The Effect of pH and Buffer on Oligonucleotide Affinity for Iron Oxide Nanoparticles
Abstract
1. Introduction
2. Results and Discussion
2.1. Synthesis and Characterization of MNP
2.2. Toxicity Study of MNPs
2.3. Analysis of Oligonucleotide Affinity for MNP in Various pH and Buffer Conditions
2.4. Analysis of Various Oligonucleotide Sequence Affinity for MNP
3. Materials and Methods
3.1. Materials
3.2. MNPs Synthesis
3.3. MNPs Characterization
3.4. Cell Culture and Toxicity Assay (MTT Test)
3.5. Evaluation of Reactive Oxygen Species (ROS) Generation
3.6. Synthesis and Isolation of Oligonucleotides
3.7. Synthesis of Radioactively Labeled Oligonucleotides
3.8. Sorption of Oligonucleotides onto the MNP Surface
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Anderson, S.D.; Gwenin, V.V.; Gwenin, C.D. Magnetic Functionalized Nanoparticles for Biomedical, Drug Delivery and Imaging Applications. Nanoscale Res. Lett. 2019, 14, 188. [Google Scholar] [CrossRef] [Scilit]
- Lamichhane, N.; Sharma, S.; Parul, P.; Verma, A.K.; Roy, I.; Sen, T. Iron oxide-based magneto-optical nanocomposites for in vivo biomedical applications. Biomedicines 2021, 9, 288. [Google Scholar] [CrossRef] [Scilit]
- Chouhan, R.S.; Horvat, M.; Ahmed, J.; Alhokbany, N.; Alshehri, S.M.; Gandhi, S. Magnetic nanoparticles—A multifunctional potential agent for diagnosis and therapy. Cancers 2021, 13, 2213. [Google Scholar] [CrossRef] [Scilit]
- Shabatina, T.I.; Vernaya, O.I.; Shabatin, V.P.; Melnikov, M.Y. Magnetic nanoparticles for biomedical purposes: Modern trends and prospects. Magnetochemistry 2020, 6, 30. [Google Scholar] [CrossRef] [Scilit]
- Ganapathe, L.S.; Mohamed, M.A.; Yunus, R.M.; Berhanuddin, D.D. Magnetite (Fe3O4) nanoparticles in biomedical application: From synthesis to surface functionalisation. Magnetochemistry 2020, 6, 68. [Google Scholar] [CrossRef] [Scilit]
- Hepel, M. Magnetic nanoparticles for nanomedicine. Magnetochemistry 2020, 6, 3. [Google Scholar] [CrossRef] [Scilit]
- Dulińska-Litewka, J.; Łazarczyk, A.; Hałubiec, P.; Szafrański, O.; Karnas, K.; Karewicz, A. Superparamagnetic iron oxide nanoparticles-current and prospective medical applications. Materials 2019, 12, 617. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, B.; Pervushin, K. Magnetic nanoparticles as in vivo tracers for alzheimer’s disease. Magnetochemistry 2020, 6, 13. [Google Scholar] [CrossRef] [Scilit]
- Govan, J. Recent Advances in Magnetic Nanoparticles and Nanocomposites for the Remediation of Water Resources. Magnetochemistry 2020, 6, 49. [Google Scholar] [CrossRef] [Scilit]
- Socoliuc, V.; Peddis, D.; Petrenko, V.I.; Avdeev, M.V.; Susan-Resiga, D.; Szabó, T.; Turcu, R.; Tombácz, E.; Vékás, L. Magnetic nanoparticle systems for nanomedicine—A materials science perspective. Magnetochemistry 2020, 6, 2. [Google Scholar] [CrossRef] [Scilit]
- Evgeny, K. Magnetic Nanoparticles. Magnetochemistry 2020, 6, 6. [Google Scholar]
- Prilepskii, A.Y.; Serov, N.S.; Kladko, D.V.; Vinogradov, V.V. Nanoparticle-based approaches towards the treatment of atherosclerosis. Pharmaceutics 2020, 12, 1056. [Google Scholar] [CrossRef] [Scilit]
- Caspani, S.; Magalhães, R.; Araújo, J.P.; Sousa, C.T. Magnetic nanomaterials as contrast agents for MRI. Materials 2020, 13, 2586. [Google Scholar] [CrossRef] [Scilit]
- Kostevšek, N. A review on the optimal design of magnetic nanoparticle-based t2 mri contrast agents. Magnetochemistry 2020, 6, 11. [Google Scholar] [CrossRef] [Scilit]
- Fernández-Barahona, I.; Muñoz-Hernando, M.; Ruiz-Cabello, J.; Herranz, F.; Pellico, J. Iron oxide nanoparticles: An alternative for positive contrast in magnetic resonance imaging. Inorganics 2020, 8, 28. [Google Scholar] [CrossRef] [Scilit]
- Ellis, C.M.; Pellico, J.; Davis, J.J. Magnetic Nanoparticles Supporting Bio-responsive T1/T2 Magnetic Resonance Imaging. Materials 2019, 12, 4096. [Google Scholar] [CrossRef] [Scilit]
- Wallyn, J.; Anton, N.; Vandamme, T.F. Synthesis, principles, and properties of magnetite nanoparticles for in vivo imaging applications—A review. Pharmaceutics 2019, 11, 601. [Google Scholar] [CrossRef] [Scilit]
- Obaidat, I.M.; Narayanaswamy, V.; Alaabed, S.; Sambasivam, S.; Muralee Gopi, C.V.V. Principles of Magnetic Hyperthermia: A Focus on Using Multifunctional Hybrid Magnetic Nanoparticles. Magnetochemistry 2019, 5, 67. [Google Scholar] [CrossRef] [Scilit]
- Mokhodoeva, O.; Vlk, M.; Málková, E.; Kukleva, E.; Mičolová, P.; Štamberg, K.; Šlouf, M.; Dzhenloda, R.; Kozempel, J. Study of 223Ra uptake mechanism by Fe3O4 nanoparticles: Towards new prospective theranostic SPIONs. J. Nanoparticle Res. 2016, 18, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Shen, L.; Li, B.; Qiao, Y. Fe3O4 nanoparticles in targeted drug/gene delivery systems. Materials 2018, 11, 324. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Canaparo, R.; Foglietta, F.; Limongi, T.; Serpe, L. Biomedical applications of reactive oxygen species generation by metal nanoparticles. Materials 2021, 14, 53. [Google Scholar] [CrossRef] [Scilit]
- Malhotra, N.; Lee, J.S.; Liman, R.A.D.; Ruallo, J.M.S.; Villaflore, O.B.; Ger, T.R.; Hsiao, C. Der Potential toxicity of iron oxide magnetic nanoparticles: A review. Molecules 2020, 25, 3159. [Google Scholar] [CrossRef] [Scilit]
- Nelson, N.; Port, J.; Pandey, M. Use of Superparamagnetic Iron Oxide Nanoparticles (SPIONs) via Multiple Imaging Modalities and Modifications to Reduce Cytotoxicity: An Educational Review. J. Nanotheranostics 2020, 1, 8. [Google Scholar] [CrossRef] [Scilit]
- Zelepukin, I.V.; Yaremenko, A.V.; Ivanov, I.N.; Yuryev, M.V.; Cherkasov, V.R.; Deyev, S.M.; Nikitin, P.I.; Nikitin, M.P. Long-Term Fate of Magnetic Particles in Mice: A Comprehensive Study. ACS Nano 2021, 15, 11341–11357. [Google Scholar] [CrossRef] [Scilit]
- Hammond, S.M.; Aartsma-Rus, A.; Alves, S.; Borgos, S.E.; Buijsen, R.A.M.; Collin, R.W.J.; Covello, G.; Denti, M.A.; Desviat, L.R.; Echevarría, L.; et al. Delivery of oligonucleotide-based therapeutics: Challenges and opportunities. EMBO Mol. Med. 2021, 13, e13243. [Google Scholar] [CrossRef] [Scilit]
- Samanta, A.; Medintz, I.L. Nanoparticles and DNA—A powerful and growing functional combination in bionanotechnology. Nanoscale 2016, 8, 9037–9095. [Google Scholar] [CrossRef] [Scilit]
- Shahbazi, R.; Ozpolat, B.; Ulubayram, K. Oligonucleotide-based theranostic nanoparticles in cancer therapy. Nanomedicine 2016, 11, 1287–1308. [Google Scholar] [CrossRef] [Scilit]
- Sizikov, A.A.; Kharlamova, M.V.; Nikitin, M.P.; Nikitin, P.I.; Kolychev, E.L. Nonviral locally injected magnetic vectors for in vivo gene delivery: A review of studies on magnetofection. Nanomaterials 2021, 11, 1078. [Google Scholar] [CrossRef] [Scilit]
- Huang, R.-Y.; Liu, Z.-H.; Weng, W.-H.; Chang, C.-W. Magnetic nanocomplexes for gene delivery applications. J. Mater. Chem. B 2021, 9, 4267–4286. [Google Scholar] [CrossRef] [Scilit]
- Laurent, N.; Sapet, C.; Gourrierec, L.L.; Bertosio, E.; Zelphati, O. Nucleic acid delivery using magnetic nanoparticles: The Magnetofection TM technology. Ther. Deliv. 2011, 2, 471–482. [Google Scholar] [CrossRef] [Scilit]
- Kami, D.; Takeda, S.; Itakura, Y.; Gojo, S.; Watanabe, M.; Toyoda, M. Application of magnetic nanoparticles to gene delivery. Int. J. Mol. Sci. 2011, 12, 3705. [Google Scholar] [CrossRef] [Scilit]
- Bakshi, S.; Zakharchenko, A.; Minko, S.; Kolpashchikov, D.; Katz, E. Towards Nanomaterials for Cancer Theranostics: A System of DNA-Modified Magnetic Nanoparticles for Detection and Suppression of RNA Marker in Cancer Cells. Magnetochemistry 2019, 5, 24. [Google Scholar] [CrossRef] [Scilit]
- Fouriki, A.; Dobson, J. Nanomagnetic gene transfection for non-viral gene delivery in nih 3t3 mouse embryonic fibroblasts. Materials 2013, 6, 255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prosen, L.; Prijic, S.; Music, B.; Lavrencak, J.; Cemazar, M.; Sersa, G. Magnetofection: A reproducible method for gene delivery to melanoma cells. Biomed Res. Int. 2013, 2013, 6–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, S.; Eltoukhy, A.A.; Love, K.T.; Langer, R.; Anderson, D.G. Lipidoid-coated iron oxide nanoparticles for efficient DNA and siRNA delivery. Nano Lett. 2013, 13, 1059–1064. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mykhaylyk, O.; Vlaskou, D.; Tresilwised, N.; Pithayanukul, P.; Möller, W.; Plank, C. Magnetic nanoparticle formulations for DNA and siRNA delivery. J. Magn. Magn. Mater. 2007, 311, 275–281. [Google Scholar] [CrossRef] [Scilit]
- Lim, J.; Clements, M.A.; Dobson, J. Delivery of Short Interfering Ribonucleic Acid-Complexed Magnetic Nanoparticles in an Oscillating Field Occurs via Caveolae-Mediated Endocytosis. PLoS ONE 2012, 7, e51350. [Google Scholar] [CrossRef] [Scilit]
- Jin, L.; Wang, Q.; Chen, J.; Wang, Z.; Xin, H.; Zhang, D. Efficient delivery of therapeutic siRNA by Fe3O4 magnetic nanoparticles into oral cancer cells. Pharmaceutics 2019, 11, 615. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Degirmenci, V.; Xin, H.; Li, Y.; Wang, L.; Chen, J.; Hu, X.; Zhang, D. PEI-coated Fe3O4 nanoparticles enable efficient delivery of therapeutic siRNA targeting REST into glioblastoma cells. Int. J. Mol. Sci. 2018, 19, 2230. [Google Scholar] [CrossRef] [Scilit]
- Prilepskii, A.Y.; Kalnin, A.Y.; Fakhardo, A.F.; Anastasova, E.I.; Nedorezova, D.D.; Antonov, G.A.; Vinogradov, V.V. Cationic magnetite nanoparticles for increasing siRNA hybridization rates. Nanomaterials 2020, 10, 1018. [Google Scholar] [CrossRef] [Scilit]
- Cherradi, N. MicroRNA Therapeutics in Cancer: Current Advances and Challenges. Cancers 2021, 13, 2680. [Google Scholar]
- Khodadadi, E.; Mahjoub, S.; Arabi, M.S.; Najafzadehvarzi, H.; Nasirian, V. Fabrication and evaluation of aptamer-conjugated paclitaxel-loaded magnetic nanoparticles for targeted therapy on breast cancer cells. Mol. Biol. Rep. 2021, 48, 2105–2116. [Google Scholar] [CrossRef] [Scilit]
- Kolovskaya, O.S.; Zamay, T.N.; Zamay, G.S.; Babkin, V.A.; Medvedeva, E.N.; Neverova, N.A.; Kirichenko, A.K.; Zamay, S.S.; Lapin, I.N.; Morozov, E.V.; et al. Aptamer-conjugated superparamagnetic ferroarabinogalactan nanoparticles for targeted magnetodynamic therapy of cancer. Cancers 2020, 12, 216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, X.; Liu, B.; Chen, X.; Lin, H.; Peng, Y.; Li, Y.; Zheng, H.; Xu, Y.; Ou, X.; Yan, S.; et al. Aptamer-assisted superparamagnetic iron oxide nanoparticles as multifunctional drug delivery platform for chemo-photodynamic combination therapy. J. Mater. Sci. Mater. Med. 2019, 30, 76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zamay, G.S.; Zamay, T.N.; Lukyanenko, K.A.; Kichkailo, A.S. Aptamers increase biocompatibility and reduce the toxicity of magnetic nanoparticles used in biomedicine. Biomedicines 2020, 8, 59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Epanchintseva, A.V.; Gorbunova, E.A.; Ryabchikova, E.I.; Pyshnaya, I.A.; Pyshnyi, D.V. Effect of Fluorescent Labels on DNA Affinity for Gold Nanoparticles. Nanomaterials 2021, 11, 1178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmad, T.; Bae, H.; Rhee, I.; Chang, Y.; Jin, S.U.; Hong, S. Gold-coated iron oxide nanoparticles as a T2 agent in magnetic resonance imaging. J. Nanosci. Nanotechnol. 2012, 12, 5132–5137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rudakovskaya, P.G.; Gerasimov, V.M.; Metelkina, O.N.; Beloglazkina, E.K.; Zyk, N.V.; Savchenko, A.G.; Shchetinin, I.V.; Salikhov, S.V.; Abakumov, M.A.; Klyachko, N.L.; et al. Synthesis and characterization of PEG-silane functionalized iron oxide(II, III) nanoparticles for biomedical application. Nanotechnologies Russ. 2015, 10, 896–903. [Google Scholar] [CrossRef] [Scilit]
- Rudakovskaya, P.G. Novel Bifunctional Organic Ligands for Gold Nanoparticles and Magnetite Modification and Hybrid Materials on Its Basis: Synthesis, Properties, and Applications; Moscow State University: Moscow, Russia, 2015. [Google Scholar]
- Kim, J.E.; Shin, J.Y.; Cho, M.H. Magnetic nanoparticles: An update of application for drug delivery and possible toxic effects. Arch. Toxicol. 2012, 86, 685–700. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef] [Scilit]
- Präbst, K.; Engelhardt, H.; Ringgeler, S.; Hübner, H. Basic Colorimetric Proliferation Assays: MTT, WST, and Resazurin. In Cell Viability Assays. Methods in Molecular Biology; Humana Press: New York, NY, USA, 2017; pp. 1–17. [Google Scholar]
- Becerra, M.E.; Suarez, A.M.; Arias, N.P.; Giraldo, O. Decomposition of the Methylene Blue Dye Using Layered Manganese Oxide Materials Synthesized by Solid State Reactions. Int. J. Chem. Eng. 2018, 2018, 4902376. [Google Scholar] [CrossRef] [Scilit]
- Mai, T. Functionalization of iron oxide nanoparticles with small molecules and the impact on reactive oxygen species generation for potential biomedical and enviromental applacations. Colloids Surf. A Physicochem. Eng. Aspa. 2019, 576, 9–14. [Google Scholar] [CrossRef] [Scilit]
- Wydra, R.J.; Oliver, C.E.; Anderson, K.W.; Dziubla, T.D.; Hilt, J.Z. Accelerated generation of free radicals by iron oxide nanoparticles in the presence of an alternating magnetic field. RSC Adv. 2015, 5, 18888–18893. [Google Scholar] [CrossRef] [Scilit]
- Lomzov, A.A.; Kupryushkin, M.S.; Shernyukov, A.V.; Nekrasov, M.D.; Dovydenko, I.S.; Stetsenko, D.A.; Pyshnyi, D.V. Diastereomers of a mono-substituted phosphoryl guanidine trideoxyribonucleotide: Isolation and properties. Biochem. Biophys. Res. Commun. 2019, 513, 807–811. [Google Scholar] [CrossRef] [Scilit]
- Epanchintseva, A.; Vorobjev, P.; Pyshnyi, D.; Pyshnaya, I. Fast and Strong Adsorption of Native Oligonucleotides on Citrate-Coated Gold Nanoparticles. Langmuir 2018, 34, 164–172. [Google Scholar] [CrossRef] [Scilit]





| Oligonucleotide | Solution | pH | Hydrodynamic Diameter, nm | PDI | ζ-Potential, mV | Oligonucleotide/MNP nmol/mg |
|---|---|---|---|---|---|---|
| − * | Water | 5.5 | 15.6 ± 2.2 | 0.296 ± 0.003 | 36.0 ± 0.9 | − |
| + | 5.5 | 180 ± 3 | 0.25 ± 0.01 | −29.0 ± 0.8 | 48 ± 2 | |
| − | Acetic buffer | 3.0 | 44 ± 0.5 | 0.29 ± 0.02 | 35 ± 4 | − |
| + | 3.0 | 133 ± 5 | 0.166 ± 0.007 | −13 ± 3 | 47 ± 2 | |
| − | Acetic buffer | 4.0 | 40 ± 0.3 | 0.244 ± 0.009 | 36.0 ± 0.6 | − |
| + | 4.0 | 116 ± 5 | 0.19 ± 0.1 | −23 ± 1 | 46 ± 2 | |
| − | Acetic buffer | 5.0 | 45 ± 0.4 | 0.276 ± 0.006 | 33 ± 1 | − |
| + | 5.0 | 120 ± 1.5 | 0.254 ± 0.006 | −21.0 ± 1.5 | 16 ± 1 | |
| − | Acetic buffer | 6.0 | 46 ± 0.2 | 0.259 ± 0.005 | 25 ± 3 | − |
| + | 6.0 | 112 ± 2 | 0.33 ± 0.01 | −26.0 ± 0.8 | 19 ± 1 | |
| − | Acetic buffer | 7.0 | 63 ± 3 | 0.41 ± 0.01 | 29 ± 2 | − |
| + | 7.0 | 126 ± 3 | 0.39 ± 0.03 | −33 ± 5 | 26 ± 2 | |
| − | PBS | 7.4 | 117 ± 1 | 0.14 ± 0.02 | −36 ± 1 | − |
| + | 7.4 | 98 ± 1 | 0.132 ± 0.004 | −28 ± 3 | 9.6 ± 0.1 | |
| − | AP | 7.5 | 37 ± 1 | 0.223 ± 0.008 | 31.0 ± 0.8 | − |
| + | 7.5 | 145 ± 2 | 0.22 ± 0.03 | −30 ± 2 | 47 ± 2 | |
| − | SBB | 8.3 | 93 ± 1 | 0.21 ± 0.01 | 26 ± 3 | − |
| + | 8.3 | 172 ± 3 | 0.27 ± 0.02 | −16 ± 0.5 | 9.9 ± 0.1 | |
| − | AP | 9.5 | 45 ± 2 | 0.227 ± 0.002 | 31 ± 2 | − |
| + | 9.5 | 112 ± 1 | 0.185 ± 0.007 | −26 ± 1.4 | 16 ± 1 |
| Name | Sequence | Oligonucleotide/MNP nmol/mg |
|---|---|---|
| T26 | TTTTTTTTTTTTTTTTTTTTTTTTTT | 48 ± 2 |
| A26 | AAAAAAAAAAAAAAAAAAAAAAAAAA | 25 ± 1 |
| C26 | CCCCCCCCCCCCCCCCCCCCCCCCCC | 31 ± 1 |
| X26 | TTTTTTTCAGGCAGTACCACAAGGCC | 25 ± 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bobrikova, E.; Chubarov, A.; Dmitrienko, E. The Effect of pH and Buffer on Oligonucleotide Affinity for Iron Oxide Nanoparticles. Magnetochemistry 2021, 7, 128. https://doi.org/10.3390/magnetochemistry7090128
Bobrikova E, Chubarov A, Dmitrienko E. The Effect of pH and Buffer on Oligonucleotide Affinity for Iron Oxide Nanoparticles. Magnetochemistry. 2021; 7(9):128. https://doi.org/10.3390/magnetochemistry7090128
Chicago/Turabian StyleBobrikova, Ekaterina, Alexey Chubarov, and Elena Dmitrienko. 2021. "The Effect of pH and Buffer on Oligonucleotide Affinity for Iron Oxide Nanoparticles" Magnetochemistry 7, no. 9: 128. https://doi.org/10.3390/magnetochemistry7090128
APA StyleBobrikova, E., Chubarov, A., & Dmitrienko, E. (2021). The Effect of pH and Buffer on Oligonucleotide Affinity for Iron Oxide Nanoparticles. Magnetochemistry, 7(9), 128. https://doi.org/10.3390/magnetochemistry7090128

