Next Article in Journal
Transcriptome Analysis of Natural Albino Northern Snakehead (Channa argus var.) Provides Novel Insights into Color-Related Genes
Previous Article in Journal
Evaluation of Silymarin–L-Carnitine as a Dietary Supplement on Growth Performance, Antioxidants and Immunity, Gut/Liver Health, and Gene Expression in Nile Tilapia (Oreochromis niloticus)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 10
Issue 11
10.3390/fishes10110581
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Role of Hydrogen-Rich Water on Growth Performance and Liver Antioxidant Capacity of Mandarin Fish (Siniperca chuatsi)

by
Haolin Wang
1,†,
Jing Huang
1,†,
Hua Liu
1,
Ying Yang
1,* and
Junru Hu
2,*
1
School of Animal Science and Technology, Foshan University, Foshan 528225, China
2
Institute of Animal Science, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fishes 2025, 10(11), 581; https://doi.org/10.3390/fishes10110581
Submission received: 7 October 2025 / Revised: 6 November 2025 / Accepted: 11 November 2025 / Published: 12 November 2025
Browse Figures
Versions Notes

Abstract

Hydrogen-rich water (HRW) is known for its antioxidant, anti-inflammatory, and growth-enhancing properties. However, research on its effects on mandarin fish (Siniperca chuatsi) is limited. This study aimed to explore the effects of HRW on the growth and liver antioxidant capacity of mandarin fish. A total of 3600 fish, with an initial average weight of 30 ± 1 g, were randomly divided into four groups (three replicates each) and treated with HRW for 0 h (control), 1 h, 2 h, and 3 h over an 8-week period. In this study, we found that HRW significantly enhanced weight gain, specific growth rate, and feed intake in mandarin fish, while reducing the feed conversion ratio. It also boosted antioxidant enzyme levels (SOD and GSH-PX) in the liver and lowered MDA. Additionally, HRW increased muscle growth-related gene expression (mrf4, myos, myod, mhc) and upregulated appetite-related genes (npy and agrp) while decreasing leptin levels. This study reveals that a hydrogen concentration of 200–320 ppb, especially with a 2 h HRW treatment, produces the most significant antioxidant effects in juvenile mandarin fish, while a 3 h treatment notably enhances growth. These findings offer valuable insights and support for the advancement of the mandarin fish breeding industry.
Keywords:
Siniperca chustsi; hydrogen-rich water; growth performance; antioxidant capacity
Key Contribution: To enhance the healthy production of mandarin fish, we assessed the dose- and time-dependent benefits of hydrogen-rich water. The results indicate that 200–320 ppb HRW, particularly with a 2 h application, maximizes antioxidant capacity, while a 3 h exposure optimally boosts growth and feed conversion. These findings offer practical guidance for incorporating HRW into mandarin fish culture systems.

1. Introduction

The mandarin fish (Siniperca chuatsi), belonging to the genus Siniperca in the order Perciformes, is commonly known as Guihua fish and is one of the most valuable freshwater fish species in China [1]. Mandarin fish fed with artificial diets are susceptible to feeding slowdown, extreme loss of appetite or no feeding at all during the aquaculture process, which seriously restricts their growth rate and survival rate and hinders the healthy development of the industry. In order to effectively increase its feed utilization rate and improve the growth performance and feeding problems of mandarin fish, it is increasingly urgent to find a new green culture technology.
Hydrogen-rich water (HRW) is a novel electrolyzed water rich in hydrogen, commonly prepared by electrolysis or by generating hydrogen gas through the reaction of magnesium with water [2]. HRW has a variety of physiological effects, mainly antioxidant, anti-inflammatory, anti-apoptosis, promoting metabolism and energy generation [3,4,5]. In recent years HRW has been widely used in the agricultural field [6], and is gradually expanding to the field of aquaculture. A recent study revealed that hydrogen could rescue coral photosynthesis from heat stress. For Acropora species, hydrogen restored the heat-suppressed maximum electron transport rate to pre-stress levels, effectively mitigating the damage to their photosynthetic apparatus [7]. As a novel gas signaling molecule, hydrogen has shown significant effects in regulating animal physiological functions, improving disease resistance and promoting growth [8]. Hydrogen enhances the growth performance of juvenile largemouth bass (Micropterus salmoides) by regulating appetite-promoting factors and growth factors [9,10]. HRW has a significant effect on inhibiting the increase in Aeromonas hydrophila abundance and the expression of pro-inflammatory genes in zebrafish (Danio rerio), and improving the survival rate of zebrafish [11]. Additionally, it has been reported that HRW can also promote zebrafish embryo osteogenesis, increase vertebral mineralization rate, and inhibit virus-induced inflammatory response [12,13]. These results provide possible evidence for the effect of HRW on the growth performance of mandarin fish, which is worthy of further study.
The domestication of artificial feed, a pivotal aspect of mandarin fish aquaculture, can lead to a marked reduction in the activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) in the gills and liver of this species, while concurrently causing an elevation in the levels of malondialdehyde (MDA) [14]. This physiological alteration, which has been validated in prior studies, clearly indicates that mandarin fish exhibits weak tolerance to oxidative stress. Notably, this key challenge aligns with the well-documented antioxidant properties of HRW in aquatic organisms, making HRW a promising candidate for addressing such oxidative stress-related issues. On this basis, the present study intends to investigate the effects of HRW on growth performance, appetite, liver antioxidant capacity, and the expression of genes related to the Keap1-Nrf2 pathway in juvenile mandarin fish. The primary aim is to screen for optimal HRW application parameters suitable for mandarin fish aquaculture, thereby providing a theoretical basis and technical support for the green and efficient cultivation of this high-value species.

2. Materials and Methods

2.1. Materials

The experimental setup consisted of multiple breeding barrels, each fitted with a dedicated PEM electrolysis hydrogen production system (Guangdong Cawolo Hydrogen Energy Technology Co., Ltd., Foshan, China). Each system had a hydrogen production capacity of 1000 ppb per hour per ton of water. During the experiment, the hydrogen concentration in the aquaculture water was monitored using a TRUSTLEX ENH-2000 monitor. In this experiment, mandarin fish were provided by Qingyuan Yurong Agricultural Science and Technology Co., Ltd. (Guangdong, China). No vaccine was injected, nor were antibiotics used. Mandarin fish with an average body weight of 30 ± 1 g, a body length of 11 ± 1 cm and normal activity were selected.

2.2. Experimental Design and Breeding Management

The experimental fish were temporarily cultured in an efficient circulating water aquaculture system for 7 days, and the basic feed of mandarin fish was fed during the period. In this study, each breeding barrel served as an experimental unit. A total of 3600 mandarin fish were randomly allocated to one control group and three HRW-treatment groups (exposed for 1, 2, and 3 h per day, respectively), with three replicate barrels per group and 300 fish in each replicate. Throughout the 8-week experiment, HRW exposure was carried out daily at a fixed time (8:00). The fish were fed twice per day (at 6:00 and 16:00) until apparent satiety. Water quality parameters including temperature, pH, dissolved oxygen, ammonia nitrogen, and nitrite were monitored daily. The water temperature was maintained at 23 ± 1 °C, pH ranged at 6.7–7.3, dissolved oxygen above 5 mg/L, ammonia nitrogen below 0.2 mg/L, and nitrite below 0.1 mg/L. The range of dissolved hydrogen is shown in Figure 1.

2.3. Sample Collection

After 8 weeks of daily HRW exposure, the mandarin fish were fasted for 24 h, then weighed and counted in the morning under eugenol (50 mg/L) anesthesia. The number of mandarin fish in each barrel was counted and weighed to determine the weight gain rate, specific growth rate, feed coefficient, feeding rate and survival rate. Sixty fish were randomly selected from each breeding barrel, and blood was collected from the tail vein with a 1 mL syringe. The blood of each three fish was placed in the same sterilized EP (Eppendorf) tube. Subsequently, the separated serum samples were collected after centrifugation at 4 °C (1600× g, 10 min) and stored in a refrigerator at −80 °C for subsequent index analysis. The brain, muscle, liver and other tissues were immediately frozen in liquid nitrogen and stored at −80 °C for long-term storage for biochemical and molecular biological analysis.

2.4. Index Detection of Samples

The liver samples were cut and weighed, then mixed with normal saline at a ratio of 1:9. After homogenization in an ice bath, the mixture was centrifuged at 3000 r/min for 15 min at 4 °C. The protein content was determined by the Coomassie Brilliant Blue method. For SOD, GSH-Px, and MDA detection—all following Nanjing Jiancheng Bioengineering Institute’s kit instructions—the respective catalog numbers are A045-2-2, A007-1-1, and A006-2-1.

2.5. Muscle Growth, Brain Feeding and Liver Antioxidant Related Gene mRNA Relative Expression

Total RNA was extracted from all samples using a TransZol Up Plus RNA kit (ER501-01-V2, TransGen Biotech, Beijing, China). The RNA quantity and purity were assessed with a Q5000 UV–Vis spectrophotometer (Quawell, San Jose, CA, USA), and integrity was verified on a 1.5% agarose gel. The total RNA of muscle tissue, brain and liver tissue samples was reverse transcribed using TransStart® Top green qPCR SuperMix reagent from TransGen Biotech Co., Ltd. (Beijing, China). The relative mRNA expression levels were determined by quantitative real-time PCR using ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China). The relative expression levels of genes were calculated using the 2-ΔΔCt method [15], with β-actin as the housekeeping genes. The validation of primers was conducted by evaluating PCR efficiency through the use of a standard curve, following MIQE (Minimum Information for Publication of Quantitative Real-Time PCR) guidelines [16]. The primer sequences are listed in Table 1.

2.6. Data Statistics and Analysis

  • Survival rate (SR, %) = (final fish number/initial fish number) × 100 [17]
  • Weight gain rate (WGR, %) = 100 × (final weight − initial weight)/initial weight [18]
  • Feed conversion ratio (FCR) = dry feed consumed/(final weight − initial weight) [17]
  • Specific growth rate (SGR, %/d) = 100 × (Ln final weight − Ln initial weight)/trial days [19]
  • Feed rate (FR, g/fish) = 100 × dry feed consumed/[feeding days × (final fish weight + initial fish weight)/2] [20]
Alpha-diversity indices were analyzed in SPSS 21.0 (SPSS Inc., Chicago, IL, USA). Normality and homogeneity of variance were examined by Shapiro–Wilk and Levene tests, respectively. Only datasets that met both assumptions (p ≥ 0.05) were subjected to one-way ANOVA followed by Duncan’s multiple-range test; otherwise, Welch’s ANOVA or Kruskal–Wallis test was used. Significance was set at p < 0.05. Values are presented as mean ± SD of three independent replicates.

3. Results

3.1. Effect of Growth Performance of Mandarin Fish

As shown in Table 2, no statistically significant differences were discerned in either initial weight or survival rate among the various treatment groups (p > 0.05). Both the final weight and weight gain rate exhibited a positive correlation with the duration of HRW treatment, reaching their highest values in the 3 h treatment group (p < 0.05). In the 2 h and 3 h HRW treatment groups, the feeding rate and specific growth rate were significantly elevated compared to those in the control group and the 1 h treatment group. Additionally, the FCR exhibited a noteworthy reduction in correlation with the duration of HRW treatment (p < 0.05), ultimately achieving its minimum value at the 3 h HRW treatment.

3.2. Effect of Antioxidant Enzyme Activity in Liver of Mandarin Fish

As shown in Figure 2, the level of MDA in the 2 h HRW treatment group was significantly lower than that observed in the control group (p < 0.05). Conversely, the activities of SOD and GSH-Px in the 2 h HRW treatment group were markedly elevated compared to the control group (p < 0.05).

3.3. Effect of Muscle Growth Gene Expression in Mandarin Fish

As shown in Figure 3, HRW treatment significantly impacted the expression of muscle growth-related genes in mandarin fish. The relative expression levels of the mrf4 and myos genes reached their maximum in the 2 h HRW treatment group, while no significant difference in mrf4 expression was noted between the 2 h and 3 h HRW treatment groups. Moreover, the relative expression levels of the myod and mhc genes in the 3 h HRW treatment group were significantly elevated compared to those in the control group (p < 0.05).

3.4. Effects on the Expression of Appetite-Related Genes in the Brain of Mandarin Fish

As shown in Figure 4, HRW treatment exerted a significant effect on the expression of appetite-related genes in the brain of mandarin fish. The relative expression of leptin mRNA in the three HRW treatment groups was significantly diminished in comparison to that in the control group (p < 0.05). Among all groups, the 3 h HRW treatment group exhibited the highest expression levels of npy and agrp. Furthermore, the relative expression of cart in the 3 h HRW treatment group was significantly reduced compared to that in the control group (p < 0.05).

3.5. Effect of Antioxidant Gene Expression in Liver of Mandarin Fish

Figure 5 shows the effect of HRW treatment on the expression of antioxidant-related genes in the liver of mandarin fish. The relative expression of sod mRNA in the 2 h and 3 h HRW treatment groups was significantly higher than that observed in the other groups (p < 0.05), although no significant difference was noted between the two HRW treatment groups. Furthermore, the mRNA expression levels of nrf2, cat, keap1, and gr in the 3 h HRW treatment group were significantly elevated compared to the control group (p < 0.05). There was no significant difference in the relative expression of gsh-px between the groups (p > 0.05).

4. Discussion

Hydrogen molecules can selectively reduce harmful free radicals and improve cell metabolism and function [21]. This mechanism may have a positive impact on the metabolic process of fish [10]. As a gas, hydrogen plays a crucial role in promoting plant growth, acting as an antioxidant, and enhancing plants’ resilience to stress [22]. Nevertheless, the effects of exogenous hydrogen on the growth performance of mandarin fish remain unexplored. Consequently, this study aimed to investigate the impact of HRW on both the growth performance and liver health of mandarin fish. The findings of this study indicated that within the HRW concentration range of 200 to 320 ppb, treatment durations of 1 to 3 h elicited a significant enhancement in the final weight, weight gain rate, specific growth rate, and feeding rate of mandarin fish, while concurrently reducing the feed conversion ratio. Notably, the 2 h and 3 h HRW treatments resulted in a substantial increase in both the specific growth rate and feeding rate. This aligns with previous studies indicating that HRW enhances the growth performance of largemouth bass [8]. This study provides empirical evidence that HRW enhances growth performance in mandarin fish, an effect concomitant with an improved antioxidant capacity. Specifically, HRW administration significantly elevated the activities of key antioxidant enzymes (SOD and GSH-PX) and reduced the level of MDA. These findings confirm that HRW effectively alleviates oxidative stress. It is plausible that the underlying growth-promoting mechanism involves the scavenging of excess reactive oxygen species (ROS) by the boosted antioxidant system, which mitigates oxidative damage to cell membranes and thereby preserves the efficiency of mitochondrial energy metabolism. The subsequent adequate ATP supply is crucial for supporting energy-demanding growth processes, such as protein synthesis. This protective mechanism aligns well with established findings in mammalian models of oxidative stress, reinforcing the reliability of our observations and suggesting the broad potential of HRW application in aquaculture.
Muscle growth serves as the quintessential indicator of fish growth performance, encompassing a dynamic interplay characterized by the differentiation, proliferation, and formation of muscle fibers from muscle cells [23,24]. In this intricate process, mrf4 and myod emerge as pivotal upstream regulatory factors derived from muscle, collaborating to catalyze the differentiation of muscle cells [25]. Conversely, myos functions as a negative regulatory element, counteracting the actions of mrf4 and myod, thereby establishing a delicate equilibrium in muscle growth [26]. Collectively, these three factors orchestrate the expression of downstream mhc genes, culminating in a regulatory network that profoundly influences muscle development in fish [27]. In the 2 h HRW treatment group, the upregulation of the myos gene may serve to enhance the inhibition of muscle growth, effectively counterbalancing the stimulating effects of mrf4 on differentiation. As a result, the expression levels of myod and mhc remain relatively stable, reflecting a harmonious equilibrium between the positive and negative regulators that govern muscle growth. In contrast, within the 3 h HRW treatment group, the myos gene appears to maintain a baseline level of muscle growth inhibition. However, the upregulation of mrf4 and myod transcends its inhibitory capacity, thereby promoting an increase in mhc expression, which ultimately stimulates muscle growth. The treatment with HRW has also demonstrated the potential to promote growth and enhance muscle development in mammals. Research indicates that HRW has a positive effect on muscle repair and growth in mouse models [28], similar to the muscle growth-promoting effects observed in fish. However, the specific regulatory mechanisms following HRW treatment in fish and mammals may differ, warranting further exploration.
The elevation in feeding rate is intricately linked to the modulation of appetite gene expression. The regulation of appetite is a process involving the interaction of a large number of peripheral signals with the brain, and these signals can affect the intracellular metabolism of animals [29]. Npy stands out as the most potent appetite-stimulating peptide in the fish brain, significantly enhancing food intake and promoting weight gain [30]. Experimental studies have demonstrated that the administration of Npy via ventricular injections in goldfish, tilapia, or zebrafish leads to a marked increase in food consumption [31,32,33]. Agrp further augments feeding behavior by antagonizing the melanocortin receptor (MC4R), thereby inhibiting satiety signals [34]. Agrp has been validated as a powerful appetite stimulant in goldfish, zebrafish, perciformes, and various other fish species [35,36,37]. Conversely, leptin plays a crucial role in suppressing Npy/Agrp expression while activating the pro-opiomelanocortin (POMC)/α-melanocyte-stimulating hormone (α-MSH) pathway, which results in a reduction in food intake [38,39]. In fact, the appetite of many fish species, including goldfish, rainbow trout, and grass carp, diminishes significantly following the injection of recombinant leptin [40]. Furthermore, cart is expressed in the hypothalamus of fish, functioning to inhibit feeding and promote lipid oxidation [41]. In alignment with previous research findings, the expression of npy and agrp genes was significantly upregulated in the 3 h HRW treatment group compared to the control group, while leptin and cart genes were notably downregulated in the same comparison. These findings suggest that HRW enhances the feeding rate of mandarin fish by upregulating the expression of npy and agrp genes, while concurrently downregulating leptin and cart genes.
During the rapid growth phase of fish, the elevation of metabolic rate is inevitably accompanied by an increase in ROS [42]. This surge in ROS can induce oxidative stress, which directly impairs the growth rate of fish and adversely affects their energy metabolism [43]. Research indicates that hydrogen molecules can function as selective antioxidants, significantly mitigating the oxidative stress encountered by organisms and facilitating the improvement of tissue function [21]. The Keap1-Nrf2 signaling pathway plays a central role in the antioxidant protective effects of hydrogen-rich water. Numerous studies have indicated that hydrogen-rich water may promote the release and nuclear translocation of Nrf2 by directly or indirectly influencing Keap1, thereby activating Nrf2 and facilitating the expression of various antioxidant genes [44,45,46,47]. Similarly to previous research findings, this study observed a notable increase in the activity of antioxidant enzymes, specifically SOD and GSH-Px, alongside a reduction in MDA levels within the 2 h HRW treatment group, which collectively aid in mitigating oxidative damage. Additionally, the expression of key antioxidant genes, including nrf2, cat, keap1, and gr, was significantly upregulated. Notably, within the 2 h HRW treatment group, the gene expressions of keap1 and nrf2 exhibited a synchronous upregulation, suggesting the presence of a finely tuned negative feedback regulation mechanism intrinsic to the Nrf2 signaling pathway. This self-regulating strategy serves to prevent an excessive antioxidant response. Consequently, Keap1 can swiftly counterbalance Nrf2 activation through negative feedback regulation, indicating a co-elevated relationship between Keap1 and Nrf2. Moreover, the upregulation of cat and gr was shown to enhance the decomposition rate of hydrogen peroxide and improve the regeneration efficiency of glutathione, respectively, thereby sustaining cellular redox homeostasis [48,49].
In conclusion, the HRW treatment group demonstrated a significant enhancement in the weight gain rate, specific growth rate, and feeding rate of mandarin fish, alongside a reduction in the feed conversion ratio. Notably, the 2 h HRW treatment markedly elevated the activities of antioxidant enzymes, including SOD and GSH-PX, within the liver of juvenile mandarin fish, while concurrently decreasing MDA levels and upregulating the expression of key antioxidant genes such as nrf2, cat, keap1, and gr. Furthermore, both the 2 h and 3 h HRW treatments significantly upregulated the expression of the muscle growth-related gene mrf4. The 3 h HRW treatment particularly facilitated the upregulation of appetite-associated genes agrp and npy, the downregulation of leptin and cart, and the upregulation of growth-related genes myod and mhc. These findings underscore the positive influence of HRW on the growth performance, feeding behavior, and hepatic antioxidant capacity of mandarin fish; nevertheless, long-term data addressing whether these benefits persist or extend to reproductive performance—central to aquaculture applications—remain to be gathered.

5. Conclusions

Considering the health and economic ramifications for aquaculture, our research revealed that within the hydrogen concentration range of 200–320 ppb, the 2 h HRW treatment demonstrated notable antioxidant effects on juvenile mandarin fish. In contrast, the 3 h HRW treatment offered significant growth enhancements for these fish. This study provides a crucial reference for the effective application of HRW in the breeding of mandarin fish, potentially advancing aquaculture practices.

Author Contributions

Conceptualization and methodology, H.W.; software, J.H. (Jing Huang); validation, H.W. and J.H. (Jing Huang); formal analysis and data curation, J.H. (Jing Huang); writing—original draft preparation, H.W. and J.H. (Jing Huang); writing—review and editing, H.L.; supervision, project administration and funding acquisition, Y.Y. and J.H. (Junru Hu). All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by National Natural Science Foundation of China (32202893); Construction funds for high level agricultural science and technology demonstration city in Guangdong Province in 2023; Foshan Nanhai District Modern Agricultural Industrial Park Research Institute Research Project (XJCG2024001); Guangdong Provincial Key Laboratory of Animal Molecular Design and Precise Breeding (2019B030301010).

Institutional Review Board Statement

This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institution Animal Ethics Committee of Foshan University (FS 2022–017) at Foshan, China (Approval date: 29 March 2022).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no competing financial interests.

Abbreviations

The following abbreviations are used in this manuscript:
AbbreviationsFull NameAbbreviationsFull Name
HRWHydrogen-rich waternpyneuropeptide Y
SODsuperoxide dismutaseagrpagouti related neuropeptide
GSH-Pxglutathione peroxidasecartcocaine and amphetamine-regulated transcript-like
MDAmalondialdehydesodsuperoxide dismutase
mrf4myogenic regulatory factor 4gsh-pxglutathione peroxidase
myodmyogenic differentiationnrf2nuclear factor erythroid factor 2
myosmyostatincatcatalase
mhcmyosin heavy chainkeap1ECH-associated protein 1b
leptinleptin-likegrglutathione reductase

References

  1. Huang, D.; Liang, X.; Yuan, X.; Cai, W.; Li, A.; He, S.; Xue, M. Effects of γ-aminobutyric acid on food intake and appetite in mandarin fish Siniperca chuatsi. Acta Hydrobiol. Sin. 2017, 41, 1312–1317. [Google Scholar]
  2. LeBaron, T.W.; Sharpe, R.; Pyatakovich, F.A.; Artamonov, M.Y. Hydrogen: From stars to fuel to medicine. In Molecular Hydrogen in Health and Disease; Springer: Cham, Switzerland, 2024; Volume 27, pp. 1–20. [Google Scholar]
  3. Zhou, Q.; Li, H.; Zhang, Y.; Zhao, Y.; Wang, C.; Liu, C. Hydrogen-Rich Water to Enhance Exercise Performance: A Review of Effects and Mechanisms. Metabolites 2024, 14, 537. [Google Scholar] [CrossRef]
  4. Sim, M.; Kim, C.S.; Shon, W.J.; Lee, Y.K.; Choi, E.Y.; Shin, D.M. Hydrogen-rich water reduces inflammatory responses and prevents apoptosis of peripheral blood cells in healthy adults: A randomized, double-blind, controlled trial. Sci. Rep. 2020, 10, 12130. [Google Scholar] [CrossRef]
  5. Dhillon, G.; Buddhavarapu, V.; Grewal, H.; Sharma, P.; Verma, R.K.; Munjal, R.; Devadoss, R.; Kashyap, R. Hydrogen Water: Extra Healthy or a Hoax?—A Systematic Review. Int. J. Mol. Sci. 2024, 25, 973. [Google Scholar] [CrossRef] [PubMed]
  6. Wang, Y.Q.; Liu, Y.H.; Wang, S.; Du, H.M.; Shen, W.B. Hydrogen agronomy: Research progress and prospects. J. Zhejiang Univ.-Sci. B 2020, 21, 841–855. [Google Scholar] [CrossRef]
  7. Ostendarp, M.; de Breuyn, M.; El-Khaled, Y.C.; Garcias-Bonet, N.; Carvalho, S.; Peixoto, R.S.; Wild, C. Temperature-dependent responses of the hard corals Acropora sp. and Pocillopora verrucosa to molecular hydrogen. PLoS ONE 2025, 20, e0308894. [Google Scholar] [CrossRef] [PubMed]
  8. Yuan, Y.; Li, H.; Chen, S.; Lin, Y.; Peng, J.; Hu, J.; Wang, Y. The effects of different concentrations of hydrogen-rich water on the growth performance, digestive ability, antioxidant capacity, glucose metabolism pathway, mTOR signaling pathway, and gut microbiota of largemouth bass (Micropterus salmoides). Fishes 2024, 9, 210. [Google Scholar] [CrossRef]
  9. Li, Z.; Chen, M.; Wang, W.; Liu, Q.; Li, N.; He, B.; Jiang, Y.; Ma, J. Mn-SOD alleviates methotrexate-related hepatocellular injury via GSK-3β affecting anti-oxidative stress of HO-1 and Drp1. Zhong Nan Da Xue Xue Bao Yi Xue Ban J. Cent. South Univ. Med. Sci. 2022, 47, 1191–1199. [Google Scholar]
  10. Hu, J.; Huang, L.; Wang, L.; Huang, W.; Lai, M.; Li, X.; Lin, Y.; Sun, Y. Hydrogen administration improves the growth performance of juvenile largemouth bass (Micropterus salmoides) by increasing feed intake, reducing serum lipids, activating mTOR and Nrf2 signaling pathways, and altering the intestinal microbiota. Aquac. Rep. 2023, 33, 101749. [Google Scholar] [CrossRef]
  11. Hu, Z.; Wu, B.; Meng, F.; Zhou, Z.; Lu, H.; Zhao, H. Impact of molecular hydrogen treatments on the innate immune activity and survival of zebrafish (Danio rerio) challenged with Aeromonas hydrophila. Fish Shellfish Immunol. 2017, 67, 554–560. [Google Scholar] [CrossRef]
  12. Carnovali, M.; Mariotti, M.; Banfi, G. Molecular hydrogen enhances osteogenesis in Danio rerio embryos. J. Fish Biol. 2021, 98, 1471–1474. [Google Scholar] [CrossRef] [PubMed]
  13. Li, C.; Cao, Y.; Kohei, F.; Hao, H.; Peng, G.; Cheng, C.; Ye, J. Nano-bubble hydrogen water: An effective therapeutic agent against inflammation related disease caused by viral infection in zebrafish model. Virol. Sin. 2022, 37, 277–283. [Google Scholar] [CrossRef]
  14. Zhang, Z.; Yuan, X.; Wu, H.; Gao, J.; Wu, J.; Xiong, Z.; Feng, Z.; Xie, M.; Li, S.; Xie, Z. The effect of short-term artificial feed domestication on the expression of oxidative-stress-related genes and antioxidant capacity in the liver and gill tissues of Mandarin fish (Siniperca chuatsi). Genes 2024, 15, 487. [Google Scholar] [CrossRef]
  15. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  16. Huggett, J.F. The Digital MIQE Guidelines Update: Minimum Information for Publication of Quantitative Digital PCR Experiments for 2020. Clin. Chem. 2020, 66, 1012–1029. [Google Scholar] [PubMed]
  17. Siagian, E.R.; Nugroho, R.A. Growth performance and carcass composition of African catfish, Clarias gariepinus fed different protein and energy levels. Iran. J. Fish. Sci. 2020, 19, 1828–1839. [Google Scholar]
  18. Jia, R. Natural Antioxidants and Aquatic Animal Health. Antioxidants 2025, 14, 185. [Google Scholar] [CrossRef] [PubMed]
  19. Paolucci, M. Fish nutrition and feed technology. Fishes 2023, 8, 146. [Google Scholar] [CrossRef]
  20. Yang, P.; Li, X.; Yao, W.; Li, M.; Wang, Y.; Leng, X. Dietary effect of Clostridium autoethanogenum protein on growth, intestinal histology and flesh lipid metabolism of largemouth bass (Micropterus salmoides) based on metabolomics. Metabolites 2022, 12, 1088. [Google Scholar] [CrossRef]
  21. Ohsawa, I.; Ishikawa, M.; Takahashi, K.; Watanabe, M.; Nishimaki, K.; Yamagata, K.; Katsura, K.; Katayama, Y.; Asoh, S.; Ohta, S. Hydrogen acts as a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals. Nat. Med. 2007, 13, 688–694. [Google Scholar] [CrossRef]
  22. Li, C.; Gong, T.; Bian, B.; Liao, W. Roles of hydrogen gas in plants: A review. Funct. Plant Biol. 2018, 45, 783–792. [Google Scholar] [CrossRef] [PubMed]
  23. Esteves de Lima, J.; Relaix, F. Master regulators of skeletal muscle lineage development and pluripotent stem cells differentiation. Cell Regen. 2021, 10, 31. [Google Scholar] [CrossRef] [PubMed]
  24. Ayisi, C.L.; Afriyie, G.; Owusu-Afriyie, G. Modulation of Muscle Growth Related Genes in Fish in Response to Plant Based Ingredients. Genet. Aquat. Org. 2021, 6, 413. [Google Scholar] [CrossRef]
  25. Fernández-Lázaro, D.; Garrosa, E.; Seco-Calvo, J.; Garrosa, M. Potential Satellite Cell-Linked Biomarkers in Aging Skeletal Muscle Tissue: Proteomics and Proteogenomics to Monitor Sarcopenia. Proteomes 2022, 10, 29. [Google Scholar] [CrossRef]
  26. Abouel Azm, F.R.; Kong, F.; Wang, X.; Zhu, W.; Yu, H.; Long, X.; Tan, Q. The Interaction of Dried Distillers Grains with Solubles (DDGS) Type and Level on Growth Performance, Health, Texture, and Muscle-Related Gene Expression in Grass Carp (Ctenopharyngodon idellus). Front. Nutr. 2022, 9, 832651. [Google Scholar] [CrossRef]
  27. Liu, X.; Zeng, S.; Liu, S.; Wang, G.; Lai, H.; Zhao, X.; Bi, S.; Guo, D.; Chen, X.; Yi, H.; et al. Identifying the Related Genes of Muscle Growth and Exploring the Functions by Compensatory Growth in Mandarin Fish (Siniperca chuatsi). Front. Physiol. 2020, 11, 553563. [Google Scholar] [CrossRef]
  28. Nazari, S.E.; Tarnava, A.; Khalili-Tanha, N.; Darroudi, M.; Khalili-Tanha, G.; Avan, A.; Khazaei, M.; LeBaron, T.W. Therapeutic potential of hydrogen-rich water on muscle atrophy caused by immobilization in a mouse model. Pharmaceuticals 2023, 16, 1436. [Google Scholar] [CrossRef]
  29. Volkoff, H.; Canosa, L.F.; Unniappan, S.; Cerdá-Reverter, J.M.; Bernier, N.J.; Kelly, S.P.; Peter, R.E. Neuropeptides and the control of food intake in fish. Gen. Comp. Endocrinol. 2005, 142, 3–19. [Google Scholar] [CrossRef]
  30. Ji, W.; Ping, H.-C.; Wei, K.-J.; Zhang, G.-R.; Shi, Z.-C.; Yang, R.-B.; Zou, G.-W.; Wang, W.-M. Ghrelin, neuropeptide Y (NPY) and cholecystokinin (CCK) in blunt snout bream (Megalobrama amblycephala): cDNA cloning, tissue distribution and mRNA expression changes responding to fasting and refeeding. Gen. Comp. Endocrinol. 2015, 223, 108–119. [Google Scholar] [CrossRef]
  31. López-Patiño, M.A.; Guijarro, A.I.; Isorna, E.; Delgado, M.J.; Alonso-Bedate, M.; de Pedro, N. Neuropeptide Y has a stimulatory action on feeding behavior in goldfish (Carassius auratus). Eur. J. Pharmacol. 1999, 377, 147–153. [Google Scholar] [CrossRef]
  32. Carpio, Y.; Acosta, J.; Morales, A.; Herrera, F.; González, L.J.; Estrada, M.P. Cloning, expression and growth promoting action of Red tilapia (Oreochromis sp.) neuropeptide Y. Peptides 2006, 27, 710–718. [Google Scholar] [CrossRef]
  33. Shiozaki, K.; Kawabe, M.; Karasuyama, K.; Kurachi, T.; Hayashi, A.; Ataka, K.; Iwai, H.; Takeno, H.; Hayasaka, O.; Kotani, T.; et al. Neuropeptide Y deficiency induces anxiety-like behaviours in zebrafish (Danio rerio). Sci. Rep. 2020, 10, 5913. [Google Scholar] [CrossRef]
  34. Tachibana, T.; Tsutsui, K. Neuropeptide control of feeding behavior in birds and its difference with mammals. Front. Neurosci. 2016, 10, 485. [Google Scholar] [CrossRef]
  35. Shainer, I.; Michel, M.; Marquart, G.D.; Bhandiwad, A.A.; Zmora, N.; Ben-Moshe Livne, Z.; Zohar, Y.; Hazak, A.; Mazon, Y.; Förster, D.; et al. Agouti-Related Protein 2 Is a New Player in the Teleost Stress Response System. Curr. Biol. 2019, 29, 2009–2019. [Google Scholar] [CrossRef]
  36. Agulleiro, M.J.; Cortés, R.; Leal, E.; Ríos, D.; Sánchez, E.; Cerdá-Reverter, J.M. Characterization, tissue distribution and regulation by fasting of the agouti family of peptides in the sea bass (Dicentrarchus labrax). Gen. Comp. Endocrinol. 2014, 205, 251–259. [Google Scholar] [CrossRef]
  37. Cerdá-Reverter, J.M.; Peter, R.E. Endogenous melanocortin antagonist in fish: Structure, brain mapping, and regulation by fasting of the goldfish agouti-related protein gene. Endocrinology 2003, 144, 4552–4561. [Google Scholar] [CrossRef] [PubMed]
  38. Catteau, A.; Caillon, H.; Barrière, P.; Denis, M.G.; Masson, D.; Fréour, T. Leptin and its potential interest in assisted reproduction cycles. Hum. Reprod. Update 2016, 22, 320–341. [Google Scholar] [CrossRef]
  39. Tan, H.L.; Yin, L.; Tan, Y.; Ivanov, J.; Plucinska, K.; Ilanges, A.; Herb, B.R.; Wang, P.; Kosse, C.; Cohen, P.; et al. Leptin-activated hypothalamic BNC2 neurons acutely suppress food intake. Nature 2024, 636, 198–205. [Google Scholar] [CrossRef] [PubMed]
  40. Bakshi, A.; Singh, R.; Rai, U. Trajectory of leptin and leptin receptor in vertebrates: Structure, function and their regulation. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2022, 257, 110652. [Google Scholar] [CrossRef] [PubMed]
  41. Rønnestad, I.; Gomes, A.S.; Murashita, K.; Angotzi, R.; Jönsson, E.; Volkoff, H. Appetite-Controlling Endocrine Systems in Teleosts. Front. Endocrinol. 2017, 8, 73. [Google Scholar] [CrossRef]
  42. Shastak, Y.; Pelletier, W. Captivating Colors, Crucial Roles: Astaxanthin’s Antioxidant Impact on Fish Oxidative Stress and Reproductive Performance. Animals 2023, 13, 3357. [Google Scholar] [CrossRef]
  43. Zengin, H. The effects of feeding and starvation on antioxidant defence, fatty acid composition and lipid peroxidation in reared Oncorhynchus mykiss fry. Sci. Rep. 2021, 11, 16716. [Google Scholar] [CrossRef]
  44. Lu, Y.; Li, C.F.; Ping, N.N.; Sun, Y.Y.; Wang, Z.; Zhao, G.X.; Yuan, S.H.; Zibrila, A.I.; Soong, L.; Liu, J.J. Hydrogen-rich water alleviates cyclosporine A-induced nephrotoxicity via the Keap1/Nrf2 signaling pathway. J. Biochem. Mol. Toxicol. 2020, 34, e22467. [Google Scholar] [CrossRef]
  45. Li, L.; Liu, T.; Liu, L.; Li, S.; Zhang, Z.; Zhang, R.; Zhou, Y.; Liu, F. Effect of hydrogen-rich water on the Nrf2/ARE signaling pathway in rats with myocardial ischemia-reperfusion injury. J. Bioenerg. Biomembr. 2019, 51, 393–402. [Google Scholar] [CrossRef] [PubMed]
  46. Liang, Y.; Jia, X.; Zheng, F.; Wang, Y.; Fan, Y.; Zhang, H.; Dang, Z.; Wang, L. SUMOylation Inhibitors Exert a Protective Effect on Oxidative Damage in Retinal Pigment Epithelial Cells Through the Keap1/Nrf2/ARE Signaling Pathway. Curr. Mol. Med. 2025, 24, 1180–1190. [Google Scholar] [CrossRef]
  47. Li, E.; Wang, Y.; Li, Q.; Li, L.; Wei, L. Protective effects of Sal B on oxidative stress-induced aging by regulating the Keap1/Nrf2 signaling pathway in zebrafish. Molecules 2021, 26, 5239. [Google Scholar] [CrossRef]
  48. Oh, Y.S.; Jun, H.S. Effects of Glucagon-Like Peptide-1 on Oxidative Stress and Nrf2 Signaling. Int. J. Mol. Sci. 2017, 19, 26. [Google Scholar] [CrossRef] [PubMed]
  49. Chen, L.; Teng, H.; Zhang, K.Y.; Skalicka-Woźniak, K.; Georgiev, M.I.; Xiao, J. Agrimonolide and Desmethylagrimonolide Induced HO-1 Expression in HepG2 Cells through Nrf2-Transduction and p38 Inactivation. Front. Pharmacol. 2016, 7, 513. [Google Scholar] [CrossRef] [PubMed]
Fishes 10 00581 g001
Figure 1. The dissolved hydrogen (DH) range of each breeding barrel at the time of H2 injection and termination. I: injection, T: termination. To keep the DH concentration identical across the three treatments, the 2 h barrels were given one 15 min pause during H2 sparging, while the 3 h barrels were given two such 15 min pauses, equalizing the accumulation rate and final saturation level in every barrel.
Figure 1. The dissolved hydrogen (DH) range of each breeding barrel at the time of H2 injection and termination. I: injection, T: termination. To keep the DH concentration identical across the three treatments, the 2 h barrels were given one 15 min pause during H2 sparging, while the 3 h barrels were given two such 15 min pauses, equalizing the accumulation rate and final saturation level in every barrel.
Fishes 10 00581 g001
Fishes 10 00581 g002
Figure 2. Effect of HRW treatment on liver antioxidant enzyme activities of mandarin fish. Values are means ± SEM of three replicate groups with 3 fish in each group (n = 3). Values within the same rows having different superscripts are significantly different (p < 0.05). SOD, superoxide dismutase; MDA, malondialdehyde; GSH-Px, glutathione peroxidase.
Figure 2. Effect of HRW treatment on liver antioxidant enzyme activities of mandarin fish. Values are means ± SEM of three replicate groups with 3 fish in each group (n = 3). Values within the same rows having different superscripts are significantly different (p < 0.05). SOD, superoxide dismutase; MDA, malondialdehyde; GSH-Px, glutathione peroxidase.
Fishes 10 00581 g002
Fishes 10 00581 g003
Figure 3. Expression of muscle growth genes in mandarin fish. Values are means ± SEM of three replicate groups with 3 fish in each group (n = 3). Values within the same rows having different superscripts are significantly different (p < 0.05). mrf4: myogenic regulatory factor 4; myod: myogenic differentiation; myos: myostatin; mhc: myosin heavy chain.
Figure 3. Expression of muscle growth genes in mandarin fish. Values are means ± SEM of three replicate groups with 3 fish in each group (n = 3). Values within the same rows having different superscripts are significantly different (p < 0.05). mrf4: myogenic regulatory factor 4; myod: myogenic differentiation; myos: myostatin; mhc: myosin heavy chain.
Fishes 10 00581 g003
Fishes 10 00581 g004
Figure 4. Relative expression of brain appetite genes. Values are means ± SEM of three replicate groups with 3 fish in each group (n = 3). Values within the same rows having different superscripts are significantly different (p < 0.05). leptin: leptin-like; npy: neuropeptide Y; agrp: agouti related neuropeptide; cart: cocaine and amphetamine-regulated transcript-like.
Figure 4. Relative expression of brain appetite genes. Values are means ± SEM of three replicate groups with 3 fish in each group (n = 3). Values within the same rows having different superscripts are significantly different (p < 0.05). leptin: leptin-like; npy: neuropeptide Y; agrp: agouti related neuropeptide; cart: cocaine and amphetamine-regulated transcript-like.
Fishes 10 00581 g004
Fishes 10 00581 g005
Figure 5. Relative expression of antioxidant genes in liver. Values are means ± SEM of three replicate groups with 3 fish in each group (n = 3). Values within the same rows having different superscripts are significantly different (p < 0.05). sod: superoxide dismutase; gsh-px: glutathione peroxidase; nrf2: nuclear factor erythroid factor 2; cat: catalase; keap1: ECH-associated protein 1b; gr: glutathione reductase.
Figure 5. Relative expression of antioxidant genes in liver. Values are means ± SEM of three replicate groups with 3 fish in each group (n = 3). Values within the same rows having different superscripts are significantly different (p < 0.05). sod: superoxide dismutase; gsh-px: glutathione peroxidase; nrf2: nuclear factor erythroid factor 2; cat: catalase; keap1: ECH-associated protein 1b; gr: glutathione reductase.
Fishes 10 00581 g005
Table 1. Genes and primers sequences.
Table 1. Genes and primers sequences.
GenesPrimer SequenceAccession No.
β-actinF:CAATGAATGAAGCGGATGAGG
R:CCGACCAAGCCAGACAAAAG		FJ436084.1
mrf4F:GCAGACGCTGGATGAACAGGAG
R:GCGGTGGAATGGTCAGCAGAG		JX682564.1
myodF:CCAAACGGCGGTCTGAAGAGC
R:GCTGCTGTTGTCGGTGGAGATC		XM_044193465.1
myosF:AAGGATGTGGCTATGGAGGAGGAC
R:TGGACGATGGACTCGGGTTCAG		JF896453.1
mhcF:CCAGATTCAGGAAGGCTCAGCATG
R:CGGCTCTTGGCTCGCATCTTG		XM_044181018.1
leptinF:CTGCCAGTGGAAGTAGTGAAGATGA
R:ACCCGTCAGCGAAGAGATGTCA		XM_044194787.1
npyF:CGCTGCTGACATTCTGACCTCTAC
R:CAACATGCCCTCCCGTACTTTACTT		XM_044172804.1
agrpF:CCTACCTGTTGACTCAGTGGAGGAT
R:GATGGCGTTAAAGAAGCGGCAGTA		XM_044195210.1
cartF:TCCTCCTCTTCCTCCTCCTCTTCC
R:TCTGCGGCTGGCTCTGGTTT		XM_044204893.1
sodF:CACGCTCCCTGACCTGACAXM_044168059.1
R:GGAGGGCAACCTGTGCTG
gpxF:GCCCATCCCCTGTTTGTGXM_044172415.1
R:AACTTCCTGCTGTAACGCTTG
nrf2F:ACGAAAGCGAAAGCTCCTCAMT270449.1
R:GCTCTCTTCCAGAATGGCGT
catF:GCGTTTGGCTACTTTGAGGTXM_044194118.1
R:CACAGTGGAGAAGCGGACA
keap1F:GTGGCAACCCAGGAGGAGXM_044189604.1
R:GGGAATGGCAACGGACA
grF:CAGGCATCCTTTCCACCCXM_044204920.1
R:TCCAGTCCTCTGTCCGTTTTA
Table 2. Growth Performance of Mandarin Fish.
Table 2. Growth Performance of Mandarin Fish.
Group0 h1 h2 h3 h
IW (g)30.12 ± 0.09 a30.57 ± 0.1 a30.05 ± 0.08 a30.11 ± 1.11 a
FW (g)57.08 ± 7.05 d63.39 ± 5.49 c71.23 ± 5.08 b76.31 ± 6.48 a
WGR (%)90.26 ± 33.1 d111.3 ± 25.4 c137.43 ± 23.9 b154.36 ± 30.43 a
SGR (%/d)1.01 ± 0.01 c1.25 ± 0.04 b1.48 ± 0.02 a1.61 ± 0.09 a
FCR1.61 ± 0.04 a1.29 ± 0.02 b1.19 ± 0.14 c1.01 ± 0.06 d
FR (g/fish)44.54 ± 0.38 c42.8 ± 1.03 b49.57 ± 2.12 a47.73 ± 1.46 a
SR (%)95.66 ± 2.15 a98.33 ± 1.92 a98.66 ± 1.86 a97.33 ± 1.03 a
Values are means ± SEM of three replicate groups with 60 fish in each group. Values within the same rows having different superscripts are significantly different (p < 0.05). IW, initial weight; FW, final weight; WGR, weight gain rate; SGR, specific growth rate; FCR, feed conversion ratio; FR, feed rate; SR, survival rate.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, H.; Huang, J.; Liu, H.; Yang, Y.; Hu, J. Role of Hydrogen-Rich Water on Growth Performance and Liver Antioxidant Capacity of Mandarin Fish (Siniperca chuatsi). Fishes 2025, 10, 581. https://doi.org/10.3390/fishes10110581

AMA Style

Wang H, Huang J, Liu H, Yang Y, Hu J. Role of Hydrogen-Rich Water on Growth Performance and Liver Antioxidant Capacity of Mandarin Fish (Siniperca chuatsi). Fishes. 2025; 10(11):581. https://doi.org/10.3390/fishes10110581

Chicago/Turabian Style

Wang, Haolin, Jing Huang, Hua Liu, Ying Yang, and Junru Hu. 2025. "Role of Hydrogen-Rich Water on Growth Performance and Liver Antioxidant Capacity of Mandarin Fish (Siniperca chuatsi)" Fishes 10, no. 11: 581. https://doi.org/10.3390/fishes10110581

APA Style

Wang, H., Huang, J., Liu, H., Yang, Y., & Hu, J. (2025). Role of Hydrogen-Rich Water on Growth Performance and Liver Antioxidant Capacity of Mandarin Fish (Siniperca chuatsi). Fishes, 10(11), 581. https://doi.org/10.3390/fishes10110581

Article Metrics

Back to TopTop