Cytocompatibility Study of Stainless Steel 316l Against Differentiated SH-SY5Y Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Lines
2.3. Cell Culture and Cellular Differentiation
2.4. Determination of Contact Angle
2.5. Culturing SH-SY5Y Cells on SS 316l and TCP Surfaces
2.6. Morphological Assessment of Differentiation Status
2.7. Scanning Electron Microscopy (SEM)
2.8. Immunofluorescence
2.9. Reverse Transcription Quantitative PCR (RT-qPCR)
2.10. Cellular Proliferation
2.11. Determination of Leaching Elements
2.12. Collagen Coating and microRAMAN Spectroscopy (RAMAN Microscopy)
2.13. Indirect Cytocompatibility
2.14. Statistical Analysis
3. Results
3.1. Morphology, Elemental Analysis, and Potential Corrosion of Stainless Steel 316l
3.2. Contact Angle Measurement
3.3. Cellular Adhesion and Proliferation on SS 316l Surface
3.4. Molecular Characterization of SH-SY5Y Cell Differentiation on SS 316l Surface
3.5. SS 316l Supports Collagen Coating
3.6. Assessment of Cytocompatibility of SS 316l with Indirect Assay
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Xu, Y.; Li, Y.; Chen, T.; Dong, C.; Zhang, K.; Bao, X. A short review of medical-grade stainless steel: Corrosion resistance and novel techniques. J. Mater. Res. Technol. 2024, 29, 2788–2798. [Google Scholar] [CrossRef] [Scilit]
- Hsiao, V.K.S.; Lin, Y.C.; Wu, H.C.; Wu, T.I. Surface morphology and human MG-63 osteoblastic cell line response of 316L stainless steel after various surface treatments. Metals 2023, 13, 1739. [Google Scholar] [CrossRef] [Scilit]
- Gao, J.; Cao, Y.; Ma, Y.; Zheng, K.; Zhang, M.; Hei, H.; Gong, H.; Yu, S.; Kuai, P.; Liu, K. Wear, corrosion, and biocompatibility of 316L stainless steel modified by well-adhered Ta coatings. J. Mater. Eng. Perform. 2022, 31, 8784–8798. [Google Scholar] [CrossRef] [Scilit]
- Esmaeili, A.; Ghaffari, S.A.; Nikkhah, M.; Ghaini, F.M.; Farzan, F.; Mohammadi, S. Biocmpatibility assessments of 316L stainless steel substrates coated by Fe-based bulk metallic glass through electro-spark deposition method. Colloids Surf. B Biointerfaces 2021, 198, 111469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kovalevich, J.; Langford, D. Considerations for the use of SH-SY5Y neuroblastoma cells in neurobiology. Methods Mol. Biol. 2013, 1078, 9–21. [Google Scholar]
- Buttiglione, M.; Vitiello, F.; Sardella, E.; Petrone, L.; Nardulli, M.; Favia, P.; d’ Agostino, R.; Gristino, R. Behaviour of SH-SY5Y neuroblastoma cell line grown in different media and on different chemically modified substrates. Biomaterials 2007, 28, 2932–2945. [Google Scholar] [CrossRef] [Scilit]
- Emmanouilidou, E.; Melachroinou, K.; Roumeliotis, T.; Garbis, S.D.; Ntzouni, N.; Margaritis, L.H.; Stefanis, L.; Vekrellis, K. Cell-produced alpha-synuclein is secreted in a calcium-dependent manner by exosomes and impacts neuronal survival. J. Neurosci. 2010, 30, 6838–6851. [Google Scholar] [CrossRef] [Scilit]
- Yu, Y.; Zhang, J.; Wu, H. Optimizing mouse primary lens epithelial cell culture: A comprehensive guide to trypsinization. J. Vis. Exp. JoVE 2024, 208, 10-3791. [Google Scholar] [CrossRef] [Scilit]
- Ammerman, N.C.; Beier-Sexton, M.; Azad, A.F. Growth and maintenance of Vero cell lines. Curr. Protoc. Microbiol 2008, 11, A-4E. [Google Scholar] [CrossRef] [Scilit]
- Sánchez, C.; Díaz-Nido, J.; Avila, J. Phosphorylation of microtubule-associated protein 2 (MAP2) and its relevance for the regulation of the neuronal cytoskeleton function. Prog. Neurobiol. 2000, 61, 133–168. [Google Scholar] [CrossRef] [Scilit]
- Chia, H.N.; Vigen, M.; Kasko, A.M. Effect of substrate stiffness on pulmonary fibroblast activation by TGF-β. Acta Biomater. 2012, 8, 2602–2611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pampalakis, G.; Zingkou, E.; Kaklamanis, N.; Spella, M.; Stathopoulos, G.T.; Sotiropoulou, G. Elimination of KLK5 inhibits early skin tumorigenesis by reducing epidermal proteolysis and reinforcing epidermal microstructure. Biochim. Biophys. Acta Mol. Basis Dis. 2019, 1865, 165520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hauser, J.; Zietlov, J.; Köller, M.; Esenwein, S.A.; Halfmann, H.; Awakowicz, P.; Steinau, H.U. Enhanced cell adhesion to silicone implant material through plasma surface modification. J. Mater. Sci. Mater. Med. 2009, 20, 2541–2548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Becker, L.; Lu, C.E.; Montes-Mojarro, I.A.; Layland, S.L.; Khalil, S.; Nsair, A.; Duffy, G.P.; Fend, F.; Marzi, J.; Schenke-Layland, K. Raman microspectroscopy identified fibrotic tissues in collagen-related disorders via deconvoluted collagen type I spectra. Acta Biomater. 2023, 162, 278–291. [Google Scholar] [CrossRef] [Scilit]
- Afseth, N.K.; Segtnan, V.H.; Wold, J.P. Raman spectra of biological samples: A study of preprocessing methods. Appl. Spectrosc. 2006, 60, 1358–1367. [Google Scholar] [CrossRef] [Scilit]
- ISO 10993; Biological Evaluation of Medical Devices. Part 12 “Sample Preparation and Reference Materials” 5th Edition. International Organization for Standardization (ISO): Geneva, Switzerland, 2021.
- Son, M.; Lee, Y.S.; Lee, M.J.; Park, Y.K.; Bae, H.R.; Lee, S.Y.; Shin, M.G.; Yang, S. Effects of osmolality and solutes on the morphology of red blood cells according to three-dimensional refractive index tomography. PLoS ONE 2021, 16, e0262106. [Google Scholar] [CrossRef] [Scilit]
- Ferrari, M.; Cirisano, F.; Morán, M.C. Mammalian cell behavior on hydrophobic substrates: Influences of surface properties. Colloids Interfaces 2019, 3, 48. [Google Scholar] [CrossRef] [Scilit]
- Izant, J.G.; McIntosh, J.R. Microtubule-associated proteins: A monoclonal antibody to MAP2 binds to differentiated neurons. Proc. Natl. Acad. Sci. USA 1980, 77, 4741–4745. [Google Scholar] [CrossRef] [Scilit]
- Yoon, S.B.; Lee, G.; Park, S.B.; Cho, H.; Lee, J.O.; Koh, B. Properties of differentiated SH-SY5Y grown on carbon-based materials. RSC Adv. 2020, 10, 19382. [Google Scholar] [CrossRef] [Scilit]
- Cárcamo, J.J.; Aliaga, A.E.; Clavijo, R.E.; Brañes, M.R.; Campos-Vallette, M.M. Raman study of the shockwave effect on collagens. Spectrochim. Acta A Mol. Biomol. Spectrosc. 2021, 86, 360–365. [Google Scholar] [CrossRef] [Scilit]
- Dong, R.; Yan, X.; Pang, X.; Liu, S. Temperature-dependent Raman spectra of collagen and DNA. Spectrochim. Acta A Mol. Biomol. Spectrosc. 2004, 60, 557–561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dravid, A.; Raos, B.; Svirskis, D.; O’ Carroll, S.J. Optimized techniques for high-throughput screening of differentiated SH-SY5Y cells and application for neurite outgrowth assays. Sci. Rep. 2021, 11, 23935. [Google Scholar] [CrossRef] [Scilit]
- Dobruchowska, E.; Schulz, J.; Zavaleyev, V.; Walkowicz, J.; Suszko, T.; Warcholinski, B. Influence of the metallic sublayer on corrosion resistance in Hank’s solution of 316L stainless steel coated with diamond-like carbon. Materials 2024, 17, 4487. [Google Scholar] [CrossRef] [Scilit]
- Ma, Y.; Talha, M.; Lin, Y.; Ituen, E.; Wang, X.; Liu, W.; Kong, X. Eliminating the negative effect of cold deformation on the corrosion resistance of austenitic stainless steel in the presence of a protein. New J. Chem. 2019, 35, 13857–13862. [Google Scholar] [CrossRef] [Scilit]
- Wissner-Gross, Z.D.; Scott, M.A.; Ku, D.; Ramaswamy, P.; Yanik, M.F. Large-scale analysis of neurite growth dynamics on micropatterned substrates. Integr. Biol. 2011, 100, 305a. [Google Scholar]
- Tasnim, N.; Kumar, A.; Joddar, B. Attenuation of the in vitro neurotoxicity of 316L SS by graphene oxide surface coating. Mater. Sci. Eng. C Mater. Biol. Appl. 2017, 73, 788–797. [Google Scholar] [CrossRef] [Scilit]
- Pan, C.; Xu, C.; Huang, Z.; Zhou, J. Antifriction effect of 316L stainless steel textured surface with superhydrophylic properties in brain tissue insertion. Mater. Res. Express 2021, 8, 105401. [Google Scholar] [CrossRef] [Scilit]
- Danish, M. Contact angle studies of hydrophobic and hydrophilic surfaces. In Handbook of Magnetic Hybrid Nanoalloys and Their Nanocomposites; Thomas, S., Nochehdehi, A.R., Eds.; Springer: Cham, Switzerland, 2022; pp. 682–761. [Google Scholar]
- Morán, M.C.; Ruano, G.; Cirisano, F.; Ferrari, M. Mammalian cell viability on hydrophobic and superhydrophobic fabrics. Mater. Sci. Eng. C 2019, 99, 241–247. [Google Scholar] [CrossRef] [Scilit]
- Law, K.Y. Definitions for hydrophilicity, hydrophobicity, and superhydrophobicity: Getting the basics right. J. Phys. Chem. Lett. 2014, 5, 686–688. [Google Scholar] [CrossRef] [Scilit]
- Cai, R.; Wu, C.; Yang, W.; Liang, W.; Yu, H.; Liu, L. Recent advance in surface modification for regulating cell adhesion and behaviors. Nanotechnol. Rev. 2020, 9, 971–989. [Google Scholar] [CrossRef] [Scilit]
- Benčina, A.; Rawat, N.; Paul, D.; Kovač, J.; Lakota, K.; Žigon, P.; Iglič, A.; Junkar, I. Enhanced hemocompatibility and cytocompatibility of stainless steels. ACS Omega 2024, 9, 19566–19577. [Google Scholar] [CrossRef] [Scilit]









| Name | Sequence (5′→3′) |
|---|---|
| MAP2 Forward | TCTGCCTCCTTCTCCACCCC |
| MAP2 Reverse | TCTGACTCCTTTTCCTTCTG |
| NEFH Forward | CTGGAGGCACTGAAAAGCA |
| NEFH Reverse | TCTTGACATTGAGCAGGTC |
| HPRT-1 Forward | GCCCTGGCGTCGTGATTAGT |
| HPRT-1 Reverse | AGCAAGACGTTCAGTCCTGTC |
| Metal | Concentration (μg/L) | Total Amount (μg) |
|---|---|---|
| Fe | 36 ± 13 | 0.108 ± 0.039 |
| Cr | 16 ± 14 | 0.480 ± 0.420 |
| Ni | 22 ± 40 | 0.066 ± 0.012 |
| Mn | 105 ± 50 | 0.315 ± 0.015 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zingkou, E.; Kolianou, A.; Angelis, G.; Lykouras, M.; Orkoula, M.; Pampalakis, G.; Sotiropoulou, G. Cytocompatibility Study of Stainless Steel 316l Against Differentiated SH-SY5Y Cells. Biomimetics 2025, 10, 169. https://doi.org/10.3390/biomimetics10030169
Zingkou E, Kolianou A, Angelis G, Lykouras M, Orkoula M, Pampalakis G, Sotiropoulou G. Cytocompatibility Study of Stainless Steel 316l Against Differentiated SH-SY5Y Cells. Biomimetics. 2025; 10(3):169. https://doi.org/10.3390/biomimetics10030169
Chicago/Turabian StyleZingkou, Eleni, Asimina Kolianou, Georgios Angelis, Michail Lykouras, Malvina Orkoula, Georgios Pampalakis, and Georgia Sotiropoulou. 2025. "Cytocompatibility Study of Stainless Steel 316l Against Differentiated SH-SY5Y Cells" Biomimetics 10, no. 3: 169. https://doi.org/10.3390/biomimetics10030169
APA StyleZingkou, E., Kolianou, A., Angelis, G., Lykouras, M., Orkoula, M., Pampalakis, G., & Sotiropoulou, G. (2025). Cytocompatibility Study of Stainless Steel 316l Against Differentiated SH-SY5Y Cells. Biomimetics, 10(3), 169. https://doi.org/10.3390/biomimetics10030169

