Growth Responses and Adventitious Root Formation of Cucumber Hybrid Lines in a Waterlogged Condition

Abstract

Cucumber (Cucumis sativus L.) F1 hybrids are grown commercially in open-field or greenhouse conditions. Hybrids are well adapted to these settings due to directed breeding. In protected cultivation systems, a small rhizosphere volume and intensive, continuous fertigation predispose the roots to waterlogging (WL) conditions and potentially to hypoxia. However, high productivity is expected and achieved under these conditions. The aim of this study was to identify traits that play a role in this surprising behavior. Initial observations revealed the presence of a significantly higher number of adventitious roots (ARs) in three greenhouse (7–14) vs. three open-field cultivars (less than two) grown under normal conditions. Further on, two contrasting representative hybrids typically grown in open-field and in greenhouse conditions were subjected to WL stress. Declining oxygen levels in the media and increased alcohol dehydrogenase activity (ADH) in the roots were experienced during the WL treatment in both hybrids, with anaerobic metabolism triggered less intensively (~4-fold less ADH activity) in the greenhouse-type ‘Oitol’. The induction characteristics of cysteine oxidase (CysOx) genes, key components of the hypoxia sensing pathway, were used to confirm the hypoxic stress experienced by the roots. The lower extent of upregulation in CysOx genes expression agreed with the milder level of hypoxic stress in the roots of ‘Oitol’ than in ‘Joker’. The more efficient induction of AR formation with a ~50% increase upon waterlogging stress was found to be a prominent trait in ‘Oitol’, apparently helping root internal aeration and mitigating hypoxia. The shoot growth of neither hybrid was set back by hypoxic root conditions. ‘Joker’ plants maintained the same growth rate as that of the control, while the growth of ‘Oitol’ accelerated when its root system was flooded with nutrient solution. Acclimation processes to hypoxia were proposed to explain the lack of growth retardation in both varieties. This corresponded well with a general abundance of AR development in greenhouse-type (slicing) cucumbers that are typically cultivated in soilless systems.

1. Introduction

Cucumber is one of the most traditionally consumed vegetables worldwide. It is grown commercially both in open fields and under greenhouse conditions. Marketed hybrids are well adapted to the specific growth systems of the location in which they are intended to be cultivated, due to intensive breeding efforts. Molecular studies have revealed a strong diversity in the available cucumber genotypes [1]. Cucumber is generally considered to be sensitive to waterlogging (WL). Intra-species variability in waterlogging tolerance has been detected in cucumbers [2], but is not yet linked to any group of genotypes. Slicing-type cucumbers are usually grown under protection, with intensive fertigation, and often in soilless substrates. In this case, the small rhizosphere volume and intensive irrigation/fertigation predispose the roots to WL stress, and therefore hypoxia. However, intensive slicing-type hybrids still reach high productivity under these conditions. This most likely results from the traits introduced by targeted breeding efforts that have made possible the adaptation of roots to hypoxia.

In several plant species, WL tolerance levels may also vary [3]. This has been linked to traits including aerenchyma formation, the development of adventitious roots, and/or alterations in sensory or metabolic pathways [4,5,6]. The molecular background of these traits has been extensively studied and partially elucidated. Adventitious roots alleviate hypoxia in root tissues by providing oxygen internally and thereby decreasing the need to switch to anaerobic metabolic pathways to sustain energy production [7].

In addition to anatomical adaptations, hypoxia also triggers plant physiological responses at the molecular level. Group VII ethylene response factors (ERFs) are among the elements that contribute to the upregulation of genes involved in anaerobic metabolism and adaptations to hypoxia [8,9]. Another class of genes linked to hypoxia stress acclimation is plant cysteine oxidases (PCOs), whose products are known as O₂-sensing enzymes. PCOs are capable of catalyzing the oxidation of cysteine to Cys-sulfinic acid in O₂-availability-dependent reactions, thereby activating Group VII ERFs [10,11]. Therefore, PCOs are considered to be important markers of plants’ hypoxic conditions [12]. Although the central components of plants’ hypoxia adaptation and anaerobic metabolism have been the subject of intensive research in the past decade, uncovering the pathways implicated in their response to low oxygen is still the subject of in-depth research [13].

In this work, the commercial growth conditions of young cucumber plants are imitated experimentally. To this end, WL is applied to contrasting genotypes in a perlite-based semi-hydroponic growth system. Greenhouse-grown and open-field-type hybrids were tested via their root systems being flooded with nutrient solution. This study aimed to reveal the hybrid-specific responses to WL and to identify the associated morphological, physiological and molecular traits. To obtain a more general view of the frequency of adventitious root formation in commercial cucumber hybrids, the number of ARs in several varieties of the two major cultivation types was evaluated.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

Four open-field-grown cucumber F1 cultivars (‘Joker’, ‘Dirigent’, ‘Harmony’ and ‘Promissa’), as well as four further hybrids usually grown in greenhouse conditions (‘Oitol’, ‘Forami’, ‘Diapason’ and ‘Grafito’), were considered and used in this research. Seeds of the cucumber varieties were obtained from Royal Sluis Magrovet Kft (Kecskemét, Hungary), except for the ‘Oitol’ hybrid, which was purchased from Semillas Fito Co. (Barcelona, Spain). To establish cultures, the cucumber seeds were submerged in 100 mL of distilled water for 24 h at 25 °C to imbibe. Plants were grown in a semi-hydroponic system, which approximates commercial cultivation practices in soilless media in a growth chamber (FitoClima 600, Rio de Mouro, Portugal). Seeds were individually sown in perlite in 10 cm diameter pots and grown at 26 ± 1 °C under a 16 h photoperiod with a photosynthetic photon flux density of 160–180 µmol m⁻² s⁻¹ at culture level and at 75–80% of the relative humidity. During the first week, plants were irrigated with distilled water, followed by the treatment of each pot with 150 mL of nutrient solution every other day (4 mM KNO₃, 2 mM KH₂PO₄, 1.5 mM CaSO₄∙2H₂O, 0.5 mM MgSO₄∙6H₂O, 0.5 mM MES, 0.05 mM Ferric sodium EDTA, 5 µM H₃BO₃, 1 µM MnCl₂∙4H₂O, 0.5 µM ZnSO₄∙7H₂O, 0.25 µM CuSO₄∙5H₂O, 0.1 µM NiSO₄∙6H₂O, 0.1 µM Na₂MoO₄∙2H₂O; EC: 1.25 µS/cm) for 14 days. The adventitious roots that appeared above the perlite level were counted at one-week intervals.

‘Joker’ and ‘Oitol’ plants (representatives of the two major cucumber types: greenhouse and open-field) were grown under the same conditions and subsequently subjected to waterlogging treatment when the second leaves were fully expanded (circa two weeks after planting). The waterlogging treatment was applied by submerging the pots into larger containers that were filled with nutrient solution. The surface of the nutrient solution was maintained at the uppermost layer of perlite. The solutions’ O₂ concentration (DOI) was monitored with an oxygen meter (Voltcraft DO-101, Conrad Electronic, Berlin, Germany). The nutrient solution was refreshed every 7 days with new solutions of the same nutrient and DOI level. The non-flooded control plants were irrigated with 150 mL of the same nutrient solution every other day. After 14 days of waterlogging, the leaf samples were harvested, photographed, and the total leaf area per plant was calculated using ImageJ software (Image Processing and Analysis in Java, Bethesda, MD, USA). The number of ARs above the perlite level were recorded before freezing the leaf and root samples in liquid nitrogen for RNA extraction and physiological analysis. The fresh weight (total foliar mass) of each intact plant was measured using a laboratory scale, and then the leaves of individual plants were separated from the stem, labeled in paper bags and kept in an oven at 70 °C for 72 h to obtain the dry leaf weight.

2.2. Alcohol Dehydrogenase (ADH) Activity

ADH enzyme activity was measured spectrophotometrically by monitoring the oxidation of NADH at 340 nm, according to Kang et al. (2009) [14]. Root samples (100 mg) were homogenized in mortar with 500 µL extraction buffer (50 mM Tris–HCl (pH 6.8) containing 5 mM MgCl₂, 5 mM mercaptoethanol, 15% (v/v) glycerol, 1 mM EDTA and 0.1 mM PMSF. To assay the ADH activity, 100 µL of enzyme extract was added to 1mL reaction solution containing 50 mM TES (pH 7.5), 0.17 mM NADH, and 0.2% (v/v) acetaldehyde. Enzyme activity was quantified using the molar extinction coefficient of NADH (6.22 mM⁻¹ cm⁻¹) and the results were expressed as µmol NADH min⁻¹ g FW⁻¹.

2.3. Malondialdehyde (MDA) Detection and Guaiacol Peroxidase (POD) Assay

The MDA content of the leaf samples was determined using the thiobarbituric acid (TBA) method according to the method of Hodges et al., [15] with slight modifications. Briefly, MDA was extracted with 0.1% (w/v) TCA and reacted with 0.5% (w/v) TBA in 20% (w/v) TCA at 100 °C for 30 min. The samples were cooled on ice, and absorbance was measured at 532, 600 and 440 nm. Results were calculated using a molar absorption coefficient of 1.55 mM⁻¹ cm⁻¹ and expressed as MDA nmol g FW⁻¹.

The activity of the guaiacol peroxidase enzyme was measured according to Jócsák et al. [16] with minor changes. Plant leaf samples (100 mg) were homogenized in 1 mL of isolation buffer (10 mM phosphate buffer pH 7.2, 1 mM EDTA and 2 mM DTT). The crude extract (20 μL) was diluted with 136 μL distillated water in the wells of the 96-well plate. The reaction was initiated by adding 200 μL of substrate solution contaning150 μL of 0.1 M of phosphate pH 6.0, 14 μL of 0.015 M H₂O₂, and 36 μL of 0.02 M guaiacol. Increases in absorbance were recorded at 470 nm every 60 s for 3 min. The results were expressed in μmol tetraguaiacol min⁻¹ g FW⁻¹ using the molar absorption coefficient of tetraguaiacol (26.6 mM⁻¹ cm⁻¹).

2.4. RNA Isolation, cDNA Synthesis, RT-PCR

Total RNA was extracted from deep frozen root samples of the control and waterlogged ‘Joker’ and ‘Oitol’ plants (collected from three different plants of different pots) after grinding in liquid N₂ using sterile mortar and pestles. A modified CTAB-based protocol [17] was used to obtain intact RNAs, as visualized on ethidium bromide-stained 1% agarose gel. The RNA concentration was normalized using a NanoDrop 1000 spectrophotometer. The RNA integrity was controlled once more on agarose gel after DNase I (Thermo Scientific, Waltham, MA, USA) treatment and before reverse transcription. A 5 μg quantity of total RNA was used for first-strand cDNA synthesis in 100 μL reaction volume using the Maxima H Minus Reverse Transcriptase kit (Thermo Scientific) with oligo(dT)₂₀ primers, according to the manufacturer’s protocol. Primers of cysteine oxidase genes and a control Actin gene (

Table 1. Target genes, qRT-PCR oligonucleotide primers and expected amplicon sizes (bp).

Gene	Accession No	Forward Primer (5′-3′)	Reverse Primer (5′-3′)	bp cDNA	bp gDNA
CysOx1	CsaV3_6G015320	GCAAAGCTGCATTGTCTCCT	GGAATGATTGTCGTCTCCCA	171	1926
CysOx2	CsaV3_3G041620	CCTTCAGGTGTCATTCCAC	GCTGTGAAGTCTGCATCTAC	206	837
CysOx3	CsaV3_4G012050	GCTGTCTTCACTTCACCC	CATCCATAACCCTCACCC	227	855
CysOx4	CsaV3_1G003120	GGTTGGCTAAGTTAGCCG	GCAGGACCAACATACATTCC	277	384
ACTIN	CsaV3_2G01809	TCGTGCTTGACTCTGGTGATGG	ACAACCACTGCCGAACGGGAAA	171	171

) were tested for PCR amplification with GO Taq G2 DNA polymerase (Promega, Madison, WI, USA). Prior to qRT-PCR, RT-PCR amplification and expected fragment sizes were confirmed using gel electrophoresis of the PCR product obtained with a T100™ Thermal Cycler instrument (Bio-Rad, USA) after 3 min at 95 °C and 26 cycles of 30 s: 95 °C, 20 s: 58 °C, 20 s: 72 °C, and a final extension for 7 min at 72 °C. Real-time PCR was performed with a CFX 96 Real-Time PCR System (Bio-Rad, USA) using the SsoAdvanced Universal Inhibitor-Tolerant SYBR^® Green Supermix (Bio-Rad) for fluorescence detection in a 96-well optical plate. The total volume of each qPCR reaction was 10 μL, containing 1 μL of 10-times-diluted cDNA, 4 μL of super mix, 0.5 μL (100 uM) of forward and reverse primers, and 4 μL of PCR-grade water. Amplification was initiated with polymerase activation and DNA denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing and extension at 60 °C for 30 s. A melting curve analysis (65–95 °C) was included to confirm the specificity of the PCR products. The PCR efficiency and stability of the internal standard gene (Actin) were evaluated and confirmed as described by Oszlányi et al. [18]. Fold changes of the relative gene expression were estimated using the built-in 2^−∆∆Ct method of the Bio-Rad CFX Maestro software.

2.5. Statistical Analysis

All data were statistically analyzed using SPSS software (IBM SPSS Statistics Version 27.0 IBM Corp, Armonk, NY, USA), and the results are shown as mean values with standard deviations among at least two biological replicates. The normal distribution of residuals was proven using the Shapiro–Wilk test and the homogeneity of variances was checked with Levene’s test. The differences among the means were evaluated using one-way ANOVA followed by Tukey’s post hoc HSD test and considered significant at p < 0.05. MS Excel 2017 was used for the chart data representations.

3. Results

3.1. Adventitious Roots (ARs) of Various F1 Hybrids without Stress Treatment

Cucumber varieties could be grouped based on the number of developed adventitious roots under normal growth conditions. The ARs were more prevalent in hybrids that are typically grown in greenhouses, where seven to fifteen ARs were produced on plants with two to three leaves on average (

Table 2. Numbers of adventitious roots of four greenhouse- and four open-field-grown cucumber hybrids under control conditions.

Cultivar		Number of Adventitious Roots
Greenhouse-type hybrids	Oitol	9.13 ± 7.0 bc
	Diapason	8.44 ± 4.0 bc
	Grafito	14.13 ± 8.7 c
	Forami	7.75 ± 3.4 b
Open-field-type hybrids	Harmony	1.88 ± 1.7 a
	Dirigent	0.0 a
	Promissa	0.0 a
	Joker	0.0 a

Different letters are for significantly different values (Tukey’s, p < 0.05). n = 8.

). Remarkably lower ARs were found on open field type cucumbers. For instance, no AR appeared on ‘Dirigent’, ‘Promissa’, or ‘Joker’ hybrids after 3 weeks of growth in perlite (Table 2).

3.2. AR Numbers of ‘Joker’ and ‘Oitol’ Plants under WL Treatments

The formation of adventitious roots was quantified after the first and second weeks of WL treatment (

Table 3. Number of adventitious roots of two cucumber hybrid lines under control and waterlogged conditions.

Cultivar	Treatment	Number of Adventitious Roots
		1 Week after WL	2 Weeks after WL
Oitol	Control	17.3 ± 4.5 b	40.6 ± 3.2 c
	Waterlogged	31 ± 13.5 c	60.1 ± 5.8 d
Joker	Control	0.86 ± 0.9 a	12.4 ± 2.3 a
	Waterlogged	3.8 ± 2.9 a	19.5 ± 5.2 b

Different letters in each column indicate significantly different values according to Tukey’s post hoc test (p < 0.05). n = 8.

). Both ‘Joker’ and ‘Oitol’ plants showed signs of AR development under control and WL conditions. In the first week of WL, ‘Oitol’ plants showed more intense AR development than the similarly treated ‘Joker’ plants. After one week under control conditions, twenty-times more ARs were developed on the stems of the control ‘Oitol’ plants, while under the WL treatment, ‘Oitol’ plants produced only eight times the number of ARs compared to the ‘Joker’ plants. AR formation on ‘Joker’ plants started during the second week of waterlogging (Table 3). At the end of the experiment, the control and waterlogged ‘Oitol’ plants developed significantly higher (three times more) ARs than the Joker plants.

3.3. Growth Responses and Factors of Redox Balance for ‘Joker’ and ‘Oitol’ Plants under WL Stress

‘Oitol’ and ‘Joker’ plants were waterlogged at the two-true-leaf stage, making sure that the entire root zone was immersed in the nutrient solution. The dissolved oxygen (O₂) level of the WL solution was checked every other day to monitor the accruing hypoxia. The dissolved oxygen level dropped to around 2 mgL⁻¹ by the end of the two-week WL treatment (Figure 1B).

Under both control and WL conditions, greenhouse-type ‘Oitol’ plants had significantly (p < 0.05) larger total leaf area and shoot fresh weight when compared to the open field type ‘Joker’. The total leaf area and shoot fresh weight of the ‘Oitol’ plants significantly increased (over 30%) after WL treatment (Figure 1A,C,D). The leaf dry weight was also enhanced by 24.5% in WL-treated ‘Oitol’ plants (Figure 1E). The ‘Joker’ plants displayed no major phenotypic changes under waterlogging conditions when compared to the controls (Figure 1A,C–E).

An elevated malondialdehyde (MDA) level is one of the most important markers of free-radical-induced lipid peroxidation and membrane damage. A significantly lower level of MDA was detected in waterlogged ‘Joker’ and ‘Oitol’ leaves when compared to the control plants (Figure 2A). In general, significantly higher guaiacol peroxidase (POD) activity was found in ‘Joker’ plants, but the waterlogging did not cause any significant changes in POD activity between the control and waterlogged plants of both hybrids (Figure 2B).

3.4. Alcohol Dehydrogenase Activity in Roots of ‘Joker’ and ‘Oitol’ Plants under WL Treatments

Alcohol dehydrogenase (ADH) enzymes are known for their assistance in prolonged glycolysis under hypoxia. The ADH activity was determined in the root samples of ‘Joker’ and ‘Oitol’ plants under WL stress. Waterlogging significantly (p < 0.05) increased the ADH activity in the roots of both hybrids (‘Joker’ and ‘Oitol’), as presented in Figure 3. The ADH activity was increased to higher level (12.59 µmol min⁻¹g FW⁻¹) in ‘Joker’ when compared to its non-stressed control counterparts (0.85 µmol min⁻¹g FW⁻¹). The ‘Oitol’ plants showed significantly lower ADH activity than the ‘Joker’ plants under both control and WL conditions (Figure 3).

3.5. Expression of Cysteine-Oxidase Genes (PCOs) in Cucumber Roots under WL Treatment

The relative gene expression analysis of the four annotated cysteine oxidase genes (PCOs) in the cucumber genome is presented in Figure 4. The product specificity of the amplified fragments was confirmed using melting cure analysis after the real-time PCR. Waterlogging clearly induced the expression of all cucumber PCOs in ‘Joker’ plants’ roots (Figure 4). The highest level of upregulation was detected in waterlogged ‘Joker’ plants in the case of CysOx1 and CysOx4, with approximately 17- and 5-fold changes, respectively. The expressions of CysOx1 and CysOx4 in the roots of ‘Oitol’ plants remained unchanged, whereas the CysOx2 and CysOx3 expressions showed a slight upregulation (less than 2- fold changes) in both hybrids (Figure 4). The obtained result point to the WL inducibility of the cucumbers’ cysteine oxidase genes to a varying degree through waterlogging-derived hypoxia.

4. Discussion

Modern cucumber F1 hybrids are the products of intensive breeding to fit for either greenhouse or open field cultivation systems. Greenhouse-type hybrids are often grown in soilless media, where irrigation/fertigation creates a waterlogged (WL) environment for the root system in a small volume compartment. In a search for traits that may alleviate the impact of WL stress, several hybrids of both cultivation types were inspected for the extent of adventitious root (AR) formation. It was found that ARs occurred more frequently in hybrids intended for greenhouse cultivation, even in the absence of any stresses. The connection between the hybrid type and the frequency of AR formation indicates that the internal aeration supported by ARs is of particular importance for the adaptation of the hybrids subjected to intensive fertigation under a protected environment. ARs may provide extra growth potential for these hybrids under their typical cultivation conditions. This result indicates the significance of AR formation in the productive and commercial cultivation of cucumbers in greenhouses.

Furthermore, in this study a pair of cucumber genotypes was investigated, representing the two major hybrid types: a greenhouse-grown ‘Oitol’ and an open-field-optimized ‘Joker’. Experimental conditions were set to simulate commercial cultivation practices as much as possible. A nutrient solution was used for flooding the root system, perlite was used as the medium, and no precautions were taken against oxygen diffusion through the surface into the nutrient solution.

The waterlogging treatment imposed a slow decrease in the dissolved oxygen levels in the media, down to approximately 2 mg L⁻¹ (Figure 1B). A reason for the slow depletion of dissolved oxygen could be the use of perlite as a solid growth medium. The air content of perlite may have buffered the reduced external supply of oxygen to the roots, and thus the oxygen content of the media did not decrease as quickly as expected (Figure 1B). The diffusion of air through the surface of the liquid media may also have contributed to oxygen replenishment. A slow build-up of hypoxia and the high nutrient level of the media may have allowed for the acclimation of the WL treated plants. Acclimation to WL conditions has already been noticed in cucumbers [19]. The above factors alone or in combination are proposed to explain the lack of growth delay in ‘Joker’ and the growth response of ‘Oitol’ plants under WL treatment.

Redox parameters indicated that no major oxidative stress was to be experienced by the plants (see the MDA content of leaves in Figure 2A). A lower basal level of MDA in ‘Oitol’ leaves may be the consequence of the higher antioxidant capacity present in this hybrid, as revealed in an earlier study [20]. MDA levels decreased in both hybrids due to the WL treatment, indicating an increased antioxidant defense, which can be linked to the acclimation processes. Redox alterations showed no interplay with guaiacol peroxidase activity, which retained the characteristic difference described earlier for the same hybrids [20], not changing significantly under the applied WL treatment. Such a sustained redox balance upon WL has been reported in response to an elevated nutrient (especially nitrogen) supply in several cases [21].

By the second week of treatment, the oxygen levels of the media clearly indicated hypoxic conditions around the root systems of the plants. This manifested in the induction of root ADH activity in both hybrids. A predominant role of ADH in fermentation processes in WL-induced hypoxia in cucumbers has been well-documented [22]. Less ADH activity of ‘Oitol’ roots indicated a smaller need for fermentation in this hybrid. In the hypoxia-sensing pathway, the cysteine oxidases performed key modifications of the ERF-VII transcription factors, regulating their actions towards the induction of genes responsible for hypoxia tolerance [23]. On the other hand, cysteine oxidases themselves were regulated by the same transcription factors [24]. Therefore, we used cucumber cysteine oxidases as genetic markers for the estimation of the extent of hypoxia sensed in the roots. Cysteine oxidases were upregulated in both hybrids. CysOx1 and CysOx4 genes were induced to a high degree, exclusively in ‘Joker’, rather than in ‘Oitol’ roots. These two genes are therefore suggested as genetic markers for hypoxia in cucumber. CysOx2 and CysOx3 were upregulated in both genotypes, reaching higher expression levels in ‘Joker’. A higher induction of ADH enzyme activity and elevated CysOx genes’ expression indicated that ‘Joker’ roots suffered more hypoxia, while ‘Oitol’ tolerated the stress more efficiently.

Despite the low DOI values in media and the clear hypoxia-responsive indicators in the roots of both hybrids, no growth delay was experienced in either hybrid. The lack of growth inhibition by WL can be explained by the acclimation process implicated above, and due to the slow build-up of hypoxia and high nutrient levels of media in our treatment. A high nutrient supply may mitigate the WL stress, as reviewed by Manik et al. [25].

While the shoot growth of ‘Joker’ plants did not change when compared to the controls, a growth-promoting effect was observed for ‘Oitol’ plants in response to two weeks of WL treatment with a nutrient solution. This accelerated growth response of ‘Oitol’ under WL conditions was particularly striking. The enhanced shoot growth manifested more in the canopy elongation, as the increase in leaf dry weight did not reach a significant level, while the leaf surface area did. This might look similar to the low oxygen escape syndrome reported in rice plants [26], but here the induction of growth was apparently facilitated by efficient hypoxia-avoidance mechanisms. The observed extra growth could also be linked to the more frequent adventitious root (AR) development in the ‘Oitol’ hybrid. AR formation had already occurred in the absence of stress treatment, and increased significantly in response to WL. Plants form ARs to avoid root hypoxia as much as possible in response to WL stress. [27]. AR formation is a trait for WL tolerance in several plant species, and has been reported to be cultivar-specific in some cases [28,29]. The importance of ARs in the WL tolerance of crops has been well established [30]. In the course of our studies, it was shown that frequent AR formation coincided with a restrained induction of ADH activity in the WL-stressed ‘Oitol’ roots. This corresponds well with the proposed role of ARs in the oxygen supply. By alleviating hypoxic stress, AR formation was implicated as a prominent trait that may have supported the accelerated growth of the greenhouse-optimized hybrid ‘Oitol’ under WL conditions. It is suggested that the other studied greenhouse varieties may also gain extra growth potential through the internal aeration of the root system through ARs when cultivated under their typical conditions. In addition to ARs as a major trait, some other potential factors of WL tolerance, such as the suberin/lignin barrier and tissue porosity in roots, need further investigation in our system. Although aerenchyma formation has not been unequivocally detected in cucumber plants, schizogenous tissue development in the cortex may increase the root aeration, as was sporadically reported for this species [31]. These additional factors deserve further investigation.

5. Conclusions

Cucumber (Cucumis sativus L.) F1 varieties of greenhouse and open-field types were subjected for a differential waterlogging (WL) tolerance evaluation. Hypoxic conditions were created for the roots as a result of flooding with nutrient solution, and this was confirmed by the dropped oxygen level in the root zone of the studied plants. The applied WL did not cause significant delay in terms of plant canopy or biomass production. An improved performance was even recorded in the greenhouse type F1 hybrid, as reflected in the obtained total leaf area as well as the fresh and dry weights after the application of the two-week long waterlogging treatment. A significantly higher rate of adventitious roots’ (ARs) formation was found as part of the observed adaptation response, which was more pronounced in the greenhouse variety. Such a high AR development rate was also evident in a cultivation-type-specific manner amongst six studied varieties in normal growth conditions. In the roots of the greenhouse type hybrid ‘Oitol’, the ADH activity was only moderately induced, probably due to AR-based alleviation of hypoxia. A less pronounced induction of cysteine oxidase (CysOx) genes, the known components of the hypoxia sensing pathway, also indicated the smaller extent of hypoxic stress in roots of the greenhouse type (‘Oitol’) plants. The observed connection of traits such as growth parameters and AR formation, as well as biochemical and genetic markers of root hypoxia between WL-stressed hybrids of different cultivation types of a single species, could be considered as a novel opportunity to better investigate the molecular mechanisms of stress response and adaptation physiology in plants.