Gene Expression in Zucchini Fruit Development
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials, Growing Conditions, and Treatments
2.2. Gene Selection, Sample Collection, and RNA Expression Analysis
2.3. Statistical Analysis
3. Results
3.1. Phenotyping of Genotypes and Treated-Fruits
3.2. Gene Expression in Non-Treated Samples
3.3. Gene Expression and Treatments
4. Discussion
4.1. Fruit Development Stages
4.2. Gene Expression Responses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A

Appendix B

References
- Paris, H.S. History of the Cultivar-Groups of Cucurbita Pepo. Hortic. Rev. 2001, 25, 71–170. [Google Scholar] [CrossRef] [Scilit]
- Pomares-Viciana, T.; Die, J.; Del Río-Celestino, M.; Román, B.; Gómez, P. Auxin Signalling Regulation during Induced and Parthenocarpic Fruit Set in Zucchini. Mol. Breed. 2017, 37, 56. [Google Scholar] [CrossRef] [Scilit]
- Nepi, M.; Cresti, L.; Guarnieri, M.; Pacini, E. Effect of Relative Humidity on Water Content, Viability and Carbohydrate Profile of Petunia Hybrida and Cucurbita Pepo Pollen. Plant Syst. Evol. 2010, 284, 57–64. [Google Scholar] [CrossRef] [Scilit]
- Gou, C.; Zhu, P.; Meng, Y.; Yang, F.; Xu, Y.; Xia, P.; Chen, J.; Li, J. Evaluation and Genetic Analysis of Parthenocarpic Germplasms in Cucumber. Genes 2022, 13, 225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martínez, C.; Manzano, S.; Megías, Z.; Garrido, D.; Picó, B.; Jamilena, M. Sources of Parthenocarpy for Zucchini Breeding: Relationship with Ethylene Production and Sensitivity. Euphytica 2014, 200, 349–362. [Google Scholar] [CrossRef] [Scilit]
- Pomares-Viciana, T.; Del Río-Celestino, M.; Román, B.; Die, J.; Pico, B.; Gómez, P. First RNA-Seq Approach to Study Fruit Set and Parthenocarpy in Zucchini (Cucurbita Pepo L.). BMC Plant Biol. 2019, 19, 61. [Google Scholar] [CrossRef] [Scilit]
- Gustafson, F.G. Parthenocarpy: Natural and Artificial. Bot. Rev. 1942, 8, 599–654. [Google Scholar] [CrossRef] [Scilit]
- Maroto, J.V.; Miguel, A.; Lopez-Galarza, S.; San Bautista, A.; Pascual, B.; Alagarda, J.; Guardiola, J.L. Parthenocarpic Fruit Set in Triploid Watermelon Induced by CPPUand 2,4-D Applications. Plant Growth Regul. 2005, 45, 209–213. [Google Scholar] [CrossRef] [Scilit]
- Bergamini, C.; Cardone, M.F.; Anaclerio, A.; Perniola, R.; Pichierri, A.; Genghi, R.; Alba, V.; Forleo, L.R.; Caputo, A.R.; Montemurro, C.; et al. Validation Assay of P3_VvAGL11 Marker in a Wide Range of Genetic Background for Early Selection of Stenospermocarpy in Vitis Vinifera L. Mol. Biotechnol. 2013, 54, 1021–1030. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, G.; Gu, H.; Zhao, Y.; Ma, Z.; Shi, G.; Yang, Y.; Pichersky, E.; Chen, H.; Liu, M.; Chen, Z.; et al. An Indole-3-Acetic Acid Carboxyl Methyltransferase Regulates Arabidopsis Leaf Development. Plant Cell 2005, 17, 2693–2704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, J.-J.; Luo, J. The PIN-FORMED Auxin Efflux Carriers in Plants. IJMS 2018, 19, 2759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mravec, J.; Skůpa, P.; Bailly, A.; Hoyerová, K.; Křeček, P.; Bielach, A.; Petrášek, J.; Zhang, J.; Gaykova, V.; Stierhof, Y.-D.; et al. Subcellular Homeostasis of Phytohormone Auxin Is Mediated by the ER-Localized PIN5 Transporter. Nature 2009, 459, 1136–1140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meijer, M.; Murray, J.A.H. The Role and Regulation of D-Type Cyclins in the Plant Cell Cycle. Plant Mol. Biol. 2000, 43, 77–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sozzani, R.; Cui, H.; Moreno-Risueno, M.A.; Busch, W.; Van Norman, J.M.; Vernoux, T.; Brady, S.M.; Dewitte, W.; Murray, J.A.H.; Benfey, P.N. Spatiotemporal Regulation of Cell-Cycle Genes by SHORTROOT Links Patterning and Growth. Nature 2010, 466, 128–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marowa, P.; Ding, A.; Kong, Y. Expansins: Roles in Plant Growth and Potential Applications in Crop Improvement. Plant Cell Rep. 2016, 35, 949–965. [Google Scholar] [CrossRef] [Scilit]
- Cosgrove, D.J. Plant Expansins: Diversity and Interactions with Plant Cell Walls. Curr. Opin. Plant Biol. 2015, 25, 162–172. [Google Scholar] [CrossRef] [Scilit]
- Obrero, Á.; Die, J.V.; Román, B.; Gómez, P.; Nadal, S.; González-Verdejo, C.I. Selection of Reference Genes for Gene Expression Studies in Zucchini (Cucurbita Pepo) Using QPCR. J. Agric. Food Chem. 2011, 59, 5402–5411. [Google Scholar] [CrossRef] [Scilit]
- Hellemans, J.; Mortier, G.; Paepe, A.D.; Speleman, F.; Vandesompele, J. QBase Relative Quantification Framework and Software for Management and Automated Analysis of Real-Time Quantitative PCR Data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef] [Scilit]
- Gillaspy, G.; Ben-David, H.; Gruissem’, W. Fruits: A Developmental Perspective. Plant Cell 1993, 5, 1439–1451. [Google Scholar] [CrossRef] [Scilit]
- Nepi, M.; Pacini, E. Pollination, Pollen Viability and Pistil Receptivity in Cucurbita Pepo. Ann. Bot. 1993, 72, 527–536. [Google Scholar] [CrossRef] [Scilit]
- Serrani, J.C.; Ruiz-Rivero, O.; Fos, M.; García-Martínez, J.L. Auxin-Induced Fruit-Set in Tomato Is Mediated in Part by Gibberellins. Plant J. 2008, 56, 922–934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ando, K.; Carr, K.M.; Grumet, R. Transcriptome Analyses of Early Cucumber Fruit Growth Identifies Distinct Gene Modules Associated with Phases of Development. BMC Genom. 2012, 13, 518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liscum, E.; Reed, J.W. Genetics of Aux/IAA and ARF Action in Plant Growth and Development. Plant Mol. Biol. 2002, 49, 387–400. [Google Scholar] [CrossRef] [Scilit]
- Abel, S.; Nguyen, M.D.; Theologis, A. ThePS-IAA4/5-like Family of Early Auxin-Inducible MRNAs InArabidopsis Thaliana. J. Mol. Biol. 1995, 251, 533–549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mapelli, S. Changes in Cytokinin in the Fruits of Parthenocarpic and Normal Tomatoes. Plant Sci. Lett. 1981, 22, 227–233. [Google Scholar] [CrossRef] [Scilit]
- Vriezen, W.H.; Feron, R.; Maretto, F.; Keijman, J.; Mariani, C. Changes in Tomato Ovary Transcriptome Demonstrate Complex Hormonal Regulation of Fruit Set. New Phytol. 2008, 177, 60–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- An, H.; Zhang, J.; Xu, F.; Jiang, S.; Zhang, X. Transcriptomic Profiling and Discovery of Key Genes Involved in Adventitious Root Formation from Green Cuttings of Highbush Blueberry (Vaccinium Corymbosum L.). BMC Plant Biol. 2020, 20, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kou, X.; Zhao, X.; Wu, B.; Wang, C.; Wu, C.; Yang, S.; Zhou, J.; Xue, Z. Auxin Response Factors Are Ubiquitous in Plant Growth and Development, and Involved in Crosstalk between Plant Hormones: A Review. Appl. Sci. 2022, 12, 1360. [Google Scholar] [CrossRef] [Scilit]
- Choi, D.; Lee, Y.; Cho, H.-T.; Kende, H. Regulation of Expansin Gene Expression Affects Growth and Development in Transgenic Rice Plants. Plant Cell 2003, 15, 1386–1398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lü, P.; Kang, M.; Jiang, X.; Dai, F.; Gao, J.; Zhang, C. RhEXPA4, a Rose Expansin Gene, Modulates Leaf Growth and Confers Drought and Salt Tolerance to Arabidopsis. Planta 2013, 237, 1547–1559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Won, S.-K.; Choi, S.-B.; Kumari, S.; Cho, M.; Lee, S.H.; Cho, H.-T. Root Hair-Specific EXPANSIN B Genes Have Been Selected for Graminaceae Root Hairs. Mol. Cells 2010, 30, 369–376. [Google Scholar] [CrossRef] [Scilit]
- Kwon, Y.R.; Lee, H.J.; Kim, K.H.; Hong, S.-W.; Lee, S.J.; Lee, H. Ectopic Expression of Expansin3 or Expansinβ1 Causes Enhanced Hormone and Salt Stress Sensitivity in Arabidopsis. Biotechnol. Lett. 2008, 30, 1281–1288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cockcroft, C.E.; den Boer, B.G.W.; Healy, J.M.S.; Murray, J.A.H. Cyclin D Control of Growth Rate in Plants. Nature 2000, 405, 575–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, L.; Li, J.; Zhang, T.; Guo, Q.; Xu, J.; Lou, Q.; Chen, J. Identification and Expression Analysis of D-Type Cyclin Genes in Early Developing Fruit of Cucumber (Cucumis Sativus L.). Plant Mol. Biol. Rep. 2014, 32, 209–218. [Google Scholar] [CrossRef] [Scilit]
- Baldazzi, V.; Bertin, N.; Génard, M. A Model of Fruit Growth Integrating Cell Division and Expansion Processes. Acta Hortic. 2012, 191–196. [Google Scholar] [CrossRef] [Scilit]




| Gene Name 1 | Target mRNA | Primer Sequence (5′-3′) | Size (pb) | Tm 2 (°C) | |
|---|---|---|---|---|---|
| CpAUX22 | XM_023693420.1 | GATCTTGCTGTTGCTCTTGAGAAG | CTTTGTCCTCGTAAATGGGAACG | 103 | 80.1 |
| CpCYCD6-1 | XM_023657092.1 | CAAACAGAGCACAATCTCTTCG | TCCCAAGATGAGAGATTCCATTC | 93 | 78.3 |
| CpEXPLB1 | XM_023698474.1 | GCGACTTTATAATGACCCGAAG | AATAACACCGAGGGCTAACAAA | 89 | 83.5 |
| CpIAA4 | XM_023671421.1 | AGGAACACCCTTCAATCAAAGA | GGAGAAGCTCAGGGTAACCTTTG | 140 | 82.4 |
| CpIAMT-1 | XM_023680319.1 | TTCCCGTGTATGCTCCTAGTTTG | TCGTCAGGCTGGTTCACTACTA | 124 | 80.5 |
| CpPIN5 | XM_023683116.1 | GGGAATCCCAACAATCTGTG | GGAGGGGCCATTAACTCTTC | 103 | 79.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ayala-Doñas, A.; de Cara-García, M.; Román, B.; Gómez, P. Gene Expression in Zucchini Fruit Development. Horticulturae 2022, 8, 306. https://doi.org/10.3390/horticulturae8040306
Ayala-Doñas A, de Cara-García M, Román B, Gómez P. Gene Expression in Zucchini Fruit Development. Horticulturae. 2022; 8(4):306. https://doi.org/10.3390/horticulturae8040306
Chicago/Turabian StyleAyala-Doñas, Alejandro, Miguel de Cara-García, Belén Román, and Pedro Gómez. 2022. "Gene Expression in Zucchini Fruit Development" Horticulturae 8, no. 4: 306. https://doi.org/10.3390/horticulturae8040306
APA StyleAyala-Doñas, A., de Cara-García, M., Román, B., & Gómez, P. (2022). Gene Expression in Zucchini Fruit Development. Horticulturae, 8(4), 306. https://doi.org/10.3390/horticulturae8040306

