Modern Approaches to In Vitro Clonal Banana Production: Next-Generation Tissue Culture Systems
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and In Vitro Establishment
2.2. Comparison of Different Culture Systems in the Micropropagation Stage
2.3. Comparison of Different Culture Systems in the Rooting Stage
2.4. Photosynthetic Pigment and Total Carotenoid Analysis
2.5. Stoma Investigations
2.6. Ex Vitro Acclimatization
2.7. Determination of Genetic Stability of Plants
2.8. Experimental Plan and Statistical Analysis
3. Results
3.1. Assessing the Impact of Different Culture Methods on Shoot Multiplication
3.2. Assessing the Impact of Different Culture Methods on Rooting
3.3. Stomata Examinations
3.4. Assessing the Impact of Different Culture Methods on Acclimatization
3.5. Effect of Different Culture Systems on Photosynthetic Pigment Contents
3.6. Genetic Stability Analysis Results
4. Discussion
4.1. Assessing the Impact of Different Culture Methods on Shoot Multiplication
4.2. Assessing the Impact of Different Culture Methods on Rooting
4.3. Effect of Different Culture Systems on Stoma Examinations and Photosynthetic Pigment Contents
4.4. Genetic Stability Analysis Results
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Aka Kaçar, Y.; Biçen, B.; Şimşek, Ö.Z.; Dönmez, D.; Erol, M. Evaluation and comparison of a new type of temporary immersion system (TIS) bioreactors for myrtle (Myrtus communis L.). Appl. Ecol. Environ. Res. 2020, 18, 1611–1620. [Google Scholar] [CrossRef] [Scilit]
- Şimşek, Ö.; Dönmez, D.; Sarıdaş, M.A.; Acar, E.; Kaçar, Y.A.; Kargı, S.P.; İzgü, T. In vitro and ex vitro propagation of Turkish myrtles through conventional and plantform bioreactor systems. PeerJ 2023, 11, e16061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plantform. 2023. Available online: https://www.plantform.se/pub/ (accessed on 8 August 2023).
- Tisserat, B.; Vandercook, C.E. Development of an automated plant culture system. Plant Cell Tiss. Org. 1985, 5, 107–117. [Google Scholar] [CrossRef] [Scilit]
- Wardhan, H.; Das, S.; Gulati, A. Banana and mango value chains. In Agricultural Value Chains in India: Ensuring Competitiveness, Inclusiveness, Sustainability, Scalability, and Improved Finance; Springer Nature: Berlin/Heidelberg, Germany, 2022; pp. 99–143. [Google Scholar] [CrossRef] [Scilit]
- Faostat. 2023. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 28 July 2023).
- Voora, V.; Larrea, C.; Bermudez, S. Global Market Report: Bananas; International Institute for Sustainable Development: Winnipeg, MB, Canada, 2020. [Google Scholar]
- Saridaş, M.A.; Kargi, S.P.; Bayiroğlu, B.M.; Şeyma, Y.A. New ecology for banana production of Turkey. Yuzuncu Yil Univ. J. Agric. Sci. 2017, 27, 370–377. [Google Scholar] [CrossRef] [Scilit]
- Kacar, Y.A.; Biçen, B.; Varol, I.; Mendi, Y.Y.; Serçe, S.; Çetiner, S. Gelling agents and culture vessels affect in vitro multiplication of banana plantlets. Genet. Mol. Res. 2010, 9, 416–424. [Google Scholar]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef] [Scilit]
- Vervit. 2023. Available online: http://www.vervit.be/products/technologies/setis-platform (accessed on 8 August 2023).
- Lichtenthaler, H.K. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1987; Volume 148, pp. 350–382. [Google Scholar]
- Xu, Z.; Zhou, G. Responses of leaf stomatal density to water status and its relationship with photosynthesis in a grass. J. Exp. Bot. 2008, 59, 3317–3325. [Google Scholar] [CrossRef] [Scilit]
- Mattos, L.A.; Amorim, E.P.; Amorim, V.B.; Cohen, K.D.; Ledo, C.A.; Silva, S.D. Agronomical and molecular characterization of banana germplasm. Pesqui. Agropecu. Bras. 2010, 45, 146–154. [Google Scholar] [CrossRef] [Scilit]
- Crouch, J.H.; Crouch, H.K.; Constandt, H.; Van Gysel, A.; Breyne, P.; Van Montagu, M.; Jarret, R.L.; Ortiz, R. Comparison of PCR-based molecular marker analyses of Musa breeding populations. Mol. Breed. 1999, 5, 233–244. [Google Scholar] [CrossRef] [Scilit]
- Lagoda, P.J.L.; Noyer, J.L.; Baurens, F.C.; Lanaud, C.; Dambier, D. Abundance and Distribution of Simple Sequence Repeats in the Musaceae Family. Microsatellite Markers to Map the Banana Genome; IAEA: Vienna, Austria, 1995. [Google Scholar]
- Creste, S.; Tulmann Neto, A.; Vencovsky, R.; de Oliveira Silva, S.; Figueira, A. Genetic diversity of Musa diploid and triploid accessions from the Brazilian banana breeding program estimated by microsatellite markers. Genet. Resour. Crop Evol. 2004, 51, 723–733. [Google Scholar] [CrossRef] [Scilit]
- Oriero, C.E.; Odunola, O.A.; Lokko, Y.; Ingelbrecht, I. Analysis of B-genome derived simple sequence repeat (SSR) markers in Musa spp. Afr. J. Biotechnol. 2006, 5, 126–128. [Google Scholar]
- JMP®; Version <5.01>; SAS Institute Inc.: Cary, NC, USA, 1989–2023.
- Noceda, C.; Vargas, A.; Roels, S.; Cejas, I.; Santamaría, E.; Escalona, M.; Debergh, P.; Rodríguez, R.; Sandoval, J.; Cañal, M.J. Field performance and (epi) genetic profile of plantain (Musa AAB) clone ‘CEMSA ¾’plants micropropagated by temporary immersion systems. Sci. Hortic. 2012, 46, 65–75. [Google Scholar] [CrossRef] [Scilit]
- Wilken, D.; Jiménez Gonzalez, E.; Gerth, A.; Gómez-Kosky, R.; Schumann, A.; Claus, D. Effect of immersion systems, lighting, and TIS designs on biomass increase in micropropagating banana (Musa spp. cv. ‘Grande Naine’ AAA). Vitr. Cell. Dev. Biol. Plant 2014, 50, 582–589. [Google Scholar] [CrossRef] [Scilit]
- Moreno, A.; Bernal, Á.; Ugarte, F.; Lima, K.; Coig, M.; Sánchez, C.; Aldrey, A.; Vidal, N. Use of liquid medium and biofortificants for improving micropropagation and acclimation of Musa AAA cv. Williams. In Proceedings of the he 5th International Conference of the IUFRO Unit 2.09.02: Clonal Trees in the Bioeconomy Age: Opportunities and Challenges, Coimbra, Portugal, 10–15 September 2018. [Google Scholar]
- Bello-Bello, J.J.; Cruz-Cruz, C.A.; Pérez-Guerra, J.C. A new temporary immersion system for commercial micropropagation of banana (Musa AAA cv. Grand Naine). Vitro Cell. Dev. Biol. Plant 2019, 55, 313–320. [Google Scholar] [CrossRef] [Scilit]
- Uma, S.; Karthic, R.; Kalpana, S.; Backiyarani, S.; Saraswathi, M.S. A novel temporary immersion bioreactor system for large scale multiplication of banana (Rasthali AAB—Silk). Sci. Rep. 2021, 11, 20371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdulmalik, M.M.; Usman, I.S.; Nasir, A.U.; Sani, L.A. Micropropagation of banana (Musa spp.) using temporary immersion bioreactor system. Bayero J. Pure Appl. Sci. 2020, 12, 197–200. [Google Scholar] [CrossRef] [Scilit]
- Roles, S.; Escalona, M.; Cejas, I.; Noceda, C.; Rodriguez, R.; Canal, M.J.; Sandoval, J.; Debergh, P. Optimization of plantain (Musa AAB) micropropagation by temporary immersion system. Plant Cell Tiss. Org. 2005, 82, 57–66. [Google Scholar] [CrossRef] [Scilit]
- Ramírez-Mosqueda, M.A.; Bello-Bello, J.J. SETIS™ bioreactor increases in vitro multiplication and shoot length in vanilla (Vanilla planifolia Jacks. Ex Andrews). Acta Physiol. Plant. 2021, 43, 52. [Google Scholar] [CrossRef] [Scilit]
- Hwang, H.D.; Kwon, S.H.; Murthy, H.N.; Yun, S.W.; Pyo, S.S.; Park, S.Y. Temporary immersion bioreactor system as an efficient method for mass production of in vitro plants in horticulture and medicinal plants. Agronomy 2022, 12, 346. [Google Scholar] [CrossRef] [Scilit]
- Thi, L.T.; Park, Y.G.; Jeong, B.R. Growth and development of carnation ‘Dreambyul’plantlets in a temporary immersion system and comparisons with conventional solid culture methods. Vitro Cell. Dev. Biol. Plant. 2019, 55, 539–548. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Niu, Z.; Li, C.; Hou, Z.; Xue, Q.; Liu, W.; Ding, X. Improving large-scale biomass and total alkaloid production of Dendrobium nobile Lindl. using a temporary immersion bioreactor system and MeJA elicitation. Plant Methods 2022, 18, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saptari, R.T.; Esyanti, R.R.; Putranto, R.A. Daminozide enhances the vigor and steviol glycoside yield of stevia (Stevia rebaudiana Bert.) propagated in temporary immersion bioreactors. Plant Cell Tiss. Org. 2022, 149, 257–268. [Google Scholar] [CrossRef] [Scilit]
- Leyva-Ovalle, O.R.; Bello-Bello, J.J.; Murguía-González, J.; Núñez-Pastrana, R.; Ramírez-Mosqueda, M.A. Micropropagation of Guarianthe skinneri (Bateman) Dressler et WE Higging in temporary immersion systems. 3 Biotech 2020, 10, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costa, B.N.; Rúbio Neto, A.; Chagas, E.A.; Chagas, P.C.; Pasqual, M.; Vendrame, W.A. Influence of silicon and in vitro culture systems on the micropropagation and acclimatization of “Dwarf Cavendish” banana. Acta Scientiarum. Agronomy 2020, 43, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Pavlov, A.; Bley, T. Betalains biosynthesis by Beta vulgaris L. hairy root culture in a temporary immersion cultivation system. Process Biochem. 2006, 41, 848–852. [Google Scholar] [CrossRef] [Scilit]
- Mišić, D.; Šiler, B.; Skorić, M.; Djurickovic, M.S.; Živković, J.N.; Jovanović, V.; Giba, Z. Secoiridoid glycosides production by Centaurium maritimum (L.) Fritch hairy root cultures in temporary immersion bioreactor. Process Biochem. 2013, 48, 1587–1591. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.H.; Yeh, D.M. In vitro leaf anatomy, ex vitro photosynthetic behaviors and growth of Calathea orbifolia (Linden) Kennedy plants obtained from semi-solid medium and temporary immersion systems. Plant Cell Tiss. Org. 2008, 93, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Ramírez-Mosqueda, M.A.; Iglesias-Andreu, L.G. Evaluation of different temporary immersion systems (BIT®, BIG, and RITA®) in the micropropagation of Vanilla planifolia Jacks. Vitro Cell. Dev. Biol. Plant 2016, 52, 154–160. [Google Scholar] [CrossRef] [Scilit]
- Bairu, M.W.; Fennell, C.W.; van Staden, J. The effect of plant growth regulators on somaclonal variation in Cavendish banana (Musa AAA cv. ‘Zelig’). Sci. Hortic. 2006, 108, 347–351. [Google Scholar] [CrossRef] [Scilit]
- Korneva, S.; Flores, J.; Santos, E.; Piña, F.; Mendoza, J. Plant regeneration of plantain ‘Barraganete’from somatic embryos using a temporary immersion system. Biotecnol. Apl. 2013, 30, 267–270. [Google Scholar]
- Safarpour, M.; Sinniah, U.R.; Subramaniam, S.; Swamy, M.K. A novel technique for Musa acuminata Colla ‘Grand Naine’(AAA) micropropagation through transverse sectioning of the shoot apex. Vitro Cell. Dev. Biol. Plant 2017, 53, 226–238. [Google Scholar] [CrossRef] [Scilit]
- D’hont, A.; Denoeud, F.; Aury, J.M.; Baurens, F.C.; Carreel, F.; Garsmeur, O.; Noel, B.; Bocs, S.; Droc, G.; Rouard, M.; et al. The banana (Musa acuminata) genome and the evolution of monocotyledonous plants. Nature 2012, 488, 213–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| No | Primer | Primer Sequences | Reference |
|---|---|---|---|
| 1 | MA1-17 | F: AGGCGGGGAATCGGTAGA R: GGCGGGAGACAGATGGAG | [15] |
| 2 | MA1-27 | F: TGAATCCCAATTTGGTCAAG R: CAAAACACTGTCCCCATCTC | |
| 3 | MA3-103 | F: TCGCCTCTCTTTAGCTCTG R: TGTTGGAGGATCTGAGATTG | |
| 4 | AGMI 24-25 | F: TTTGATGTCACAATGGTGTTCC R: TAAAGGTGGGTTAGCATTAGG | [16] |
| 5 | AGMI 67-68 | F: ATACCTTCTCCCGTTCTTCTTC R: TGGAAACCCAATCATTGATC | |
| 6 | AGMI 93-94 | F: ACAACTAGGATGGTAATGTGTGGAA R: GATCTGAGGATGGTTCTGTTGGAGTG | |
| 7 | AGMI 103-103 | F: CAGAATCGCTAACCCTATCCTCA R: CCCTTTGCGTGCCCCTAA | |
| 8 | MAOCEN01 | F: TCTCAGGAAGGGCAATC R: GGACCAAAGGGAAAGAAACC | [17] |
| 9 | MAOCEN03 | F: GGAGGAAATGGAGGTCAACA R: TTCGGGATAGGAGGAGGAG | |
| 10 | MAOCEN10 | F: GGAAGAAAGAAGTGGAGAATGAA R: TGAAATGGATAAGGCAGAAGAA | |
| 11 | MAOCEN12 | F: GCAAGAAAGAACGAGAAGGAAA R: GTGGGGAGGGAGGCATAG | |
| 12 | MAOCEN13 | F: GCTGCTATTTTGTCCTTGGTG R: CTTGATGCTGGGAATCTGG | |
| 13 | MB1-100 | F: TCGGCTGGCTAATAGAGGAA R: TCTCGAGGGATGGTGAAAGA | [18] |
| Variety | Culture Systems | Plant Length (cm) | Number of Shoots | Number of Leaves | Fresh Weight (g) | Dry Weight (g) |
|---|---|---|---|---|---|---|
| Grande Naine | Solid | 4.38 a | 3.58 c | 10.27 a | 1.53 d | 0.18 bc |
| Plantform™ | 4.06 b | 4.32 a | 9.88 b | 1.89 a | 0.22 a | |
| SETIS™ | 3.88 c | 4.01 b | 9.30 d | 1.85 a | 0.19 b | |
| Azman | Solid | 3.98 bc | 2.06 d | 6.73 e | 1.07 e | 0.09 e |
| Plantform™ | 3.48 d | 3.75 c | 8.29 d | 1.66 c | 0.16 d | |
| SETIS™ | 3.87 c | 4.08 b | 8.29 d | 1.73 b | 0.18 c |
| Variety | Culture Systems | Plant Length (cm) | Number of Roots/Plant | Root Length (cm) | Number of Leaves | Fresh Weight (g) | Dry Weight (g) |
|---|---|---|---|---|---|---|---|
| Grande Naine | Solid | 5.45 d | 5.08 d | 6.61 d | 4.95 b | 2.26 c | 0.21 |
| Plantform™ | 7.32 b | 7.51 b | 11.43 b | 6.63 a | 2.84 b | 0.23 | |
| SETIS™ | 8.51 a | 9.18 a | 13.47 a | 5.08 b | 2.94 ab | 0.24 | |
| Azman | Solid | 5.28 d | 5.33 cd | 5.06 e | 6.37 b | 1.15 d | 0.16 |
| Plantform™ | 6.14 c | 7.11 b | 12.03 b | 4.42 c | 1.89 c | 0.21 | |
| SETIS™ | 7.79 b | 9.92 a | 8.80 c | 5.12 b | 3.21 a | 0.27 |
| Variety | Applications | Stomata Density (per mm2) | Stomata Opening (µm) | Stomata Area (µm2) | |||
|---|---|---|---|---|---|---|---|
| Leaf Surface | Anterior | Posterior | Anterior | Posterior | Anterior | Posterior | |
| Grande Naine | Solid | 17.36 bc | 115.91 a | 3.46 c | 5.71 c | 971.8 | 1011.21 |
| Plantform™ | 16.9 bcd | 98.18 b | 4.96 b | 10.01 a | 1025.05 | 1122.98 | |
| SETIS™ | 18.73 ab | 100.78 b | 5.71 a | 9.88 a | 949.17 | 1010.76 | |
| Azman | Solid | 15.17 d | 114.13 a | 2.73 d | 4.48 d | 882.91 | 1010.76 |
| Plantform™ | 16.72 cd | 100.78 b | 3.79 c | 7.42 b | 899.22 | 1091.51 | |
| SETIS™ | 20.1 a | 86.58 c | 4.64 b | 9.76 a | 999.35 | 1163.67 | |
| Variety | Culture Systems | Survivor (%) | Plant Length (cm) | Number of Leaves |
|---|---|---|---|---|
| Grande Naine | Solid | 100 | 18.35 c | 8.73 a |
| Plantform™ | 100 | 22.87 ab | 7.40 de | |
| SETIS™ | 100 | 23.42 ab | 7.55 cd | |
| Azman | Solid | 100 | 15.73 d | 7.87 bc |
| Plantform™ | 100 | 22.18 b | 7.04 e | |
| Setis | 100 | 23.91 a | 8.18 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Erol, M.H.; Dönmez, D.; Biçen, B.; Şimşek, Ö.; Kaçar, Y.A. Modern Approaches to In Vitro Clonal Banana Production: Next-Generation Tissue Culture Systems. Horticulturae 2023, 9, 1154. https://doi.org/10.3390/horticulturae9101154
Erol MH, Dönmez D, Biçen B, Şimşek Ö, Kaçar YA. Modern Approaches to In Vitro Clonal Banana Production: Next-Generation Tissue Culture Systems. Horticulturae. 2023; 9(10):1154. https://doi.org/10.3390/horticulturae9101154
Chicago/Turabian StyleErol, Mansur Hakan, Dicle Dönmez, Belgin Biçen, Özhan Şimşek, and Yıldız Aka Kaçar. 2023. "Modern Approaches to In Vitro Clonal Banana Production: Next-Generation Tissue Culture Systems" Horticulturae 9, no. 10: 1154. https://doi.org/10.3390/horticulturae9101154
APA StyleErol, M. H., Dönmez, D., Biçen, B., Şimşek, Ö., & Kaçar, Y. A. (2023). Modern Approaches to In Vitro Clonal Banana Production: Next-Generation Tissue Culture Systems. Horticulturae, 9(10), 1154. https://doi.org/10.3390/horticulturae9101154

