Next Article in Journal
Automatic Identification System (AIS)-Based Spatiotemporal Allocation of Catch and Fishing Effort for Purse Seine Fisheries in Korean Waters
Previous Article in Journal
Reproductive Parameters of the Western Tubenose Goby (Proterorhinus semilunaris) from Žitný Island, Slovakia, in Connection with Its Invasive Potential
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 10
Issue 10
10.3390/fishes10100529
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of the DVR Gene Family and Expression Analysis of GDF8 Genes in Qihe Gibel Carp

by
Jinyan Shan
1,2,3,†,
Yuling Liu
1,3,†,
Kaiqi Lian
1,3,
Xianghui Xiao
1,
Jun Ma
1,3,
Ren Ren
1,3,
Xiaolong Li
1,3,
Guoqiang Wei
1,3,
Youyi Kuang
4,* and
Renhai Peng
1,3,*
1
School of Biological and Food Engineering, Anyang Institute of Technology, Anyang 455000, China
2
College of Life Science and Technology, Tarim University, Alar 843300, China
3
Haihe River Basin, Aquatic Biodiversity, Observation and Research Station of Henan Province, Anyang 455000, China
4
Heilongjiang River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Harbin 150070, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fishes 2025, 10(10), 529; https://doi.org/10.3390/fishes10100529
Submission received: 25 September 2025 / Revised: 14 October 2025 / Accepted: 16 October 2025 / Published: 17 October 2025
(This article belongs to the Special Issue Advances in Carp: Genetic Improvement and Biotechnology)
Browse Figures
Versions Notes

Abstract

(1) Background: The BMP/GDF (Bone Morphogenetic Protein/Growth Differentiation Factor) subfamily (Decapentaplegic-Vg1-related, DVR) within the transforming growth factor beta (TGF-β) superfamily plays critical roles in governing biological developmental processes and physiological functions. (2) Methods: In this study, we systematically investigated the DVR gene family in hexaploid Qihe gibel carp (Carassius gibelio var. Qihe) through comprehensive genomic identification, phylogenetic analysis, chromosome mapping, and cis-regulatory element prediction. The experimental design for gene expression analysis involved collecting samples from multiple tissues (brain, muscle, liver, kidney, etc.) and different developmental stages (20, 45, and 60 days post hatching, dph) to examine the expression patterns of four GDF8 genes using quantitative real-time PCR (qRT-PCR). (3) Results: We identified 50 DVR members in Qihe gibel carp. Phylogenetic analysis classified the 50 DVR family members into 20 distinct protein types, with 29 BMPs (Bone Morphogenetic Proteins) and 21 GDFs (Growth Differentiation Factors) identified. All 50 DVR proteins of Qihe gibel carp have similar TGF-β domains except for four BMP1 proteins. Chromosomal localization revealed widespread distribution of DVR members across 36 chromosomes, a pattern potentially linked to the hexaploid genome of Qihe gibel carp. Genes within the same subgroup exhibited conserved intron–exon architectures and similar intron numbers; syntenic conservation within subgroups may reflect functional constraints after polyploidization, implying evolutionary pressure to maintain functional domains. Through spatiotemporal expression profiling, we uncovered functional divergence among four GDF8 (myostatin) paralogs: GDF8-1 and GDF8-2 were predominantly expressed in brain and muscle tissues (dorsal and caudal), while GDF8-3 and GDF8-4 showed hepatic, cerebral, and renal specificity. Intriguingly, all paralogs exhibited a gradual upregulation during late development (20–60 days post hatching, dph), with peak expression staggered between 45 dph (GDF8-1/2) and 60 dph (GDF8-3/4). (4) Conclusions: These findings suggest that GDF8 plays a critical regulatory role in the growth and development of Qihe gibel carp. Collectively, these results provide a foundation for further investigations into the functional roles of the DVR gene family during the ontogenetic development of this species.
Keywords:
decapentaplegic-Vg1-related (DVR); Growth Differentiation Factors 8 (GDF8); phylogenetic analysis; Qihe gibel carp; spationtemporal expression
Key Contribution: This study provides the first comprehensive genomic identification and characterization of the DVR gene family in hexaploid Qihe gibel carp, revealing 50 members and uncovering significant functional divergence among four GDF8 paralogs in their spatiotemporal expression patterns, which highlights their critical and potentially specialized roles in the growth and development of Qihe gibel carp.

1. Introduction

The Carassius complex of cyprinid teleost, comprising two cyprinid groups—the tetraploid crucian carp (Carassius auratus) and the hexaploid gibel carp (Carassius gibelio)—serves dual roles as both economically vital aquaculture resources and a unique vertebrate model for polyploid evolution [1]. The Qihe gibel carp (Carassius gibelio var. Qihe), a natural gynogenetic hexaploid fish characterized by its broad and thickened dorsal profile (colloquially termed “double-back carp”) [2], has garnered significant research attention due to its nutritional and economic merits coupled with a unique reproductive mode. These distinctive biological features establish it as a pivotal model organism for investigating vertebrate evolutionary mechanisms and advancing aquaculture genetic breeding strategies.
The Transforming Growth Factor Beta (TGF-β) superfamily includes more than 40 signaling proteins, which play an important regulatory role during the development process. These proteins are effective regulators of cell growth and differentiation [3]. Based on the differences in sequence structure characteristics and biological functions, the protein members within the TGF-β superfamily are further divided into the transforming growth factor-β (TGF-β) subfamily, the decapentaplegic/vg-1-related (DVR) subfamily, the activin/inhibin subfamily, and potentially other subfamilies yet to be characterized [4]. The DVR subfamily is one of the most extensively studied subfamilies within the TGF-β superfamily. It is composed of two major groups of proteins: Bone Morphogenetic Protein (BMP) and Growth Differentiation Factor (GDF) [5]. Both BMP and GDF share structural similarities with other TGF-β superfamily members, featuring a highly conserved cysteine residue domain that is typically located in the C-terminal mature region of the protein. This unique structural signature serves as a hallmark feature of the TGF-β superfamily. It plays a critical role in maintaining the protein’s tertiary structure and biological activity. The evolutionary conservation of this domain ensures functional stability among DVR gene family members, which are part of the TGF-β superfamily, across evolutionary timescales. Reiner et al. investigated the evolutionary characteristics of signal peptide sequences in DVR gene family members (e.g., BMP15 and GDF9), revealing that these sequences are encoded by orthologous DNA fragments [6]. Despite significant sequence divergence, the functions of these proteins exhibit convergence, providing a theoretical foundation for understanding the functional evolution in protein-coding regions. Functionally, DVR family members exhibit both overlap and divergence, playing highly diverse roles across various developmental processes [7]. DVR genes play critical regulatory roles during embryonic development, acting as extracellular signaling molecules that mediate tissue interactions, including cell differentiation [8], tissue formation [9], and activation of specific signaling pathways to influence cellular and tissue morphogenesis [10]. The DVR family comprises 22 subtypes in the human genome [11], whereas aquatic species possess 20 subtypes [12]. This variation in subtype number may reflect differences in the complexity of developmental processes and functional requirements among species. Further investigation into the evolutionary and functional significance of these subtypes could provide valuable insights into the diverse roles of DVR genes across different organisms.
Research in the field of aquatic sciences has demonstrated that the DVR gene family plays an indispensable role in fish. These genes are involved in a wide range of biological processes, including the initiation of embryonic development, skeletal formation during ontogeny, and immune regulation in response to external pathogen challenges [13,14,15,16,17,18]. This multifaceted involvement underscores the critical importance of the DVR gene family in both developmental and immune processes in fish. Genes such as BMP15 [19] and GDF11 [20], which are members of the DVR gene family, have been demonstrated to play crucial roles in gonadal development and reproduction. These genes exhibit specific expression patterns during ovarian development and are likely involved in regulating oogenesis and oocyte maturation. Similarly, in the context of skeletal development in fish, other members of the DVR gene family, including BMP2, BMP4, and BMP7, are closely linked to bone formation and ontogeny. These genes regulate the development of both skeletal and cartilaginous tissues [21]. This diverse functional profile highlights the multifaceted roles of the DVR gene family in different developmental processes. GDF8 has been demonstrated to function as a secreted protein that negatively regulates muscle mass in vivo [22]. Similarly, BMP2b [17] and BMP8a [18], which are also members of the DVR gene family, play critical roles in immune regulation and other biological processes in fish. These findings highlight the diverse functions of the DVR gene family across different biological systems. Investigating the DVR gene family lays a foundational framework for elucidating developmental and regulatory mechanisms in organisms, as well as constructing gene expression regulatory networks. These studies not only deepen our understanding of the DVR gene family but also have broader implications for developmental biology and disease mechanisms. Fish growth rate and meat content are of utmost significance to fish aquaculture breeding and economic benefits, and they also represent key research focuses in the field of fish genetic breeding. Given the potential role of the DVR gene family in regulating growth and development, understanding its function in fish species could provide valuable insights for improving aquaculture practices. Qihe gibel carp, a naturally hermaphroditic hexaploid carp species, exhibits high nutritional and economic value. In this study, we identified DVR family genes from the genomic data of Qihe gibel carp. Bioinformatics analyses were performed on their gene structures, chromosomal localizations, predicted protein characteristics, and related functions. Additionally, we analyzed the expression patterns of four GDF8 genes in different tissues and developmental stages of Qihe gibel carp. These analyses aim to elucidate the roles of DVR family genes in the growth and development of Qihe gibel carp, potentially providing a foundation for future genetic breeding strategies.
This study provides a theoretical basis for enhancing muscle content in Qihe gibel carp through fish breeding and other technologies, holding significant implications for the development of novel fish breeding techniques and yield improvement in this species. Furthermore, it is expected to offer fundamental data for studies on fish-related gene functions and lay a foundation for elucidating the regulatory mechanisms of fish muscle development. This research contributes to in-depth investigations into gene expression regulatory mechanisms, gene interactions, and the roles of genes during biological development. This work facilitates a deeper understanding of the complexity and functional diversity of fish genomes, thereby advancing the field of fish genetics and breeding.

2. Materials and Methods

2.1. Ethical Approval of Animal Research and Animals

In the experiment, MS-222 (Guangdong Yufubao Aquaculture Technology Co., Ltd., Guangdong, China) was used to anesthetize fish individuals to reduce pain. The ethics approval for this study was granted by the Laboratory Animal Management and Animal Welfare Ethics Committee of the School of Biology and Food Engineering, Anyang Institute of Technology, with approval code: AGSWJU202402 and date 22 February 2024.
Qihe gibel carp samples were obtained from the Anyang Institute of Technology Qihe gibel Carp Germplasm Innovation and New Variety Breeding Experimental Base in Henan Province, China. The location and the shape of the fish can be viewed via maps and images (Figures S1 and S2).

2.2. Identification of DVR Family Members in Qihe Gibel Carp

In this study, the genomic data of Qihe gibel carp sequenced by our research group were used (https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_043790415.1/, accessed on 25 October 2024), and the whole-genome sequence files of zebrafish (https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_000002035.6/, accessed on 25 October 2024), crucian carp (https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_003368295.1/, accessed on 25 October 2024), and gibel carp (https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_023724105.1/, accessed on 25 October 2024) were downloaded from the NCBI website. From reference [23], 25 identified and screened zebrafish DVR protein sequence numbers were obtained (Table S1), and then 25 zebrafish DVR proteins were downloaded from the NCBI website as reference sequences. TBtools v2.154 software (https://github.com/CJ-Chen/TBtools, accessed on 25 October 2024) was used to perform blast analysis on the genome files of Qihe gibel carp, crucian carp and gibel carp. The DVR proteins were identified in the PFAM database (http://pfam-legacy.xfam.org/, accessed on 25 October 2024) and on the HMMER website (https://www.ebi.ac.uk/Tools/hmmer/, accessed on 25 October 2024) [24]. The NCBI CD-Search website (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 25 October 2024) and the SMRAT website (https://smart.embl-heidelberg.de/, accessed on 25 October 2024) [25] were used to confirm the candidate sequences. The amino acid number, molecular weight (MW), isoelectric point (pI) and grand average of hydropathicity (GRAVY) of DVR proteins in Qihe gibel carp were predicted by online analysis website ExPASy (https://web.expasy.org/protparam/, accessed on 25 October 2024). The subcellular localization of DVR protein was predicted by CELLO v.2.5 (http://cello.life.nctu.edu.tw/, accessed on 25 October 2024) and WoLF PSORT (https://wolfpsort.hgc.jp/, accessed on 25 October 2024).

2.3. Evolutionary Analysis of DVR Gene Family

In this study, the AligninMUSCLE alignment method in MEGA 11.0.13 software was used to align the protein sequences of Qihe gibel carp and three reference species. The Neighbor-Joining method in the MEGA 11.0.13 software was used to construct a phylogenetic tree, with the Partial Deletion and P-distance models selected, and the Bootstrap value set to 1000 times. Visualization was carried out on the Evolview website (https://evolgenius.info//evolview-v3/#login, accessed on 25 October 2024) [26].

2.4. Analysis of DVR Gene Structure and Conserved Motifs

Use the MEME online website (https://meme-suite.org/meme/tools/meme, accessed on 25 October 2024) to analyze the input amino acid sequences of the DVR family members in Qihe gibel carp, and the software will detect the number and types of motifs. The analysis was carried out using the following parameters: a maximum of 10 motifs was displayed, while other settings were kept at their default values. Use Btools v2.010 to visually analyze the gene structure, exons, introns, and conserved motifs of the DVR family members in Qihe gibel carp [27].

2.5. Chromosomal Localization and Gene Duplication Analysis

In the TBtools software, according to the location of the genes annotated in the gff file of Qihe gibel carp, the location information of the genes on the relevant chromosomes and the length information of the chromosomes were extracted, and then the physical distribution of these DVR members was visualized by MapInspect in the TBtools software. The gff files of Qihe gibel carp and three reference species were input into TBtools software. The gene duplication and collinear regions were identified by the MCScanX tool [28], and the results were visualized by TBtools.

2.6. RNA Extraction and Expression Analysis of GDF8 Genes

Total RNA was extracted from juvenile Qi gibel carp at 5, 10, 13, 15, 20, 25, 30, 45, and 60 days post hatching (dph), as well as from one-year-old individuals, including brain, kidney, intestine, gill, liver, spleen, dorsal muscle, caudal muscle, and ovarian tissues, using a combined method of TRIGene reagent (P118-05, Beijing Kang Runcheng Industry Biotechnology Co., Ltd. Beijing, China) and the TaKaRa MiniBEST Universal RNA Extraction Kit (9767, Takara Bio—Technology (Beijing) Co., Ltd. Beijing, China). Three samples were collected from each period and tissue as three biological replicates. RNA concentration and purity were measured using a NanoDrop 2000 UV spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and RNA integrity was assessed by 1.5% agarose gel electrophoresis. Qualified RNA samples were reverse-transcribed into first-strand cDNA using the PrimeScript™ 1st Strand cDNA Synthesis Kit (6110A, Takara Bio-Technology (Beijing) Co., Ltd., Beijing, China) and stored at −20 °C for subsequent experiments. Specific primers for the GDF8 gene were designed using NCBI Primer-BLAST (Table 1). Quantitative real-time PCR (qRT-PCR) was performed on an ABI 7500 Fast system (Applied Biosystems, Foster City, CA, USA) with the ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme Biotech Co., Ltd., Nanjing, China). Each sample was tested in triplicate, and relative gene expression levels were calculated using the 2−ΔΔCt method [29].

2.7. Data Statistical Analysis

Multiple comparisons (Tukey’s Multiple Comparisons) [30] were performed using one-way analysis of variance (One-Way ANOVA) in GraphPad Prism 9.5 software to compare the means of each group pairwise for significant difference analysis. Digital labeling was used for annotation and plotting. Results were presented as mean ± standard deviation. Different letters indicated significant differences (p < 0.05), while the same letters indicated no significant differences (p > 0.05).

3. Results

3.1. Genome-Wide Identification of DVR Family Members in Qihe Gibel Carp

Through identification and screening of specific domains, 50 DVR gene family members were successfully identified in Qihe gibel carp and renamed according to standard protein nomenclature. These include 29 BMP proteins (Qihe-CgBMP1a-1, 1a-2, 1b-1, 1b-2, 2a-1, 2a-2, 2b-1, 2b-2, 3-1, 3-2, 4-1, 4-2, 5-1, 5-2, 6a, 6b, 7a-1, 7a-2, 7b-1, 7b-2, 8a-1, 8a-2, 10-1, 10-2, 10-3, 15-1, 15-2, 16-1, 16-2) and 21 GDF proteins (Qihe-CgGDF2, 3, 5-1, 5-2, 6a-1, 6a-2, 6b-1, 6b-2, 7-1, 7-2, 8-1, 8-2, 8-3, 8-4, 9-1, 9-2, 10a-1, 10a-2, 10b-1, 11-1, 11-2). Predicted physicochemical properties of Qihe gibel carp DVR family members revealed that the protein lengths range from 330 amino acids (Qihe-CgGDF7-2) to 986 amino acids (Qihe-CgBMP1a-1). The relative molecular weights span from 36.89 kDa (Qihe-CgGDF7-2) to 111.22 kDa (Qihe-CgBMP1a-1). The isoelectric points (pI) of DVR proteins range between 5.04 (Qihe-CgBMP10-1 and Qihe-CgBMP10-2) and 9.92 (Qihe-CgGDF5-1), with an average hydrophobicity index ranging from −0.659 to −0.257, indicating their predominantly hydrophilic nature. The instability index criteria suggest protein stability under experimental conditions (≤40: potentially stable; >40: potentially unstable). Subcellular localization predictions show 36 proteins localized extracellularly, 4 in the Golgi apparatus, 5 in the nucleus, 3 in the plasma membrane, 1 in the cytoplasm, and 1 in mitochondria (Table S2).

3.2. Phylogenetic Analysis of DVR Gene Family

To elucidate the evolutionary relationships of the identified DVR gene family, a phylogenetic tree was constructed using amino acid sequences of 211 proteins, including 50 from Qihe gibel carp, 25 from zebrafish, 64 from crucian carp, and 72 from gibel carp (Figure 1).

3.3. Formatting of Mathematical Components

To further investigate the diversity of DVR gene motifs in Qihe gibel carp, the MEME web server was employed to identify the number and types of protein motifs, followed by visualization of conserved motifs using TBtools software. Ten potential conserved motifs were identified (Figure 2). The analysis results indicated that, except for the four Qihe-CgBMP1 proteins, all other members of the DVR gene family in Qihe gibel carp contain Motif1 and Motif2, suggesting that these two motifs are evolutionarily conserved within the DVR family of this species. Notably, the 16 proteins—including Qihe-CgBMP2, Qihe-CgBMP3, Qihe-CgBMP4, Qihe-CgBMP5, Qihe-CgBMP6, Qihe-CgBMP7, Qihe-CgBMP8, Qihe-CgBMP1, Qihe-CgBMP15, Qihe-CgBMP16, Qihe-CgGDF2, Qihe-CgGDF3, Qihe-CgGDF5, Qihe-CgGDF6, Qihe-CgGDF7, and Qihe-CgGDF10—exhibit conserved motifs with a shared structural order of Motif3, Motif1, Motif4, and Motif2. Qihe-CgGDF11 and Qihe-CgGDF8 display similar motif architectures. These findings suggest that functional divergence of DVRs during evolution may have resulted in differences in conserved motifs among family members. Furthermore, members within the same subfamily were found to share similar conserved motifs, indicating potential functional similarities and evolutionary conservation of DVR family members in Qihe gibel carp.
Domain distribution analysis of DVR family proteins revealed that, apart from the four Qihe-CgBMP1 proteins, all other members exhibit the characteristic TGF-β family domains. Specifically, the specialized ZnMc, CUB, and FXa_inhibition domains were exclusively detected in Qihe-CgBMP1a-1, Qihe-CgBMP1a-2, Qihe-CgBMP1b-1, and Qihe-CgBMP1b-2. Visual analysis of exon-intron structures in Qihe gibel carp DVR family genes showed that these genes contain 1–19 introns and 2–20 exons. Members within the same group shared similar intron–exon architectures and intron counts, indicating high conservation in their gene structures (Figure 2).

3.4. Chromosomal Localization and Gene Replication of DVR Gene Family

Based on chromosomal mapping of DVR family genes in Qihe gibel carp, DVR genes were mapped to 36 distinct chromosomes. A single chromosome harbored a maximum of four DVR genes, and different isoforms of the same protein were mapped to both A and B chromosomes of the same pair (Figure 3).
Gene duplication events frequently occur in nature, with whole-genome duplication (WGD) serving as a major driving force for speciation, evolutionary innovation, and environmental adaptation. During fish evolution, chromosomes have undergone two rounds of polyploidization. The genus Carassius represents a rare group of vertebrates with diverse ploidy levels, including tetraploid and hexaploid species. Qihe gibel carp, a naturally gynogenetic hexaploid fish, was successfully assembled into two subgenomes (A and B) during genome sequencing by our research group. The DVR gene counts in C. auratus var. Qihe gibel carp, C. auratus, and C. gibelio are more numerous than those in Danio rerio (zebrafish), indicating that genome duplication events occurred in these three species during evolution.

3.5. Synteny Analysis of DVR Gene Family in Qihe Gibel Carp

To further investigate the DVR gene family in Qihe gibel carp and characterize genome duplication events, intraspecific synteny analysis was performed on Qihe gibel carp DVR genes (Figure 4). Meanwhile, interspecific synteny analyses were conducted with three species—zebrafish, crucian carp, and gibel carp—respectively (Figure 5). Intraspecific synteny analysis detected 31 gene duplication pairs in Qihe gibel carp, indicating significant synteny within the species. Interspecific synteny analysis revealed 52 duplication pairs between Qihe gibel carp and zebrafish genomes, 95 pairs between Qihe gibel carp and crucian carp genomes, and 104 pairs between Qihe gibel carp and gibel carp genomes. These results demonstrate strong synteny between Qihe gibel carp and the three comparator species, suggesting marked evolutionary conservation.

3.6. Spatio-Temporal Specific Expression of GDF8 Gene

As a negative regulatory factor in muscle development, GDF8 influences muscle growth [22]. To investigate the expression profiles of GDF8 genes in different tissues and developmental stages of Qihe gibel carp, qPCR primers (Table 1) were designed to examine the expression patterns of GDF8-1, GDF8-2, GDF8-3, and GDF8-4 in nine tissues—spleen, intestine, brain, gill, liver, ovary, dorsal muscle, caudal muscle, and kidney—and nine developmental stages: 5, 10, 13, 15, 20, 25, 30, 45, and 60 dph (days post hatching).
Analysis results showed that GDF8-1 and GDF8-2 exhibited similar expression patterns in different tissues of Qihe gibel carp, with high expression levels detected in brain, dorsal muscle, and caudal muscle tissues. Conversely, GDF8-3 and GDF8-4 displayed similar expression patterns, characterized by elevated expressions in liver, brain, and kidney tissues. All four genes demonstrated low expression levels in the intestine and gill tissues (Figure 6). During different developmental stages, the four GDF8 genes showed higher expression levels in late development (20–60 dph), with an overall increasing trend as development progressed. However, GDF8-1 and GDF8-2 reached peak expression at 45 dph, whereas GDF8-3 and GDF8-4 exhibited maximum expression at 60 dph (Figure 7).

4. Discussion

The DVR (BMP/GDF) gene subfamily, part of the transforming growth factor-β (TGF-β) superfamily, plays crucial regulatory roles in growth, development, and immune responses across vertebrate species [17,18,19,20,31,32,33]. In this study, we systematically identified and characterized the DVR gene family in the hexaploid Qihe gibel carp (Carassius gibelio var. Qihe), revealing 50 DVR members classified into 20 distinct protein types—including 29 BMPs and 21 GDFs. This expansion represents one of the largest DVR gene repertoires reported among teleost fishes to date, providing valuable genetic resources for understanding gene family evolution in polyploid vertebrates [1,34,35].
Notably, key developmental regulators including BMP2, BMP7, GDF6, and GDF8 were retained in up to four copies in Qihe gibel carp, whereas most teleosts typically maintain only two copies of these genes due to the teleost-specific whole-genome duplication [36,37]. This exceptional copy number variation likely results from additional genome duplication events in this hexaploid species. Particularly significant was the identification of four GDF8 (myostatin) paralogs, as GDF8 serves as a critical negative regulator of muscle growth in vertebrates [38,39,40]. The expansion of these key developmental genes provides a genomic foundation for investigating functional diversification and subfunctionalization in polyploid organisms.
Phylogenetic reconstruction using 211 DVR proteins from four fish species (zebrafish, crucian carp, gibel carp, and Qihe gibel carp) resolved 20 well-supported subgroups, with sequences from the three Carassius species forming monophyletic clusters before grouping with zebrafish orthologs. This topology reflects established phylogenetic relationships and suggests conserved evolutionary patterns despite genome duplication events. Structural analysis revealed two highly conserved motifs within the DVR gene family, with most members maintaining characteristic TGF-β domains and exhibiting conserved intron–exon architectures within functional subgroups. These structural conservation patterns indicate strong functional constraints on protein folding and gene regulation [41,42].
Synteny analysis further illuminated the evolutionary history of DVR genes in Qihe gibel carp. Intraspecific analysis identified 31 gene duplication pairs, while comparative interspecific analysis with zebrafish, crucian carp, and gibel carp revealed 251 duplication pairs total, with gibel carp showing the highest number. This extensive synteny conservation, particularly among cyprinids, underscores the evolutionary stability of genomic regions harboring DVR genes, despite lineage-specific expansions. The conservation of synteny blocks across species suggests that the DVR gene family has maintained structural integrity while adapting to species-specific biological requirements through gene duplication and functional diversification [37,43].
Expression profiling of the four GDF8 paralogs revealed striking functional divergence. GDF8-1 and GDF8-2 showed predominant expression in dorsal and caudal muscle tissues as well as the brain, suggesting specialized roles in skeletal muscle development and neurological functions. In contrast, GDF8-3 and GDF8-4 exhibited broader expression patterns with elevated levels in liver, brain, and kidney tissues, indicating potential involvement in metabolic regulation, neural development, and renal function. This expression divergence mirrors findings from other fish species, where GDF8 paralogs have undergone functional specialization [36,44,45].
Developmental expression analysis revealed that all four GDF8 paralogs were upregulated during late developmental stages (20–60 days post hatching), with peak expression staggered between 45 dph (GDF8-1/2) and 60 dph (GDF8-3/4). This temporal expression pattern coincides with critical periods of muscle maturation and intermuscular bone development (15–25 dph) [46,47], suggesting that GDF8 genes may regulate epithelial–mesenchymal interactions during IB formation. The stage-specific expression of different paralogs indicates complex regulatory mechanisms governing growth and development in Qihe gibel carp.
The diversification of DVR genes, particularly the GDF8 paralogs, in Qihe gibel carp provides insights into polyploid adaptation in vertebrates. As a gynogenetic species, Qihe gibel carp relies exclusively on maternal genome inheritance, yet maintains genomic stability and developmental robustness. The conservation of DVR gene sequences and motifs, coupled with functional diversification through gene duplication, may contribute to this stability by maintaining essential functions while allowing adaptive evolution. Previous studies have demonstrated that polyploidization can alter gene dosage, potentially affecting DVR-regulated processes including embryonic development, skeletal formation, and organ differentiation [37,43]. The expanded DVR repertoire in Qihe gibel carp thus represents a valuable natural experiment for studying gene family evolution in polyploid vertebrates.
While this study provides comprehensive genomic and expression analyses, functional validation through gene editing approaches such as CRISPR/Cas9 will be essential to precisely determine the roles of specific DVR genes in Qihe gibel carp development. Future studies integrating single-cell sequencing and epigenomic technologies could further elucidate the spatiotemporal regulatory networks of DVR genes during polyploid development, ultimately contributing to genetic improvement programs in aquaculture and enhancing our understanding of vertebrate evolution.

5. Conclusions

In summary, this study identified 50 DVR genes in Qihe gibel carp, classifying them into 20 protein types through genome-wide analysis. Expression profiling revealed distinct roles for GDF8 paralogs: GDF8-1 and GDF8-2 were highly expressed in muscle and brain, suggesting importance for growth, while GDF8-3 and GDF8-4 showed predominant expression in liver and kidney. These findings underscore the functional divergence of GDF8 genes in this hexaploid fish. Our results provide a foundation for understanding the roles of the DVR family in fish development and offer valuable insights for molecular breeding aimed at genetic improvement in aquaculture.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes10100529/s1, Table S1: 25 zebrafish DVR protein sequence numbers; Table S2: Physico-chemical and biochemical features of DVR genes in Qihe gibel carp. Figure S1: The map of the Qihe gibel carp site. Figure S2: The photo of the Qihe gibel carp.

Author Contributions

Conceptualization, R.P. and Y.K.; methodology, J.S. and X.X.; software, J.S. and K.L.; validation, J.S., Y.L. and J.M.; formal analysis, R.R.; investigation, X.L.; resources, G.W.; data curation, J.S.; writing—original draft preparation, J.S. and Y.L.; writing—review and editing, R.P. and Y.K.; visualization, X.X.; supervision, Y.L.; project administration, R.P. and Y.K.; funding acquisition, Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the National Key Research and Development Program of China (2023YFD2400300), Science and Technology Research Project of Henan Province (242102110065, 252102110074), and supported by the Special Fund for Henan Agriculture Research System (HARS-22-16-G4).

Institutional Review Board Statement

The experimental protocol was reviewed and approved by the Ethics Committee of the Institute of Modern Biotechnology for the Uses of Laboratory Animals (approval code: AGSWJU202402 and approval date: 22 February 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wang, Y.; Li, X.Y.; Xu, W.J.; Wang, K.; Wu, B.; Xu, M.; Chen, Y.; Miao, L.J.; Wang, Z.W.; Li, Z.; et al. Comparative genome anatomy reveals evolutionary insights into a unique amphitriploid fish. Nat. Ecol. Evol. 2022, 6, 1354–1366. [Google Scholar] [CrossRef]
  2. Zhang, J.; Zhu, Y.; Chen, Z.; Li, C.; Zhao, X.; Kong, X. Molecular cloning and expression analysis of MyD88 and TRAF6 in Qihe crucian carp Carassius auratus. Fish. Shellfish. Immunol. 2019, 87, 829–838. [Google Scholar] [CrossRef]
  3. Frangogiannis, N.G. Transforming growth factor-β in myocardial disease. Nat. Rev. Cardiol. 2022, 19, 435–455. [Google Scholar] [CrossRef]
  4. Kokabu, S.; Kodama, N.; Miyawaki, A.; Tsuji, K.; Hino, J.; Ono, Y.; Matsubara, T. Excessive BMP3b suppresses skeletal muscle differentiation. Biochem. Biophys. Res. Commun. 2025, 746, 151261. [Google Scholar] [CrossRef]
  5. Guignabert, C.; Humbert, M. Targeting transforming growth factor-β receptors in pulmonary hypertension. Eur. Respir. J. 2021, 57, 2002341. [Google Scholar] [CrossRef]
  6. Veitia, R.A.; Caburet, S. Extensive sequence turnover of the signal peptides of members of the GDF/BMP family: Exploring their evolutionary landscape. Biol. Direct 2009, 4, 22. [Google Scholar] [CrossRef] [PubMed]
  7. Hogan, B.L. Bone morphogenetic proteins: Multifunctional regulators of vertebrate development. Genes. Dev. 1996, 10, 1580–1594. [Google Scholar] [CrossRef] [PubMed]
  8. Plikus, M.V.; Guerrero-Juarez, C.F.; Ito, M.; Li, Y.R.; Dedhia, P.H.; Zheng, Y.; Shao, M.; Gay, D.L.; Ramos, R.; Hsi, T.C.; et al. Regeneration of fat cells from myofibroblasts during wound healing. Science 2017, 355, 748–752. [Google Scholar] [CrossRef]
  9. Traoré, M.; Noviello, C.; Vergnol, A.; Gentil, C.; Halliez, M.; Saillard, L.; Gelin, M.; Forand, A.; Lemaitre, M.; Guesmia, Z.; et al. GDF5 as a rejuvenating treatment for age-related neuromuscular failure. Brain 2024, 147, 3834–3848. [Google Scholar] [CrossRef] [PubMed]
  10. Tajer, B.; Dutko, J.A.; Little, S.C.; Mullins, M.C. BMP heterodimers signal via distinct type I receptor class functions. Proc. Natl. Acad. Sci. USA 2021, 118, e2017952118. [Google Scholar] [CrossRef]
  11. Katoh, Y.; Katoh, M. Comparative integromics on BMP/GDF family. Int. J. Mol. Med. 2006, 17, 951–955. [Google Scholar] [CrossRef]
  12. Whitfield, C.W.; Band, M.R.; Bonaldo, M.F.; Kumar, C.G.; Liu, L.; Pardinas, J.R.; Robertson, H.M.; Soares, M.B.; Robinson, G.E. Annotated Expressed Sequence Tags and cDNA Microarrays for Studies of Brain and Behavior in the Honey Bee. Genome Res. 2002, 12, 555–566. [Google Scholar] [CrossRef] [PubMed]
  13. Li, H.; Xu, W.; Xiang, S.; Tao, L.; Fu, W.; Liu, J.; Liu, W.; Xiao, Y.; Peng, L. Defining the Pluripotent Marker Genes for Identification of Teleost Fish Cell Pluripotency During Reprogramming. Front. Genet. 2022, 13, 819682. [Google Scholar] [CrossRef]
  14. Xu, J.; Liu, S.; Ai, Y.; Zhang, Y.; Li, S.; Li, Y. Establishment and transcriptome analysis of single blastomere-derived cell lines from zebrafish. J. Genet. Genom. 2024, 51, 957–969. [Google Scholar] [CrossRef] [PubMed]
  15. Li, D.; Cui, X.; Chen, S.; Xu, J.; Li, Y.; Zhang, Q.; Sun, Y. Mechanistic Insights into Nonylphenol Stress on BMP2 and BMP4 Gene Expression in Red Crucian Carp (Carassius auratus Red var.). Fishes 2024, 9, 159. [Google Scholar] [CrossRef]
  16. Kuang, Y.; Zheng, X.; Cao, D.; Sun, Z.; Tong, G.; Xu, H.; Yan, T.; Tang, S.; Chen, Z.; Zhang, T. Generate a new crucian carp (Carassius auratus) strain without intermuscular bones by knocking out bmp6. Aquaculture 2023, 569, 14. [Google Scholar] [CrossRef]
  17. Ye, D.; Wang, X.; Wei, C.; He, M.; Sun, Y. Marcksb plays a key role in the secretory pathway of zebrafish Bmp2b. PLOS Genet. 2019, 15, e1008306. [Google Scholar] [CrossRef]
  18. Zhong, S.; Li, H.; Wang, Y.; Wang, Y.; Ji, G.; Li, H.; Zhang, S.; Liu, Z. Bmp8a is an essential positive regulator of antiviral immunity in zebrafish. Commun. Biol. 2021, 4, 318. [Google Scholar] [CrossRef]
  19. Wang, W.; Yang, N.; Wang, L.; Zhu, Y.; Chu, X.; Xu, W.; Li, Y.; Xu, Y.; Gao, L.; Zhang, B.; et al. The TET-Sall4-BMP regulatory axis controls craniofacial cartilage development. Br. J. Med. Med. Res. 2024, 43, 113873. [Google Scholar] [CrossRef]
  20. Ravenscroft, T.A.; Phillips, J.B.; Fieg, E.; Bajikar, S.S.; Bellen, H.J. Heterozygous loss-of-function variants significantly expand the phenotypes associated with loss of GDF11. Genet. Med. 2021, 23, 1889–1900. [Google Scholar] [CrossRef]
  21. Bandyopadhyay, A.; Tsuji, K.; Cox, K.; Harfe, B.D.; Tabin, C.J. Genetic Analysis of the Roles of BMP2, BMP4, and BMP7 in Limb Patterning and Skeletogenesis. PLoS Genet. 2007, 2, e216. [Google Scholar] [CrossRef] [PubMed]
  22. Lee, S.-J. Myostatin: A skeletal muscle chalone. Annu. Rev. Physiol. 2023, 85, 269–291. [Google Scholar] [CrossRef]
  23. Shi, R.; Li, X.; Xu, X.; Chen, Z.; Zhu, Y.; Wang, N. Genome-wide analysis of BMP/GDF family and DAP-seq of YY1 suggest their roles in Cynoglossus semilaevis sexual size dimorphism. Int. J. Biol. Macromol. 2023, 253 Pt 5, 127201. [Google Scholar] [CrossRef]
  24. Finn, R.D.; Clements, J.; Eddy, S.R. HMMER web server: Interactive sequence similarity searching. Nucleic Acids Res. 2011, 39 (Suppl. S2), W29–W37. [Google Scholar] [CrossRef]
  25. Letunic, I.; Doerks, T.; Bork, P. SMART: Recent updates, new developments and status in 2015. Nucleic Acids Res. 2015, 43, D257–D260. [Google Scholar] [CrossRef] [PubMed]
  26. Li, Z.; Liu, Z.; Wei, Y.; Peng, R. Genome-wide identification of the MIOX gene family and their expression profile in cotton development and response to abiotic stress. PLoS ONE 2021, 16, e0254111. [Google Scholar] [CrossRef]
  27. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one”bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
  28. Wang, Y.; Tang, H.; Wang, X.; Sun, Y.; Joseph, P.V.; Paterson, A.H. Detection of colinear blocks and synteny and evolutionary analyses based on utilization of MCScanX. Nat. Protoc. 2024, 19, 2206–2229. [Google Scholar] [CrossRef]
  29. Maren, N.A.; Duduit, J.R.; Huang, D.; Zhao, F.; Ranney, T.G.; Liu, W. Stepwise Optimization of Real-Time RT-PCR Analysis. Methods Mol. Biol. 2023, 2653, 317–332. [Google Scholar] [CrossRef]
  30. Barnett, M.J.; Doroudgar, S.; Khosraviani, V.; Ip, E.J. Multiple comparisons: To compare or not to compare, that is the question. Res. Soc. Adm. Pharm. 2022, 18, 2331–2334. [Google Scholar] [CrossRef]
  31. Jiang, S.-Y.; Wang, Y.; Zhou, L.; Chen, F.; Li, Z.; Gui, J.-F. Molecular characteristics, genomic structure and expression patterns of diverse BMP 15 alleles in polyploid gibel carp clone F. ACTA Hydrobiol. Sin. 2020, 44, 518–527. [Google Scholar]
  32. Reichwald, K.; Petzold, A.; Koch, P.; Downie, B.R.; Hartmann, N.; Pietsch, S.; Baumgart, M.; Chalopin, D.; Felder, M.; Bens, M.; et al. Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish. Cell 2015, 163, 1527–1538. [Google Scholar] [CrossRef]
  33. Yang, F.; Liu, S.; Qu, J.; Zhang, Q. Identification and functional characterization of Pomstna in Japanese flounder (Paralichthys olivaceus). Gene 2022, 837, 146675. [Google Scholar] [CrossRef]
  34. Kuhl, H.; Du, K.; Schartl, M.; Kalous, L.; Stöck, M.; Lamatsch, D.K. Equilibrated evolution of the mixed auto-/allopolyploid haplotype-resolved genome of the invasive hexaploid Prussian carp. Nat. Commun. 2022, 13, 4092. [Google Scholar] [CrossRef] [PubMed]
  35. Luo, J.; Chai, J.; Wen, Y.; Tao, M.; Lin, G.; Liu, X.; Ren, L.; Chen, Z.; Wu, S.; Li, S.; et al. From asymmetrical to balanced genomic diversification during rediploidization: Subgenomic evolution in allotetraploid fish. Sci. Adv. 2020, 6, eaaz7677. [Google Scholar] [CrossRef]
  36. Shuqing, Z.; Juan, L.; Zhilong, L.; Wenjing, T.; Deshou, W. Identification and Evolution of TGF-β Signaling Pathway Members in Twenty-Four Animal Species and Expression in Tilapia. Int. J. Mol. Sci. 2018, 19, 1154. [Google Scholar]
  37. Gabillard, J.C.; Biga, P.R.; Rescan, P.Y.; Seiliez, I. Revisiting the paradigm of myostatin in vertebrates: Insights from fishes. Gen. Comp. Endocrinol. 2013, 194, 45–54. [Google Scholar] [CrossRef]
  38. Elashry, M.I.; Schneider, V.C.; Heimann, M.; Wenisch, S.; Arnhold, S. CRISPR/Cas9-Targeted Myostatin Deletion Improves the Myogenic Differentiation Parameters for Muscle-Derived Stem Cells in Mice. J. Dev. Biol. 2025, 13, 5. [Google Scholar] [CrossRef]
  39. Grobet, L.; Martin, L.J.; Poncelet, D.; Pirottin, D.; Brouwers, B.; Riquet, J.; Schoeberlein, A.; Dunner, S.; Ménissier, F.; Massabanda, J.; et al. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat. Genet. 1997, 17, 71–74. [Google Scholar] [CrossRef] [PubMed]
  40. Esposito, P.; Picciotto, D.; Battaglia, Y.; Costigliolo, F.; Viazzi, F.; Verzola, D. Myostatin: Basic biology to clinical application. Adv. Clin. Chem. 2022, 106, 181–234. [Google Scholar] [CrossRef] [PubMed]
  41. Berrios, L.; Rentsch, J.D. Linking Reactive Oxygen Species (ROS) to Abiotic and Biotic Feedbacks in Plant Microbiomes: The Dose Makes the Poison. Int. J. Mol. Sci. 2022, 23, 4402. [Google Scholar] [CrossRef]
  42. Nadarajah, K.K. ROS Homeostasis in Abiotic Stress Tolerance in Plants. Int. J. Mol. Sci. 2020, 21, 5208. [Google Scholar] [CrossRef] [PubMed]
  43. Feiner, N.; Begemann, G.; Renz, A.J.; Meyer, A.; Kuraku, S. The origin of bmp16, a novel Bmp2/4 relative, retained in teleost fish genomes. BMC Evol. Biol. 2009, 9, 277. [Google Scholar] [CrossRef] [PubMed]
  44. Funkenstein, B.; Olekh, E. Growth/differentiation factor-11: An evolutionary conserved growth factor in vertebrates. Dev. Genes. Evol. 2010, 220, 129–137. [Google Scholar] [CrossRef]
  45. Rescan, P.Y.; Jutel, I.; Rallière, C. Two myostatin genes are differentially expressed in myotomal muscles of the trout (Oncorhynchus mykiss). J. Exp. Biol. 2001, 204 Pt 20, 3523–3529. [Google Scholar] [CrossRef]
  46. Xue, T.; Liangyan, W.; Lin, C.; Lei, W.; Xiao, M.A.; Cancan, H.U.; Xianghui, K.; Guoxing, N.; Xuejun, L.I. The mRNA and protein expression of gene SOST during ossification process of intermuscular bone in crucian carp (Carassius auratus) in Qihe River. J. Fish. China 2016, 40, 673–680. [Google Scholar]
  47. Gan, R.-H.; Li, Z.; Wang, Z.-W.; Li, X.-Y.; Wang, Y.; Zhang, X.-J.; Tong, J.-F.; Wu, Y.; Xia, L.-Y.; Gao, Z.-X. Creation of intermuscular bone-free mutants in amphitriploid gibel carp by editing two duplicated runx2b homeologs. Aquaculture 2023, 567, 739300. [Google Scholar] [CrossRef]
Fishes 10 00529 g001
Figure 1. Phylogenetic tree of DVR proteins from Qihe gibel carp, zebrafish, crucian carp, and gibel carp. Note: Different color arcs in the outer ring indicate different types of DVR proteins. The white hook represents the DVR protein from Qihe gibel carp, the black circle represents the DVR protein from zebrafish, the blue triangle represents the DVR protein from crucian carp, and the red star represents the DVR protein from gibel carp.
Figure 1. Phylogenetic tree of DVR proteins from Qihe gibel carp, zebrafish, crucian carp, and gibel carp. Note: Different color arcs in the outer ring indicate different types of DVR proteins. The white hook represents the DVR protein from Qihe gibel carp, the black circle represents the DVR protein from zebrafish, the blue triangle represents the DVR protein from crucian carp, and the red star represents the DVR protein from gibel carp.
Fishes 10 00529 g001
Fishes 10 00529 g002
Figure 2. Conserved motifs, domains and exon-intron structures of the DVR genes in Qihe gibel carp. (A) Analysis of conserved motifs in the DVR protein sequence. Different conserved motifs are shown in specific colors. (B) Prediction of the DVR protein domain. (C) Gene structure of the DVR gene family. Note: The lengths of protein and DNA sequences were estimated using the scale at the bottom, and black lines represent non-conserved amino acids or introns.
Figure 2. Conserved motifs, domains and exon-intron structures of the DVR genes in Qihe gibel carp. (A) Analysis of conserved motifs in the DVR protein sequence. Different conserved motifs are shown in specific colors. (B) Prediction of the DVR protein domain. (C) Gene structure of the DVR gene family. Note: The lengths of protein and DNA sequences were estimated using the scale at the bottom, and black lines represent non-conserved amino acids or introns.
Fishes 10 00529 g002
Fishes 10 00529 g003
Figure 3. Distribution of DVR genes on the chromosome of Qihe gibel carp. Note: The vertical line on the left represents the size of the chromosome in Mb.
Figure 3. Distribution of DVR genes on the chromosome of Qihe gibel carp. Note: The vertical line on the left represents the size of the chromosome in Mb.
Fishes 10 00529 g003
Fishes 10 00529 g004
Figure 4. Self-collinearity analysis of DVR genes in Qihe gibel carp. Note: The outermost circle is the chromosome coordinates (Mb), chromosome number and gene distribution. Different colors represent different chromosome pairs. Followed by a gene density line graph, the innermost circle is the gene density heat map, red represents the high-density region, and yellow represents the low-density region.
Figure 4. Self-collinearity analysis of DVR genes in Qihe gibel carp. Note: The outermost circle is the chromosome coordinates (Mb), chromosome number and gene distribution. Different colors represent different chromosome pairs. Followed by a gene density line graph, the innermost circle is the gene density heat map, red represents the high-density region, and yellow represents the low-density region.
Fishes 10 00529 g004
Fishes 10 00529 g005
Figure 5. Collinearity analysis of DVR genes among the genomes of four species. (A) The collinearity between Qihe gibel carp and zebrafish. (B) The collinearity analysis of Qihe gibel carp and crucian carp. (C) The collinearity analysis of Qihe gibel carp and gibel carp.
Figure 5. Collinearity analysis of DVR genes among the genomes of four species. (A) The collinearity between Qihe gibel carp and zebrafish. (B) The collinearity analysis of Qihe gibel carp and crucian carp. (C) The collinearity analysis of Qihe gibel carp and gibel carp.
Fishes 10 00529 g005
Fishes 10 00529 g006
Figure 6. qRT-PCR analysis of the expression of the GDF8 gene in different tissues of the Qihe gibel carp. Note: Values with different letter superscripts mean significant difference (p < 0.05), while those with the same letter superscripts mean no significant difference (p > 0.05).
Figure 6. qRT-PCR analysis of the expression of the GDF8 gene in different tissues of the Qihe gibel carp. Note: Values with different letter superscripts mean significant difference (p < 0.05), while those with the same letter superscripts mean no significant difference (p > 0.05).
Fishes 10 00529 g006
Fishes 10 00529 g007
Figure 7. qRT-PCR analysis of the expression of the GDF8 gene in the Qihe gibel carp at different developmental stages. Note: Values with different letter superscripts mean significant difference (p < 0.05), while those with the same letter superscripts mean no significant difference (p > 0.05).
Figure 7. qRT-PCR analysis of the expression of the GDF8 gene in the Qihe gibel carp at different developmental stages. Note: Values with different letter superscripts mean significant difference (p < 0.05), while those with the same letter superscripts mean no significant difference (p > 0.05).
Fishes 10 00529 g007
Table 1. Primers used for qRT-PCR in this study.
Table 1. Primers used for qRT-PCR in this study.
GenesPrimer Sequences (5′→3′)Annealing Temperature/°CProduct Length/bpApplications
GDF8-1F1: GGATTGGACTGCGACGAGAA60294qRT-PCR
R1: TGAGGGGATCTTGCCGTAGA
GDF8-2F: GACCAACTGGGGCATTGAGA60274qRT-PCR
R: TCCCGAACAGTAATTCGCCT
GDF8-3F: ACTGAGGGAATGCCGAAGTG60264qRT-PCR
R: AGGCTGTTTGAGCCACAACT
GDF8-4F: GACACAGGCCTCGATTGTGA60181qRT-PCR
R: TGGCCTTGTTGACGATGTGA
β-actinF: ACCATCTACCCCGGTATTGC60149qRT-PCR
R: TGGAAGGTGGACAGGGAAGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shan, J.; Liu, Y.; Lian, K.; Xiao, X.; Ma, J.; Ren, R.; Li, X.; Wei, G.; Kuang, Y.; Peng, R. Genome-Wide Identification of the DVR Gene Family and Expression Analysis of GDF8 Genes in Qihe Gibel Carp. Fishes 2025, 10, 529. https://doi.org/10.3390/fishes10100529

AMA Style

Shan J, Liu Y, Lian K, Xiao X, Ma J, Ren R, Li X, Wei G, Kuang Y, Peng R. Genome-Wide Identification of the DVR Gene Family and Expression Analysis of GDF8 Genes in Qihe Gibel Carp. Fishes. 2025; 10(10):529. https://doi.org/10.3390/fishes10100529

Chicago/Turabian Style

Shan, Jinyan, Yuling Liu, Kaiqi Lian, Xianghui Xiao, Jun Ma, Ren Ren, Xiaolong Li, Guoqiang Wei, Youyi Kuang, and Renhai Peng. 2025. "Genome-Wide Identification of the DVR Gene Family and Expression Analysis of GDF8 Genes in Qihe Gibel Carp" Fishes 10, no. 10: 529. https://doi.org/10.3390/fishes10100529

APA Style

Shan, J., Liu, Y., Lian, K., Xiao, X., Ma, J., Ren, R., Li, X., Wei, G., Kuang, Y., & Peng, R. (2025). Genome-Wide Identification of the DVR Gene Family and Expression Analysis of GDF8 Genes in Qihe Gibel Carp. Fishes, 10(10), 529. https://doi.org/10.3390/fishes10100529

Article Metrics

Back to TopTop