA was clustered with CvSAA-5 from C. virginica. These results indicated that CgSAA was a conserved homolog of the SAA family in oysters.
Functional studies have shown that invertebrate SAA-like proteins exhibit similar immune-modulatory activities to vertebrate SAA. In vertebrates, SAA proteins are mainly synthesized in the liver in response to immune challenges, such as bacterial or viral infections and are secreted into the hemolymph or other body fluids [4]. In invertebrates no specific liver tissue was evolved and developed, and the synthesis of the SAA protein was mainly focused on immune-related tissues [23]. In the present study, CgSAA was detectable in all the sampled tissues of normal individuals but at a low level, with relative higher level in hemocytes, the ganglion, and the mantle. While in oyster C. hongkongensis, ChSAA was lowest expressed in hemocytes but higher expressed in the mantle and labial palps [9]. Though not highly expressed in normal condition, the expression of CgSAA was quickly unregulated after immune stimulation, which was similar to that in vertebrates. Living in intertidal environment, oysters always face environmental stresses, such as high temperature and low oxygen [24]. The mass death caused by high temperature (summary mortality) and continuous rainfall (hypotonic death) has severely dampened the oyster industry, but the mechanism as to why is still not clear [25]. In the present study, the expression of CgSAA was quickly unregulated in oysters cultured under high temperature (34 °C) stress or hypotonic stress (15‰). As an acute-phase response protein, SAA in human can rise 1000-fold in 24–36 h following the initiating stimulus, which is commonly used as a diagnosing marker for infection or inflammation [26]. The prompt expression changes of CgSAA under infection and environmental stresses inferred that it could be used as a sensitive diagnosing marker of oyster disease.
The role of SAA proteins in immune responses is multifaceted. In vertebrates, they can bind to lipoproteins, enhance phagocytosis, and stimulate the production of immune mediators in mammalians [27]. Some SAA proteins have been shown to exhibit antimicrobial and antiviral activity, directly inhibiting the growth of pathogens. They can also modulate the production of cytokines and other immune mediators, thereby regulating the inflammatory response. While in invertebrates, the role of SAA protein in mediating immune response has not been fully uncovered, and only limited studies have reported that its expression changes under immune stimulation. In echinoderm, for example, SAA proteins have been shown to be induced in response to LPS stimulation or during intestinal regeneration [8,28]. These proteins are secreted into the hemolymph and bind to lipoproteins, forming complexes that are recognized by immune cells. In mollusks Tridacna crocea, SAA protein has been found to exhibit binding and antimicrobial activity against a range of bacteria pathogens, and it could reduce the lethality rate of infected individuals [10]. In the present study, to explore the potential role of SAA in immune response, the recombinant rCgSAA was prepared and injected into oysters or incubated with primary cultured hemocytes. The expressions of cytokines including IL17-1, IL17-1, and TNF were all significantly induced after rCgSAA treatment, indicating the important role of CgSAA in inflammation. In oyster C. hongkongensis, the over-expression of ChSAA via transfection with a ChSAA expression vector led to significantly increased NF-kB activity in HEK293T cells [9]. In mammalians, the SAA was also found to display a proinflammatory effect, and it could promote synovial macrophage activation and chronic arthritis via NFAT5.
Though the detail mechanism of CgSAA-induced inflammation is still missing, it could be inferred that the NF-kB signal might play a role similar to that in oyster C. hongkongensis. In oysters, the inflammation caused by cytokines including IL17-1, IL17-1, and TNF [21,29], plays an important role in mass mortality under stressful environment. Considering the high expression of CgSAA and serious mortality in oyster under high temperature stress or hypotonic stress, the CgSAA-induced severe inflammation might be the main cause of summary mortality in oyster industry. The discovery of SAA function in oysters has opened up new possibilities for the development of disease-resistant strains and biotechnology applications.

5. Conclusions

In this study, the only gene, CgSAA, encoding the SAA protein was identified in Crassostrea gigas and the results collectively suggested that CgSAA is a conserved acute-phase response protein in oysters. In normal conditions, the mRNA expression level of CgSAA in individual Crassostrea gigas can be detected but remains at a low level. The expression level is the lowest in the tissue of the labial palp and slightly higher in hemocytes. When exposed to Vibrio splendidus or high-temperature (34 °C, 30‰ salinity) stress, CgSAA expression rapidly increased, and inflammation worsened with prolonged stress. In contrast, under low salinity (18 °C, 15‰ salinity) stress, CgSAA expression peaked at 6 h, yet inflammation declined over time.
By regulating the production of cytokines, CgSAA played an important role in severe inflammation induced under high-temperature or hypotonic stress, which provided fresh ideas for understanding the roles of SAA proteins in the disease occurrence of aquatic species.

Author Contributions

J.C., W.W. and L.W. Conceived and designed the experiment; J.C. and X.C. carried out experiments; X.L. (Xuesong Li), L.L. and X.L. (Xingye Lian) analyzed data; J.C. and W.W. wrote the manuscript; W.W., L.W. and L.S. revised the manuscript. All the authors approved the final publication of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The authors thank all laboratory members for their valuable discussions. This research was supported by grants from Dalian High Level Talent Innovation Support Program (2021RQ091), National Science Foundation of China (Nos. 32230110), earmarked fund (CARS-49), the Fund for Outstanding Talents and Innovative Team of Agricultural Scientific Research in MARA, the innovation team of Aquaculture Environment Safety from Liaoning Province (LT202009), and grants from Natural Science Foundation of Liaoning Province (Nos. 2023-MS-286).

Institutional Review Board Statement

Ethics approval was not required for this study as C. gigas is a commercially available cultured marine species and not endangered or protected. An Ethics Approval Exemption was provided by the Ethics Committee of Dalian Ocean University.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original data supporting the conclusion of this paper will be provided by the author without reservation.

Acknowledgments

We are very grateful to all MBBL laboratory members for their technical advice and helpful discussions.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Baumann, H.; Gauldie, J. The Acute Phase Response. Immunol. Today 1994, 15, 74–80. [Google Scholar] [CrossRef] [PubMed]
  2. Sack, G.H. Serum Amyloid A (SAA) Proteins. In Vertebrate and Invertebrate Respiratory Proteins, Lipoproteins and other Body Fluid Proteins; Subcellular Biochemistry; Springer: Cham, Switzerland, 2020; Volume 94, pp. 421–436. [Google Scholar] [CrossRef]
  3. Sack, G.H. Serum Amyloid AA Review. Mol. Med. 2018, 24, 46. [Google Scholar] [CrossRef] [PubMed]
  4. Malle, E.; De Beer, F.C. Human Serum Amyloid A (SAA) Protein: A Prominent Acute-Phase Reactant for Clinical Practice. Eur. J. Clin. Invest. 1996, 26, 427–435. [Google Scholar] [CrossRef] [PubMed]
  5. Malle, E.; Steinmetz, A.; Raynes, J.G. Serum Amyloid A (SAA): An Acute Phase Protein and Apolipoprotein. Atherosclerosis 1993, 102, 131–146. [Google Scholar] [CrossRef] [PubMed]
  6. Cray, C.; Zaias, J.; Altman, N.H. Acute Phase Response in Animals: A Review. Comp. Med. 2009, 59, 517–526. [Google Scholar]
  7. Rosani, U.; Domeneghetti, S.; Gerdol, M.; Franzoi, M.; Pallavicini, A.; Venier, P. Serum Amyloid A in Marine Bivalves: An Acute Phase and Innate Immunity Protein. Dev. Comp. Immunol. 2016, 59, 136–144. [Google Scholar] [CrossRef]
  8. Santiago-Cardona, P.G.; Berríos, C.A.; Ramírez, F.; García-Arrarás, J.E. Lipopolysaccharides Induce Intestinal Serum Amyloid A Expression in the Sea Cucumber Holothuria Glaberrima. Dev. Comp. Immunol. 2003, 27, 105–110. [Google Scholar] [CrossRef]
  9. Qu, F.; Xiang, Z.; Yu, Z. The First Molluscan Acute Phase Serum Amyloid A (A-SAA) Identified from Oyster Crassostrea hongkongensis: Molecular Cloning and Functional Characterization. Fish Shellfish. Immunol. 2014, 39, 145–151. [Google Scholar] [CrossRef]
  10. Wang, J.; Yang, Y.; Zhang, A.; Zeng, L.; Xiao, S.; Ma, H.; Li, J.; Mao, F.; Zhang, Y.; Zhang, Y.; et al. Serum Amyloid Protein (SAA) as a Healthy Marker for Immune Function in Tridacna Crocea. Fish Shellfish Immunol. 2022, 122, 495–500. [Google Scholar] [CrossRef]
  11. Eckhardt, E.R.M.; Witta, J.; Zhong, J.; Arsenescu, R.; Arsenescu, V.; Wang, Y.; Ghoshal, S.; de Beer, M.C.; de Beer, F.C.; de Villiers, W.J.S. Intestinal Epithelial Serum Amyloid A Modulates Bacterial Growth in Vitro and Pro-Inflammatory Responses in Mouse Experimental Colitis. BMC Gastroenterol. 2010, 10, 133. [Google Scholar] [CrossRef]
  12. King, W.L.; Jenkins, C.; Seymour, J.R.; Labbate, M. Oyster Disease in a Changing Environment: Decrypting the Link between Pathogen, Microbiome and Environment. Mar. Environ. Res. 2019, 143, 124–140. [Google Scholar] [CrossRef] [PubMed]
  13. Petton, B.; Destoumieux-Garzón, D.; Pernet, F.; Toulza, E.; de Lorgeril, J.; Degremont, L.; Mitta, G. The Pacific Oyster Mortality Syndrome, a Polymicrobial and Multifactorial Disease: State of Knowledge and Future Directions. Front. Immunol. 2021, 12, 630343. [Google Scholar] [CrossRef] [PubMed]
  14. Xu, Y.-Z.; Fang, D.-Z.; Chen, F.-F.; Zhao, Q.-F.; Cai, C.-M.; Cheng, M.-G. Utilization of Recombinase Polymerase Amplification Method Combined with Lateral Flow Dipstick for Visual Detection of Respiratory Syncytial Virus. Mol. Cell. Probes 2020, 49, 101473. [Google Scholar] [CrossRef] [PubMed]
  15. Lavie, M.; Voisset, C.; Vu-Dac, N.; Zurawski, V.; Duverlie, G.; Wychowski, C.; Dubuisson, J. Serum Amyloid A Has Antiviral Activity against Hepatitis C Virus by Inhibiting Virus Entry in a Cell Culture System. Hepatology 2006, 44, 1626–1634. [Google Scholar] [CrossRef]
  16. Trevisan, R.; Mello, D.F.; Delapedra, G.; Silva, D.G.H.; Arl, M.; Danielli, N.M.; Metian, M.; Almeida, E.A.; Dafre, A.L. Gills as a Glutathione-Dependent Metabolic Barrier in Pacific Oysters Crassostrea gigas: Absorption, Metabolism and Excretion of a Model Electrophile. Aquat. Toxicol. 2016, 173, 105–119. [Google Scholar] [CrossRef]
  17. Arredondo-Espinoza, R.; Ibarra, A.M.; Roberts, S.B.; Sicard-González, M.T.; Escobedo-Fregoso, C. Transcriptome Profile in Heat Resilient Pacific Oyster Crassostrea gigas Families under Thermal Challenge. Comp. Biochem. Physiol. Part D Genom. Proteom. 2023, 47, 101089. [Google Scholar] [CrossRef]
  18. Zhu, T.; Liu, C.; Liu, Z.; Gao, Y.; Xin, X.; Wang, L.; Song, L. A Cartilage Matrix Protein Regulates Collagen Synthesis in Mantle of Magallana gigas (Crassostrea gigas) under Ocean Acidification. Fishes 2023, 8, 290. [Google Scholar] [CrossRef]
  19. Ribeiro, V.T.; Asevedo, E.A.; de Paiva Vasconcelos, L.T.C.; Filho, M.A.O.; de Araújo, J.S.; de Macedo, G.R.; de Sousa, F.C., Jr.; Dos Santos, E.S. Evaluation of Induction Conditions for Plasmid pQE-30 Stability and 503 Antigen of Leishmania i. Chagasi Expression in E. Coli M15. Appl. Microbiol. Biotechnol. 2019, 103, 6495–6504. [Google Scholar] [CrossRef]
  20. Rahman, M.A.; Henderson, S.; Miller-Ezzy, P.; Li, X.X.; Qin, J.G. Immune Response to Temperature Stress in Three Bivalve Species: Pacific Oyster Crassostrea gigas, Mediterranean Mussel Mytilus Galloprovincialis and Mud Cockle Katelysia Rhytiphora. Fish Shellfish Immunol. 2019, 86, 868–874. [Google Scholar] [CrossRef]
  21. Wang, L.; Sun, J.; Wu, Z.; Lian, X.; Han, S.; Huang, S.; Yang, C.; Wang, L.; Song, L. AP-1 Regulates the Expression of IL17-4 and IL17-5 in the Pacific Oyster Crassostrea gigas. Fish Shellfish Immunol. 2020, 97, 554–563. [Google Scholar] [CrossRef]
  22. Ma, Y.; Liu, X.; Liu, D.; Yin, Z.; Yang, X.; Zeng, M. Oyster (Crassostrea gigas) Polysaccharide Ameliorates High-Fat-Diet-Induced Oxidative Stress and Inflammation in the Liver via the Bile Acid-FXR-AMPKα Pathway. J. Agric. Food Chem. 2022, 70, 8662–8671. [Google Scholar] [CrossRef] [PubMed]
  23. Zhang, Y.; Ni, M.; Bai, Y.; Shi, Q.; Zheng, J.; Cui, Z. Full-Length Transcriptome Analysis Provides New Insights Into the Diversity of Immune-Related Genes in Portunus Trituberculatus. Front. Immunol. 2022, 13, 843347. [Google Scholar] [CrossRef] [PubMed]
  24. Trevisan, R.; Mello, D.F. Redox Control of Antioxidants, Metabolism, Immunity, and Development at the Core of Stress Adaptation of the Oyster Crassostrea gigas to the Dynamic Intertidal Environment. Free Radic. Biol. Med. 2024, 210, 85–106. [Google Scholar] [CrossRef] [PubMed]
  25. Li, X.; Shi, C.; Yang, B.; Li, Q.; Liu, S. High Temperature Aggravates Mortalities of the Pacific Oyster (Crassostrea gigas) Infected with Vibrio: A Perspective from Homeostasis of Digestive Microbiota and Immune Response. Aquaculture 2023, 568, 739309. [Google Scholar] [CrossRef]
  26. Abdullahi, A.; Stanojcic, M.; Yu, N.; Samadi, O.; Sadri, A.-R.; Vinaik, R.; Coburn, N.; Jeschke, M.G. Serum Amlyoid A: An Inflammatory Adipokine Mediating Postburn Outcomes. Clin. Transl. Med. 2021, 11, e412. [Google Scholar] [CrossRef]
  27. Abouelasrar Salama, S.; Gouwy, M.; Van Damme, J.; Struyf, S. The Turning Away of Serum Amyloid A Biological Activities and Receptor Usage. Immunology 2021, 163, 115–127. [Google Scholar] [CrossRef]
  28. Lee, H.J.; Kim, J.H.; Kim, S.W.; Joo, H.A.; Lee, H.W.; Kim, Y.S.; Park, S.J.; Hong, S.P.; Kim, T.I.; Kim, W.H.; et al. Proteomic Analysis of Serum Amyloid A as a Potential Marker in Intestinal Behçet’s Disease. Dig. Dis. Sci. 2017, 62, 1953–1962. [Google Scholar] [CrossRef]
  29. Kuret, T.; Peskar, D.; Kreft, M.E.; Erman, A.; Veranič, P. Comprehensive Transcriptome Profiling of Urothelial Cells Following TNFα Stimulation in an in Vitro Interstitial Cystitis/Bladder Pain Syndrome Model. Front. Immunol. 2022, 13, 960667. [Google Scholar] [CrossRef]
Figure 1. Sequence features of CgSAA. (A) The sequence of ORF and encoded amino acids. The nucleotides and amino acids are numbered along the left margin. The symbol (-) represents a stop codon. The SAA domain is shadowed. (B) Prediction of protein domains by SMART analysis.
Figure 1. Sequence features of CgSAA. (A) The sequence of ORF and encoded amino acids. The nucleotides and amino acids are numbered along the left margin. The symbol (-) represents a stop codon. The SAA domain is shadowed. (B) Prediction of protein domains by SMART analysis.
Fishes 10 00093 g001
Figure 2. Regarding CgSAA and its homologues, both the multiple sequence alignment and the phylogenetic tree were constructed. (A) Multiple sequence alignment analysis of putative domains of CgSAA with other SAA deposited in GenBank and the following are the proteins analyzed: Strongylocentrotus purpuratus (XP_030837042.1), Crassostrea virginica (XP_022321638.1), Branchiostoma belcheri (XP_019623558.1), Poecilia reticulata (XP_008433017.1), Poecilia latipinna (XP_014890824.1), Scleropages Formosus (XP_018618982.1), Microtus ochrogaster (XP_005366816.1), Alligator sinensis (XP_025057901.1), Crocodylus porosus (XP_019407521.1), Crassostrea hongkongensis (AHY23235.1), Meretrix meretrix (AJF23095.1). The identical amino acid residues are shaded in black, and the similar amino acids are shaded in gray. (B) MEGA-X software (version 10.1.7) was used to conduct phylogenetic analysis on CgSAA and other SAA proteins from multiple different species.
Figure 2. Regarding CgSAA and its homologues, both the multiple sequence alignment and the phylogenetic tree were constructed. (A) Multiple sequence alignment analysis of putative domains of CgSAA with other SAA deposited in GenBank and the following are the proteins analyzed: Strongylocentrotus purpuratus (XP_030837042.1), Crassostrea virginica (XP_022321638.1), Branchiostoma belcheri (XP_019623558.1), Poecilia reticulata (XP_008433017.1), Poecilia latipinna (XP_014890824.1), Scleropages Formosus (XP_018618982.1), Microtus ochrogaster (XP_005366816.1), Alligator sinensis (XP_025057901.1), Crocodylus porosus (XP_019407521.1), Crassostrea hongkongensis (AHY23235.1), Meretrix meretrix (AJF23095.1). The identical amino acid residues are shaded in black, and the similar amino acids are shaded in gray. (B) MEGA-X software (version 10.1.7) was used to conduct phylogenetic analysis on CgSAA and other SAA proteins from multiple different species.
Fishes 10 00093 g002
Figure 3. The spatiotemporal expression pattern of CgSAA mRNA. (A) Expression of CgSAA mRNA in different tissues of oyster detected by real-time PCR. (B) The expression levels of CgSAA mRNA in the embryonic and larval stages of the Crassostrea gigas. Data are shown as mean ± S.D (N = 3). The different letters (a, b and c) indicated significant differences (p < 0.05). Labial palp, hepatopancreas, muscle, gill, ganglion, mantle, hemocytes.
Figure 3. The spatiotemporal expression pattern of CgSAA mRNA. (A) Expression of CgSAA mRNA in different tissues of oyster detected by real-time PCR. (B) The expression levels of CgSAA mRNA in the embryonic and larval stages of the Crassostrea gigas. Data are shown as mean ± S.D (N = 3). The different letters (a, b and c) indicated significant differences (p < 0.05). Labial palp, hepatopancreas, muscle, gill, ganglion, mantle, hemocytes.
Fishes 10 00093 g003
Figure 4. The expression levels of CgSAA in the Crassostrea gigas after being stimulated by different environmental factors. (A) The mRNA expression of CgSAA in hemocytes following the stimulation by Vibrio splendidus. (B) The mRNA expression of CgSAA in hemocytes after 34 °C seawater treatment. (C) 15‰ salinity seawater treatment. Hemocytes were collected at 0, 6, 12, and 24 h after treatment, respectively. Vertical bars represent the mean ± S.D (N = 3). The asterisks (* p < 0.05, ** p < 0.01) indicate the significant differences.
Figure 4. The expression levels of CgSAA in the Crassostrea gigas after being stimulated by different environmental factors. (A) The mRNA expression of CgSAA in hemocytes following the stimulation by Vibrio splendidus. (B) The mRNA expression of CgSAA in hemocytes after 34 °C seawater treatment. (C) 15‰ salinity seawater treatment. Hemocytes were collected at 0, 6, 12, and 24 h after treatment, respectively. Vertical bars represent the mean ± S.D (N = 3). The asterisks (* p < 0.05, ** p < 0.01) indicate the significant differences.
Fishes 10 00093 g004
Figure 5. SDS-PAGE analysis of rCgSAA. Lane M: standard protein molecular mass marker; lane 1: negative control (without induction); lane 2: induced rCgSAA; lane 3: purified rCgSAA.
Figure 5. SDS-PAGE analysis of rCgSAA. Lane M: standard protein molecular mass marker; lane 1: negative control (without induction); lane 2: induced rCgSAA; lane 3: purified rCgSAA.
Fishes 10 00093 g005
Figure 6. The promoting effect of rCgSAA on cytokine gene expression. (AC) The expression levels of CgIL17-1, CgIL17-5, and CgTNF in the Crassostrea gigas after treatment with rCgSAA. (D) The expression levels of CgIL17-1, CgIL17-5, and CgTNF in hemocytes after rCgSAA treatment. Vertical bars represent the mean ± S.D. (N = 3). The different letters (a, b and c) indicated significant differences (p < 0.05).
Figure 6. The promoting effect of rCgSAA on cytokine gene expression. (AC) The expression levels of CgIL17-1, CgIL17-5, and CgTNF in the Crassostrea gigas after treatment with rCgSAA. (D) The expression levels of CgIL17-1, CgIL17-5, and CgTNF in hemocytes after rCgSAA treatment. Vertical bars represent the mean ± S.D. (N = 3). The different letters (a, b and c) indicated significant differences (p < 0.05).
Fishes 10 00093 g006
Table 1. Primers used for RT-PCR in this study.
Table 1. Primers used for RT-PCR in this study.
Gene NamePrimer Sequence (5′-3′)
Clone primers
CgSAA-FATGAGGGTATTCGCAGTA
CgSAA-RCAGTATCTATCTGGTAACCC
Primers for recombinant expression
CgSAA-EXFCGCGGATCCCAGGGATTTTTAGACAGAATTCGAGAC
CgSAA-EXRCCGCTCGAGGTATCTATCTGGTAACCCATCGGGTCT
RT-PCR primers
CgIL17-1-RT-FGCGAACGCCACAGTGTCAAA
CgIL17-1-RT-RGACGCTACGAGGAAATACGGAC
CgIL17-5-RT-FTCTGGCTGACTCTCGTCCTTG
CgIL17-5-RT-RGACCCTGTCGTTGTCCTCTACC
CgILTNF-RT-FCTTCTCGTCTGCGGCTTCTTT
CgILTNF-RT-RCAGGGCTGCGGTCTTTCC
CgEF-RT-FAGTCACCAAGGCTGCACAGAAAG
CgEF-RT-RACGACGATCGCATTTCTCTT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cheng, J.; Wang, W.; Cheng, X.; Li, X.; Lun, L.; Lian, X.; Wang, L.; Song, L. The Acute-Phase Serum Amyloid A Promotes Cytokines Production in Oyster Crassostrea gigas. Fishes 2025, 10, 93. https://doi.org/10.3390/fishes10030093

AMA Style

Cheng J, Wang W, Cheng X, Li X, Lun L, Lian X, Wang L, Song L. The Acute-Phase Serum Amyloid A Promotes Cytokines Production in Oyster Crassostrea gigas. Fishes. 2025; 10(3):93. https://doi.org/10.3390/fishes10030093

Chicago/Turabian Style

Cheng, Junlei, Weilin Wang, Xuemei Cheng, Xuesong Li, Luyi Lun, Xingye Lian, Lingling Wang, and Linsheng Song. 2025. "The Acute-Phase Serum Amyloid A Promotes Cytokines Production in Oyster Crassostrea gigas" Fishes 10, no. 3: 93. https://doi.org/10.3390/fishes10030093

APA Style

Cheng, J., Wang, W., Cheng, X., Li, X., Lun, L., Lian, X., Wang, L., & Song, L. (2025). The Acute-Phase Serum Amyloid A Promotes Cytokines Production in Oyster Crassostrea gigas. Fishes, 10(3), 93. https://doi.org/10.3390/fishes10030093

Article Metrics

Back to TopTop