Baseline Sensitivity and Resistance of Botrytis cinerea to Penthiopyrad in Hebei Province, China

Abstract

Tomato gray mold (TGM), caused by Botrytis cinerea, is a destructive disease of greenhouse tomatoes. Its control mainly depends on the application of chemical fungicides. In China, penthiopyrad has been registered for the management of TGM for about 3 years. In this study, the baseline sensitivity of B. cinerea to penthiopyrad was measured based on mycelial growth and spore germination, using 131 wild isolates collected from Hebei Province. The mean EC₅₀ values 1.054 ± 0.633 mg/L (on mycelial growth) and 0.101 ± 0.037 mg/L (on conidia germination) were used as the baseline sensitivity. Isolates (187) of B. cinerea, sampled from eight regions in Hebei province during 2021 and 2022, were used for resistance studies by mycelial growth method. Based on the resistance factor, these isolates were considered: sensitive (=65 isolates), low (=39 isolates), moderate (=38 isolates), and high (=45 isolates) resistance. All 15 isolates from Raoyang were sensitive to penthiopyrad. Four mutation types in the sdhB subunit, namely H272R, N230I, P225F, and P225L, were associated with the resistance to penthiopyrad. A positive cross-resistance was also recorded between penthiopyrad and fluopyram, boscalid, or pydiflumetofen. These results provide useful information on the chemical control of TGM.

1. Introduction

Tomato gray mold (TGM), caused by Botrytis cinerea (anamorph of Botryotinia fuckeliana), is a destructive disease affecting tomato that usually occurs during winter and spring in greenhouses [1]. TGM often causes significant yield loss. Due to the lack of disease-resistant varieties, the control of TGM greatly depends on the application of chemical fungicides. Most of these fungicides show a single-site mode of action, such as benzimidazoles, N-phenylcarbamates, anilinopyrimidines and so on [2,3]. However, B. cinerea is a “high-risk” pathogenic fungus. With the long-term and frequent application of single-site mode of action fungicides, the occurrence of fungicide resistance in field populations of B. cinerea to many fungicides (i.e., carbendazim, iprodione, and boscalid) has been reported in many countries [1,2,3,4,5].

Penthiopyrad [1-methyl-N-[2-(4-methylpentan-2-yl)-3-thienyl]-3-(tr-ifluoromethyl) pyrazole-4-carboxamide] developed by Mitsui Chemical, Inc., is a novel succinate dehydrogenase inhibitor (SDHI) fungicide [6]. SDHI fungicides play an important role in the control of crop diseases. Several SDHI fungicides (i.e., boscalid, fluopyram, Fluxapyroxad, and pydiflumetofen) have been registered for the control of gray mold. However, SDHIs are rated as fungicides at medium to high risk of resistance by the Fungicide Resistance Action Committee (FRAC, http://www.frac.info (accessed on 5 June 2022)). Field resistance to these fungicides have been reported in multiple pathogens [7,8,9]. Therefore, in many countries, the use of most of them has been revoked or is restricted due to anti-resistance strategies [10].

The antifungal activity of SDHI fungicides occurs by interfering with fungal respiration in complex II of the cytochrome system and the energy generation process. The complex II consists of four nucleus-encoded sub-units: SDHA (flavoprotein), SDHB (iron-sulphur protein), SDHC (cytochrome b), and SDHD (CybS protein) [11]. In most cases, point mutations in the SDH genes that result in altered amino acid sequences at the fungicide binding site have been associated with SDHI resistance. In previous studies, the B. cinerea isolates carrying the mutations at amino acids 225 (P225F/T/L), 230 (N230I), and 272 (H272 L/R/Y) in the SdhB subunit were associated with less sensitivity to SDHIs, and the isolates with different mutants display different degrees of resistance to SDHI fungicides [12,13]. The Fusarium graminearum with the point mutants SdhB^H248Y/R exhibit decreased sensitivity to pydiflumetofen [14]. In the sensitive and low-resistance isolates of B. cinerea to boscalid, four simultaneous dependent mutations in the sdhC subunit (G85A, I93V, M158V, and V168I) were detected [15].

In China, penthiopyrad had been registered for the control of TGM since 2019. SDHI fungicides such as fluopyram and boscalid have been widely used to manage TGM for years. B. cinerea has developed resistance to SDHI fungicides in the field [15,16]. However, there has not been any reports on B. cinerea resistant to penthiopyrad in Hebei Province, China.

Thus, the purposes of this study were to establish the sensitivity baseline of B. cinerea to penthiopyrad, detect the resistance frequency of B. cinerea to penthiopyrad in Hebei Province, analyze sdhA, sdhB, sdhC, and sdhD mutation types, and clarify the cross-resistance relationships between penthiopyrad and three other SDHI fungicides.

2. Materials and Methods

2.1. Fungal Isolates

B. cinerea isolates were obtained from fruits or leaves of cropped tomatoes affected by gray mold taken from seven cities of Hebei Province, in China. After isolation, performed using a previous method [3], isolates were identified by morphological characteristics and stored on potato dextrose agar (PDA; fresh potato 200 g, 100 dextrose 20 g and agar 13 g per litre of distilled water) slants at 4 °C. To establish baseline sensitivity, 131 B. cinerea isolates were used (Table S1). All these isolates were sampled from seven different cities (at least two regions per city), where penthiopyrad and other SDHI fungicides were not used, during 2015–2017 following three cropping periods.

In 2021 and 2022 tomato growth periods, 187 B. cinerea isolates were sampled from tomatoes of the commercial greenhouses in Hebei Province (8 regions of 7 cities) that received 1–5 treatments with SDHI fungicides (boscalid, fluopyram, etc) per cropping period (Table S2).

2.2. Fungicides

Penthiopyrad (available ingredient 98%) was purified from 20% penthiopyrad SC. Penthiopyrad suspension agent was a commercial product. Boscalid (96%), pydiflumetofen (98%) and fluopyram (96%) were provided by BASF Plant Protection (Jiangsu) Co. Ltd. (Nantong, China), Syngenta Nantong Crop Protection Co., Ltd. (Nantong, China), and Bayer Crop Science (China) Co., Ltd. (Hangzhou, China), respectively. To make 10 g/L stock solutions, penthiopyrad (98%), boscalid (96%), and fluopyram (96%) were dissolved in acetone, while pydiflumetofen (98%) was dissolved in methanol. All stock solutions were stored at 4 °C, in the dark. The final concentration of acetone or methanol never exceeded 0.1%.

2.3. Baseline-Sensitivity of B. cinerea to Penthiopyrad

The baseline sensitivity to penthiopyrad of 131 isolates was determined by mycelial growth [2] and conidia germination inhibition analysis, in vitro [17].

2.3.1. Mycelial Radial Growth Assay

Briefly, mycelial plugs (5 mm diameter) from a pre-grown culture of B. cinerea isolates were transferred to the center of PDA amended with 0, 0.05, 0.1, 0.5, 1, 5 and 10 mg/L of penthiopyrad [2]. There were three replicates for every concentration and the experiment was repeated. All plates were cultured at 24 °C for 3 d in the dark, and then the diameters of the colonies were measured. The growth inhibition and EC₅₀ value (the median effective concentration) were calculated following a previous method [18].

2.3.2. Conidia Germination Test

Briefly, after culturing on PDA plates for about 8–10 d at 24 °C, in the dark, the conidia were collected by washing with sterile water and adjusted to a concentration of 10⁵ conidia/mL by sterile water. Sixty microliters of this suspension was spread onto WA (water agar; agar 13 g per liter of distilled water) plates amended with 0, 0.005, 0.01, 0.05, 0.1, 0.5, 1, and 5 mg/L penthiopyrad, respectively. For each concentration, there were three replicates, and the experiment was repeated. The conidia germination was observed by the microscope; conidia were thought to be germinated if the length of the germ tube was more than 50% of the conidial length. For each plate, 100 conidia were analyzed for germination rate (% germination = (the number of germinated conidium/total of 100 conidia × 100)). The EC₅₀ of penthiopyrad to each isolate was calculated [18].

2.4. Detection of B. cinerea Resistance to Penthiopyrad

As described above, the resistance to penthiopyrad of the 187 isolates sampled from tomato plants affected by gray mold and treated with SDHI fungicides cropped in eight regions of Hebei Province (China) in 2021 and 2022 was determined by mycelial growth assay on PDA plates, amended with penthiopyrad at concentrations of 0, 0.5, 1, 5, 10, 50, and 100 mg/L. The resistance levels were classified by Resistance Factor (RF: the EC₅₀ value of the isolate/baseline-sensitivity of B. cinerea to penthiopyrad) [19]. If RF < 10, the isolate was considered sensitive (S) to penthiopyrad, 10 ≤ RF < 50 indicated low resistance (LR) to penthiopyrad, 50 ≤ RF < 100 represented moderate resistance (MR) to penthiopyrad, and RF > 100 indicated high resistance (HR) to penthiopyrad [19,20].

2.5. Sequencing of the sdhA, sdhB, sdhC and sdhD Genes

To clarify the mutation types of B. cinerea isolates according to resistance levels to penthiopyrad, the four sdh genes of 40 randomly selected isolates (3 S, 14 LR, 8 MR, and 15 HR) were sequenced. Genomic DNA of these 40 isolates was extracted from the mycelium using a DNA Extraction Kit (CW0531S, Beijing ComWin Biotech Co., Ltd. Beijing, China). To amplify the entire sequence of sdhA, sdhB, sdhC, and sdhD genes, the primers and annealing temperature used are presented in

Table 1. Primers used for this study.

Taget Gene	Primers	Sequence (5′→3′)	Amplicon Size (bp)	Annealing Temperature/°C
SdhA	SdhA-F SdhA-R	CTTCGCAATTGAAGATTTGGAAACGC ATCCATGCCCCTTTCGTGTCT	2609	56
SdhB	SdhB-F SdhB-R	ACCTACTCGCCCTATCCAAT AGACTTAGCAATAACCGCCC	1004	54
SdhC	SdhC-F SdhC-R	GCCAGATTTCCTTAGTCAG GCTGGACTCTGAATGTGAT	1065	52
SdhD	SdhD-F SdhD-R	ATGGCTTCATTCATCAAACCATC TTATGCGCGCCAAATTCTTTTG	650	56

. A 50 μL PCR reaction mixture contained 2 μL of DNA template, 25 µL 2 × Es Taq Master Mix (CW0690M, CWBIO, containing Es Taq DNA Polymerase, 3 mM MgCl₂, and 400 µM each of dNTP), 1 μL of each primer, and 22 μL of ddH₂O. The PCR amplification procedure was as follows: pre-denaturation at 94 °C for 2 min, 35 cycles at 94 °C for 30 s, 52~57 °C (annealing temperature) for 30 s, and 72 °C for 30 s, elongation step at 72 °C for 5 min. The PCR products were separated by electrophoresis using 1% agarose gel, purified using a Quick Gel extraction kit (Beijing TransGen Biotech Co., Ltd., Beijing, China), then connected to a cloning vector using a Cloning Kit (pEASY-T3 produced by Beijing TransGen Biotech Co., Ltd., Beijing, China), and sequenced by BGI (Beijing, China).

2.6. Correlation between Penthiopyrad and Three Other SDHI Fungicides

To understand the cross-resistance relationship between penthiopyrad and three other SDHI fungicides, 15 isolates with different mutation types of the gene sdhB were studied. The EC₅₀ values of SDHI fungicides such as penthiopyrad, boscalid, pydiflumetofen and fluopyram were measured by mycelial growth assay on PDA, containing a series concentration of SDHI fungicides (0, 1, 5,10, 50, 100 and 500 mg/L for isolates with mutations of sdhB or 0, 0.05, 0.1, 0.5, 1, 5, and 10 mg/L for isolates with no mutations of sdhB). The cross-resistance relationship between penthiopyrad and three other SDHI fungicides was analyzed by a previous method [21].

2.7. Statistical Analysis

The data were analyzed by software SPSS 17.0 (SPSS Inc. in Chicago, IL, USA). Fisher’s least significant difference method (LSD) was used to evaluate the significant difference between the treatments (p = 0.05) [21]. To reveal the cross-resistance patterns between penthiopyrad and three other SDHI fungicides, the individual Lg EC₅₀ values of penthiopyrad were regressed against the Lg EC₅₀ values of other SDHI fungicides, respectively, and the Spearman correlation analysis was used to assess the correlations between penthiopyrad and the other three SDHI fungicides.

3. Results

3.1. Sensitivity Baseline of B. cinerea to Penthiopyrad

3.1.1. On Mycelial Growth

Penthiopyrad exhibited a high inhibitory activity against the mycelial growth of B. cinerea (Figure 1). The EC₅₀ values of penthiopyrad against B. cinerea collected from the same area were varied, with a variation factor (the highest EC₅₀ value/the lowest EC₅₀ value) of 6.91 on mycelial growth (

Table 2. Sensitivity baseline to penthiopyrad of 131 Botrytis cinerea isolates sampled from tomato plants affected by gray mold cropped in Hebei Province (China) during 2015–2017 without SDHI fungicide application.

Region	Number of Isolates	EC50 (mg/L) a
		Mycelial Growth		Conidia Germination
		Range	Mean ± SD b	Range	Mean ± SD b
Handan	21	0.090~2.456	1.098 ± 0.581 a	0.055~0.154	0.098 ± 0.028 a
Xingtai	18	0.301~2.080	0.944 ± 0.480 a	0.051~0.128	0.101 ± 0.035 a
Shijiazhuang	20	0.128~1.892	1.024 ± 0.595 a	0.053~0.168	0.107 ± 0.036 a
Baoding	26	0.069~2.550	1.128 ± 0.835 a	0.034~0.142	0.107 ± 0.034 a
Cangzhou	16	0.080~2.536	0.893 ± 0.543 a	0.045~0.128	0.090 ± 0.025 a
Hengshui	13	0.039~2.088	1.000 ± 0.506 a	0.013~0.186	0.098 ± 0.047 a
Qinhuangdao	17	0.071~2.134	1.176 ± 0.758 a	0.039~0.286	0.098 ± 0.053 a
Total	131	0.039~2.550	1.054 ± 0.633	0.013~0.286	0.101 ± 0.037

^a EC₅₀ = the fungicide concentrations required to obtain a 50% inhibition of mycelial growth on potato dextrose agar or conidia germination on water agar media. ^b Data are the means of EC₅₀ values ± standard deviation (SD). Values accompanied by the same letters are not significantly different (p = 0.05) according to Fisher’s LSD test.

). The average EC₅₀ values of penthiopyrad for the tested isolates sampled from each area were very similar. There was no significant difference in the average EC₅₀ value among the seven different cities. The EC₅₀ values of 131 isolates to penthiopyrad ranged from 0.039 to 2.550 mg/L and their mean value was 1.054 ± 0.633 mg/L. The EC₅₀ values frequency distribution of these tested isolates was a continuous unimodal curve (Figure 2) and the variation factor was 65.4.

3.1.2. On Conidia Germination

Penthiopyrad also exhibited a high inhibitory activity against the conidia germination of B. cinerea. The EC₅₀ values of penthiopyrad against B. cinerea isolates sampled from the same area were varied, with a minimum variation factor of 2.51 on conidia germination (Table 2). However, the mean EC₅₀ values of penthiopyrad for B. cinerea isolates sampled from seven different cities were similar. This means that there were no significant differences in the average EC₅₀ values among the seven different cities. The EC₅₀ values of 131 isolates to penthiopyrad ranged from 0.013 to 0.286 mg/L and their mean value was 0.101 ± 0.037 mg/L. The frequency distribution of the EC₅₀ values for these tested isolates was a continuous unimodal curve (Figure 2) and the variation factor was 22.0.

3.2. Resistance of B. cinerea to Penthiopyrad

A total of 187 B. cinerea isolates collected from eight different regions of Hebei Province had developed obvious resistance to penthiopyrad, except Raoyang (

Table 3. Resistance level (S = sensitive; LR = low resistance, MR = moderate resistance, or HR = high resistance) to penthiopyrad of 187 Botrytis cinerea isolates sampled from tomato plants affected by gray mold and treated with SDHI fungicides cropped in eight regions of Hebei Province (China), during 2021–2022.

Region	Number of Isolates	Isolate/Percentage of the Total Population/%
		S	LR	MR	HR
Dingxing, Baoding	32	24 (75.0)	7 (21.9)	1 (3.1)	0 (0.0)
Xushui, Baoding	18	14 (77.8)	4 (22.2)	0 (0.0)	0 (0.0)
Weichang, chengde	18	10 (55.6)	7 (38.9)	1 (5.6)	0 (0.0)
Feixiang, Handan	24	0 (0.0)	4 (16.7)	12 (50)	8 (33.3)
Raoyang, Hengshui	15	15 (100.0)	0 (0.0)	0 (0.0)	0 (0.0)
Gaoyi, Shijiazhuang	19	2 (10.5)	6 (31.6)	4 (21.1)	7 (36.8)
Kaiping, Tangshan	27	0 (0.0)	4 (14.8)	6 (22.2)	17 (63.0)
Guangzong, Xingtai	34	0 (0.0)	9 (26.5)	13 (38.2)	12 (35.3)
Total	187	65 (34.8)	39 (20.9)	38 (20.3)	45 (24.1)

). Based on the resistance factor, isolates with low resistance (=39 isolates), moderate resistance (=38 isolates) and high resistance (=45 isolates) were detected in the field. The resistance frequency to penthiopyrad was up to 100% in Feixiang, Kaiping and Guangzong, where SDHI fungicides are frequently applied at least five times per season. No high-resistance isolates were detected in Dingxing and Weichang and only low-resistance isolates were detected in Xushui.

3.3. Sequence Variation of the sdhA, sdhB, sdhC, and sdhD Genes

Four mutations of the gene sdhB (N230I, H272R, P225F, and P225L) were detected in the resistance isolates of B. cinerea to penthiopyrad (Figure S1). N230I mutations isolates exhibited low to high resistance levels to penthiopyrad; the P225F or P225L mutations showed low resistance levels; and the H272R mutations exhibited low or high resistance levels to penthiopyrad (

Table 4. Point mutation types of four sdh genes detected in 40 B.cinerea isolates with different resistance levels (S = sensitive; LR = low resistance, MR = moderate resistance, or HR = high resistance) to penthiopyrad.

Name of Isolates c	Phenotype	Mutation Type
		sdhA	sdhB	sdhC	sdhD
21BDDM6, 21CDCYW16	S	-	-	-	-
21CDLQ18	S	-	-	G85A, I93V, M158V, V168I	-
21CDCYW13, 21TS8, 21TS15, 21TS17, 21XTG17, 21XTG19	LR	-	N230I	-	-
21HDFH4, 21HDFH6, 21HDFH7, 21HDFH8, 21HDFH9, 21HDFH11, 21HDFH12, 21TS6	MR	-	N230I	-	-
21HDFH5, 21HDFH10, 21HDFH13, 21TS7, 21TS9, 21TS10, 21TS11, 21TS12, 21TS13, 21TS14, 21TS16, 21TS18, 21TS19, 21TS20	HR	-	N230I	-	-
21BDKG9, 21BDHE1	LR	-	H272R	-	-
21HDH1	HR	-	H272R	-	-
21BDL10, 21XTG29, 21XTG28	LR	-	P225F	-	-
21HDFH14, 21BDXS1, 21HDFH18	LR	-	P225L	-	-

^c: The 40 isolates sampled from tomato plants affected by gray mold and treated with SDHI fungicides cropped in Hebei Province (China), in 2021 and 2022.

).

For the gene sdhC, four concurrent mutations were only observed in the sensitive isolate 21CDLQ18 (Figure S2); the mutants with glycine changed to alanine at position 85 (G85A), isoleucine changed to valine at position 93 (I93V), methionine to valine at position 158 (M158V) and valine to isoleucine at position 168 (V168I) (Table 4). For sdhA and sdhD genes, no mutations were observed in this study.

3.4. Correlation between Penthiopyrad and Other Botryticides

The EC₅₀ values of penthiopyrad, boscalid, fluopyram, and pydiflumetofen were tested by mycelial growth method (

Table 5. The EC₅₀ values of four SDHI fungicides against three B. cinerea isolates with no mutation and 12 isolates with four different mutations (H272R, P225F, P225L and N230I) of the gene sdhB.

Isolates	Mutation Types	EC50/(mg/L) e
		Penthiopyrad	Fluopyram	Pydiflumetofen	Boscalid
21BDDM6	- d	2.874 ± 1.217 e	1.140 ± 0.083 h	1.482 ± 0.463 ef	6.091 ± 1.715 c
21CDCYW16	-	1.582 ± 0.301 e	0.311 ± 0.025 h	0.491 ± 0.052 f	3.739 ± 2.182 c
21CDLQ18	-	0.210 ± 0.090 e	0.603 ± 0.108 h	0.099 ± 0.034 f	1.320 ± 0.188 c
21BDHE1	H272R	41.82 ± 6.31 de	79.15 ± 7.49 de	3.999 ± 0.153 def	938.26 ± 475.05 a
21HDH1	H272R	383.06 ± 43.19 b	152.45 ± 30.01 c	39.76 ± 4.75 a	>500 z
21BDKG9	H272R	15.00 ± 3.65 de	42.58 ± 8.54 efg	4.174 ± 0.250 cdef	>500 z
21BDL10	P225F	26.30 ± 2.97 de	79.70 ± 2.55 de	2.604 ± 0.579 def	255.99 ± 45.97 bc
21XTG28	P225F	37.99 ± 5.67 de	351.00 ± 39.30 a	5.064 ± 0.513 cdef	>500 z
21XTG29	P225F	43.92 ± 3.15 de	308.99 ± 38.70 b	13.19 ± 2.19 bc	>500 z
21HDFH14	P225L	30.41 ± 7.46 de	64.72 ± 16.13 def	33.49 ± 7.11 a	329.81 ± 87.59 bc
21HDFH18	P225L	38.88 ± 11.07 de	90.16 ± 9.40 d	5.96 ± 0.56 cdef	>500 z
21BDXS	P225L	35.69 ± 5.60 de	20.11 ± 2.22 gh	9.838 ± 1.072 bcde	356.82 ± 33.32 b
21TS12	N230I	488.31 ± 63.38 a	69.48 ± 5.82 def	18.65 ± 1.34 b	124.16 ± 5.31 bc
21TS16	N230I	164.83 ± 14.57 c	41.17 ± 10.68 fg	10.93 ± 4.92 bcd	70.50 ± 2.69 bc
21TS6	N230I	54.21 ± 12.85 d	41.46 ± 0.46 fg	2.625 ± 0.046 def	807.95 ± 66.67 a

^d: “-”: There was no mutation of the gene sdhB. ^e: Values accompanied by the same letters are not significantly different (p = 0.05) according to Fisher’s LSD test. ^z: These data were not included in the significant difference analysis.

). There was a decline in the sensitivity of B. cinerea isolates with mutations of the gene sdhB. There was a moderate correlation between penthiopyrad and three other SDHI fungicides (boscalid, fluopyram, and pydiflumetofen) (p < 0.05, ρ > 0.5) in the Spearman rank correlation analysis, indicating that there was positive cross-resistance between penthiopyrad and boscalid, fluopyram, or pydiflumetofen (Figure 3).

4. Discussion

The establishment of the sensitivity baseline is necessary in monitoring the changes in pathogen sensitivity to one fungicide, predicting the control efficacy of the fungicide and developing resistance management practices [9,22]. In this study, the EC₅₀ values of 131 B. cinerea isolates to penthiopyrad were detected on mycelial growth and conidial germination. The average EC₅₀ values of penthiopyrad against 131 B. cinerea isolates were 1.054 ± 0.633 mg/L (on mycelial growth) and 0.101 ± 0.037 mg/L (on conidial germination). All these 131 isolates were sampled from tomato plants affected by gray mold cropped in Hebei Province (China) during 2015–2017 without SDHI fungicide applications. The frequency distribution curve was a unimodal curve. This indicated no resistant subpopulations among the tested isolates [23]. Hence, these results can be used to monitor the changes in the sensitivity of B. cinerea to penthiopyrad, as a sensitivity baseline. The baseline sensitivity for conidial germination was significantly lower than that for mycelial growth. Similar results have been reported by predecessors in the sensitivity baseline of B. cinerea to boscalid, isopyrazam and pydiflumetofen [17,20,24]. These results can probably be interpreted as that the germination of conidia is highly demanding in energy in the fungal developmental stage [25].

B. cinerea has developed resistance to different kinds of fungicides. B. cinerea resistance to SDHI fungicides has been reported in multiple areas [15,16,26,27]. In the current study, the resistance isolates of B. cinerea to penthiopyrad were sampled from tomatoes from commercial greenhouses in Hebei Province and tested by the mycelial growth assay. The resistance frequency of B. cinerea isolates sampled from different regions of Hebei Province to penthiopyrad ranged from 0 to 100%. No sensitive isolates were detected in the isolates sampled from Feixiang, Guangzong and Kaiping. In these three regions, the SDHI fungicides (i.e., boscalid and fluopyram, except for penthiopyrad) were used at least five times per season. However, to our knowledge, penthiopyrad has been registered for the control of TGM for only about 3 years, and was not widely used in the sampling regions. All the B. cinerea isolates collected from Raoyang, where the SDHI fungicides were only applied once or twice per season, were sensitive to penthiopyrad. Therefore, it can be inferred that the development of resistance in B. cinerea to penthiopyrad was due to the long-term frequent application of SDHI fungicides such as boscalid and fluopyram.

Multiple mutation types have been reported in the sdhB, sdhC and sdhD subunit of the resistance isolates to SDHI fungicides in some pathogenic fungi [12,13,28,29,30]. In this study, four simultaneous dependent mutations in the gene of sdhC (G85A, I93V, M158V, and V168I) were only detected in the sensitive isolate to penthiopyrad. These four mutations have been reported in the sensitive and low-resistance isolates of B. cinerea to boscalid [15] and the B. cinerea isolates sampled from five hosts [31]. Therefore, we speculated that the resistance of B. cinerea to penthiopyrad may not be related to these four mutations.

For the SdhB gene, there were at least seven different mutations (P225F/T/L, N230I, and H272 L/R/Y) in resistant isolates of B. cinerea to SDHI fungicides [28,32]. B. cinerea isolates with different mutations exhibited different sensitivities to SDHI fungicides [32]. The isolates carrying the P225F mutation were resistant to fluopyram, boscalid, fluxapyroxad, and penthiopyrad [33]. The N230I mutants were moderately resistant to fluopyram, boscalid, and fluxapyroxad, but exhibited low resistance levels to isopyrazam. The H272R mutations were moderately resistant to boscalid, but retained their sensitivity to fluopyram and fluxapyroxad [32]. In the current study, the isolates with N230I mutations exhibited low to high levels of resistance to penthiopyrad, the P225F/L mutations showed low resistance levels, and the H272R mutations exhibited low or high resistance levels to penthiopyrad. All results are corresponding to those previously reported. Therefore, we speculated that these four mutations (P225F/L, N230I, H272R) of the gene of SdhB led to the resistance of B. cinerea to penthiopyrad.

This study found a positive cross-resistance between penthiopyrad and boscalid, fluopyram, or pydiflumetofen. In previous studies, positive cross-resistance was found to exist between fluopyram and boscalid or pydiflumetofen [20,34]. These reports were similar to the findings of this study. However, no cross-resistance between fluopyram and boscalid was reported by Veloukas et al. (2012) [35] or Liu et al. (2021) [15]. These distinctly different results may be caused by the tested B. cinerea isolates with different genetic backgrounds, or different resistance mechanisms to SDHI fungicides.

5. Conclusions

The baseline sensitivity of B. cinerea to penthiopyrad was established. Based on this baseline sensitivity and the resistance factor, isolates (187) of B. cinerea, sampled from eight regions in Hebei province during 2021 and 2022, had developed obvious resistance to penthiopyrad, except Raoyang. The resistance of B. cinerea to penthiopyrad was associated with four mutation types (P225F, P225L, N230I, and H272R) in the sdhB subunit. This study also found a positive cross-resistance between penthiopyrad and fluopyram, boscalid, or pydiflumetofen.

To control TGM and delay the development of resistance, penthiopyrad should be applied alternately or tank mixed with fungicides with different mechanisms of action. In addition, the application times of penthiopyrad should be limited in each growing season and it is advisable to apply it no more than twice per season.