Sucrose Enhances Anthocyanin Accumulation in Torenia by Promoting Expression of Anthocyanin Biosynthesis Genes
Abstract
1. Introduction
2. Materials and Methods
2.1. Effect of Sucrose on Anthocyanin Accumulation and Plant Growth
2.2. Analysis of Total Anthocyanin Content
2.3. RNA Extraction and Anthocyanin Biosynthesis Gene Expression Analysis
2.4. Statistical Analysis
3. Results
3.1. Sucrose-Induced Anthocyanin Accumulation in WT and Transgenic Plants
3.2. Sucrose Regulates Transcription of Anthocyanin Biosynthesis Genes
3.3. Effect of Sucrose on Plant Growth
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Naing, A.H.; Kim, C.K. Roles of R2R3-MYB transcription factors in transcriptional regulation of anthocyanin biosynthesis in horticultural plants. Plant Mol. Biol. 2018, 98, 1–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naing, A.H.; Kim, C.K. Abiotic stress-induced anthocyanins in plants: Their role in tolerance to abiotic stresses. Physiol. Plant. 2021, 172, 711–1723. [Google Scholar] [CrossRef] [Scilit]
- Koch, K.E. Carbohydrate-modulated gene expression in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1996, 47, 509–540. [Google Scholar] [CrossRef] [Scilit]
- Rolland, F.; Moore, B.; Sheen, J. Sugar sensing and signaling in plants. Plant Cell 2002, 14, S185–S205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gollop, R.; Even, S.; Colova-Tsolova, V.; Peri, A. Expression of the grape dihydroflavonol reductase gene and analysis of its promoter region. JexpBot 2002, 53, 1397–1409. [Google Scholar]
- Hara, M.; Oki, K.; Hoshino, K.; Kuboi, T. Enhancement of anthocyanin biosynthesis by sugar in radish (Raphanus sativus) hypocotyl. Plant Sci. 2003, 164, 259–265. [Google Scholar] [CrossRef] [Scilit]
- Hara, M.; Oki, K.; Hoshino, K.; Kuboi, T. Effects of sucrose on anthocyanin production in hypocotyl of two radish (Raphanus sativus) varieties. Plant Biotechnol. 2004, 21, 401–405. [Google Scholar] [CrossRef] [Scilit]
- Hossain, M.A.; Kim, S.; Kim, K.H.; Lee, S.J.; Lee, H. Flavonoid compounds are enriched in lemon balm (Melissa officinalis) leaves by a high level of sucrose and confer increased antioxidant activity. Hortscience 2009, 44, 1907–1913. [Google Scholar] [CrossRef] [Scilit]
- Momose, T.; Ozeki, Y. Erratum to: Regulatory effect of stems on sucrose-induced chlorophyll degradation and anthocyanin synthesis in Egeria densa leaves. J. Plant Res. 2013, 126, 869. [Google Scholar] [CrossRef] [Scilit]
- Nagira, Y.; Ozeki, Y. A system in which anthocyanin synthesis is induced in regenerated torenia shoots. J. Plant Res. 2004, 117, 377–383. [Google Scholar] [CrossRef] [Scilit]
- Ram, M.; Prasad, V.K.; Kaur, C.; Singh, K.S.; Arora, A.; Kumar, S. Induction of anthocyanin pigments in callus cultures of Rosa hybrida L. in response to sucrose and ammoniacal nitrogen levels. Plant Cell Tissue Organ Cult. 2011, 104, 171–179. [Google Scholar] [CrossRef] [Scilit]
- Solfanelli, C.; Poggi, A.; Loreti, E.; Alpi, A.; Perata, P. Sucrose specific induction of the anthocyanin biosynthetic pathway in Arabidopsis. Plant Physiol. 2006, 140, 637–646. [Google Scholar] [CrossRef] [Scilit]
- Su, N.; Wu, Q.; Cui, J. Increased Sucrose in the Hypocotyls of Radish Sprouts Contributes to Nitrogen Deficiency-Induced Anthocyanin Accumulation. Front. Plant Sci. 2016, 7, 1976. [Google Scholar] [CrossRef] [Scilit]
- Tsukaya, H.; Ohshima, T.; Naito, S.; Chino, M.; Komeda, Y. Sugar-dependent expression of the CHS-A gene for chalcone synthase from petunia in transgenic Arabidopsis. Plant Physiol. 1991, 97, 1414–1421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vitrac, X.; Larronde, F.; Krisa, S.; Decendit, A.; Deffieux, G.; Merillon, J.M. Sugar sensing and Ca2-calmodulin requirement in Vitis vinifera cells producing anthocyanins. Phytochem 2000, 53, 659–665. [Google Scholar] [CrossRef] [Scilit]
- Weiss, D. Regulation of flower pigmentation and growth: Multiple signaling pathways control anthocyanin synthesis in expanding petals. Physiol. Plant. 2000, 110, 152–157. [Google Scholar] [CrossRef] [Scilit]
- Teng, S.; Keurentjes, J.; Bentsink, L.; Koornneef, M.; Smeekens, S. Sucrose-specific induction of anthocyanin biosynthesis in Arabidopsis requires the MYB75/PAP1 gene. Plant Physiol. 2005, 139, 1840–1852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ai, T.N.; Naing, A.H.; Arun, M.; Lim, S.H.; Kim, C.K. Sucrose-induced anthocyanin accumulation in vegetative tissue of petunia plants requires anthocyanin regulatory transcription factors. Plant Sci. 2016, 252, 144–150. [Google Scholar] [CrossRef] [Scilit]
- Nagira, Y.; Ikegami, K.; Koshiba, T.; Ozeki, Y. Effect of ABA upon anthocyanin synthesis in regenerated Torenia shoots. J. Plant Res. 2006, 119, 137–144. [Google Scholar] [CrossRef] [Scilit]
- Junping, X.; Naing, A.H.; Kim, C.K. Transcriptional activation of anthocyanin structural genes in Torenia ‘Kauai Rose’via overexpression of anthocyanin regulatory transcription factors. 3 Biotech 2018, 8, 476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lea, U.S.; Slimestad, R.; Smedvig, P.; Lillo, C. Nitrogen deficiency enhances expression of specific MYB and bHLH transcription factors and accumulation of end products in the flavonoid pathway. Planta 2007, 225, 1245–1253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, Z.B.; Wang, Y.F.; Zhu, A.J.; Peng, F.L.; Wang, L.S. Exogenous sucrose can enhance tolerance of Arabidopsis thaliana seedlings to salt stress. Biol. Plant 2014, 58, 611–617. [Google Scholar] [CrossRef] [Scilit]
- Cu, H.; Jeong, J.C.; Kim, W.J.; Chung, D.M.; Jeon, H.K.; Ahn, Y.O.; Kim, S.H.; Lee, H.S.; Kwak, S.S.; Kim, Y. Expression of the sweet potato R2R3-type IbMYB1a gene induces anthocyanin accumulation in Arabidopsis. Physiol. Plant. 2013, 148, 189–199. [Google Scholar]
- Sasaki, K.; Yamaguchi, H.; Kasajima, I.; Narumi, T.; Ohtsubo, N. Generation of Novel Floral Traits Using a Combination of Floral Organ-Specific Promoters and a Chimeric Repressor in Torenia fournieri Lind. Plant Cell Physiol. 2016, 57, 1319–1331. [Google Scholar] [CrossRef] [Scilit]
- Payyavula, R.S.; Singh, R.K.; Navarre, D.A. Transcription factors, sucrose, and sucrose metabolic genes interact to regulate potato phenylpropanoid metabolism. J. Exp. Bot. 2013, 64, 5115–5131. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Tian, L.; Liu, H.; Pan, Q.; Zhan, J.; Huang, W. Sugars induce anthocyanin accumulation and flavanone 3-hydroxylase expression in grape berries. Plant Growth Regul. 2009, 58, 251–260. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.H.; Dewir, Y.S.; Hahn, E.J.; Paek, K.Y. Optimization of culturing conditions for the production of biomass and phenolics from adventitious roots of Echinacea angustifolia. J. Plant Biol. 2006, 49, 193–199. [Google Scholar] [CrossRef] [Scilit]
- Yoon, Y.J.; Murthy, H.N.; Hahn, E.J.; Peak, K.Y. Biomass production of Anoectichilus formosanus Hayata in a bioreactor system. J. Plant Biol. 2007, 50, 573–576. [Google Scholar] [CrossRef] [Scilit]
- Baque, M.A.; Shin, Y.K.; Elshmari, T.; Lee, E.J.; Paek, K.Y. Effect of light quality, sucrose and coconut water concentration on the microporpagation of Calanthe hybrids (‘Bukduseong’ × ‘Hyesung’ and ‘Chunkwang’ × ‘Hyesung’). AJCS 2011, 5, 1247–1254. [Google Scholar]
- Shim, S.W.; Hahn, E.J.; Paek, K.Y. In vitro and ex vitro growth of grapevine rootstock ‘5BB’ as influenced by number of air exchanges and the presence or absence of sucrose in culture media. Plant Cell Tissue Organ Cult. 2003, 75, 57–62. [Google Scholar] [CrossRef] [Scilit]





| Genes | Accession No. | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|---|
| TfCHS | AB548586.1 | TGAGCGAGTACGGGAACATG | TTCCTCATCTCGTCCAGTATGAAC |
| TfF3H | AB548588.1 | CGAGCAGTGGTGAACTCAAACA | TCTGGCGATGGGTTTTGG |
| TfDFR | AB548587.1 | TGGGATGCTTCCGACTTCTG | CAGTGGTTTCTGCCATTGCTT |
| TfANS | AB548583.1 | CCAAGGAGAAGATCGTGCTCA | CAATAAACTCCACCCATCACTCAAC |
| Tf3GT | AB548591.1 | CATTACACACTGCGGTTGGAA | CGGGACACCGCTGCAT |
| TfF3’5’H | AB548590.1 | CTGAACCTGCCTCGGATCTC | CCTCGTGCCCTTTGGTATGT |
| TfACT3 | AB330989.1 | TCCCAAAGCCAATCGTGAA | TTGCAGGAGCATTGAAGGTTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Naing, A.H.; Xu, J.; Park, K.I.; Chung, M.Y.; Kim, C.K. Sucrose Enhances Anthocyanin Accumulation in Torenia by Promoting Expression of Anthocyanin Biosynthesis Genes. Horticulturae 2021, 7, 219. https://doi.org/10.3390/horticulturae7080219
Naing AH, Xu J, Park KI, Chung MY, Kim CK. Sucrose Enhances Anthocyanin Accumulation in Torenia by Promoting Expression of Anthocyanin Biosynthesis Genes. Horticulturae. 2021; 7(8):219. https://doi.org/10.3390/horticulturae7080219
Chicago/Turabian StyleNaing, Aung Htay, Junping Xu, Kyeung Il Park, Mi Young Chung, and Chang Kil Kim. 2021. "Sucrose Enhances Anthocyanin Accumulation in Torenia by Promoting Expression of Anthocyanin Biosynthesis Genes" Horticulturae 7, no. 8: 219. https://doi.org/10.3390/horticulturae7080219
APA StyleNaing, A. H., Xu, J., Park, K. I., Chung, M. Y., & Kim, C. K. (2021). Sucrose Enhances Anthocyanin Accumulation in Torenia by Promoting Expression of Anthocyanin Biosynthesis Genes. Horticulturae, 7(8), 219. https://doi.org/10.3390/horticulturae7080219

