Candidate Gene, SmCPR1, Encoding CPR1 Related to Plant Height of the Eggplant Dwarf Mutant dwf
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Growth Conditions
2.2. Genetic Analysis
2.3. Candidate Gene Identification Using BSA-Seq
2.4. Verification of the Candidate SNP Genotype
2.5. Validation of Selected Genes Using Real-Time Quantitative Reverse Transcription PCR (qRT-PCR)
2.6. NADPH-Cytochrome P450 Reductase Activity Assay
2.7. Statistical Analysis
3. Results
3.1. Inheritance of the Dwarf Phenotype in dwf
3.2. Identification of a Candidate Gene by BSA
3.3. Effect of SmCRP Mutation on Enzyme Activity
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hedden, P. The genes of the green revolution. Trends Genet. 2003, 19, 5–9. [Google Scholar] [CrossRef]
- Peng, J.R.; Richards, D.E.; Hartley, N.M.; Murphy, G.P.; Devos, K.M.; Flintham, J.E.; Beales, J.; Fish, L.J.; Worland, A.J.; Pelica, F. ‘Green revolution’ genes encode mutant gibberellin response modulators. Nature 1999, 400, 256–261. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, A.; Ashikari, M.; Ueguchi-Tanaka, M.; Itoh, H.; Nishimura, A.; Swapan, D.; Ishiyama, K.; Saito, T.; Kobayashi, M.; Khush, G.S.; et al. A mutant gibberellin-synthesis gene in rice. Nature 2002, 416, 701–702. [Google Scholar] [CrossRef] [PubMed]
- Jin, X.J.; Sun, D.F.; Li, H.Y.; Sun, G.L. Characterization and molecular mapping of a dwarf mutant in wheat. Genet. Mol. Res. 2013, 12, 3555–3565. [Google Scholar] [CrossRef] [PubMed]
- Xu, T.; Bian, N.F.; Wen, M.M.; Xiao, J.; Yuan, C.X.; Cao, A.Z.; Zhang, S.Z.; Wang, X.E.; Wang, H.Y. Characterization of a common wheat (Triticum asetivum L.) high—tillering dwarf mutant. Theor. Appl. Genet. 2017, 130, 483–494. [Google Scholar] [CrossRef]
- Li, C.; Tang, J.; Hu, Z.Y.; Wang, J.W.; Yu, T.; Yi, H.Y.; Cao, M.Y. A novel maize dwarf mutant generated by Ty1-copia LTR- retrotransposon insertion in Brachytic2 after spaceflight. Plant Cell Rep. 2020, 39, 393–408. [Google Scholar] [CrossRef]
- Chen, Q.; Song, J.; Du, W.P.; Xu, L.Y.; Jiang, Y.; Zhang, J.; Xiang, X.L.; Yu, G.R. Identification and genetic mapping for rht-DM, a dominant dwarfing gene in mutant semi-dwarf maize using QTL-seq approach. Genes Genom. 2018, 40, 1091–1099. [Google Scholar] [CrossRef]
- Bae, K.-D.; Um, T.-Y.; Yang, W.-T.; Park, T.-H.; Hong, S.-Y.; Kim, K.-M.; Chung, Y.-S.; Yun, D.-J.; Kim, D.-H. Characterization of dwarf and narrow leaf (dnl-4) mutant in rice. Plant Signal Behav. 2021, 16, 1849490. [Google Scholar] [CrossRef]
- Wei, X.J.; Tang, S.Q.; Shao, G.N.; Chen, M.L.; Hu, Y.C.; Hu, P.S. Fine mapping and characterization of a novel dwarf and narrow-leaf mutant dnl1 in rice. Genet. Mol. Res. 2013, 12, 3845–3855. [Google Scholar] [CrossRef] [PubMed]
- Xing, M.M.; Su, H.N.; Liu, X.; Yang, L.M.; Zhang, Y.Y.; Wang, Y.; Fang, Z.Y.; Lv, H.H. Morphological, transcriptomics and phytohormone analysis shed light on the development of a novel dwarf mutant of cabbage (Brassica oleracea). Plant Sci. 2020, 290, 110283. [Google Scholar] [CrossRef]
- Hou, S.S.; Niu, H.H.; Tao, Q.Y.; Wang, S.S.; Gong, Z.H.; Li, S.; Weng, Y.Q.; Li, Z. A mutant in the CsDET2 gene leads to a systemic brassinosteriod deficiency and super compact phenotype in cucumber (Cucumis sativus L.). Theor. Appl. Genet. 2017, 130, 1693–1703. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 5, 2078–2079. [Google Scholar] [CrossRef] [Green Version]
- McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef] [Green Version]
- Wang, K.; Li, M.; Hakonarson, H. ANNOVAR: Functional annotation of genetic variants from high-throug hput sequencing data. Nucleic Acids Res. 2010, 38, e164. [Google Scholar] [CrossRef] [PubMed]
- Barbierato, V.; Sala, T.; Rinaldi, P.; Bassolino, L.; Barchi, L.; Rotino, G.L.; Toppino, L. A spiking strategy facilitates housekeeping selection for RT-qPCR analysis under different biotic stresses in eggplant. Protoplasma 2017, 254, 2215–2223. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 −ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Mishra, P.; Singh, U.; Pandey, C.M.; Mishra, P.; Pandey, G. Application of student’s t-test, analysis of variance, and covariance. Ann. Card. Anaesth. 2019, 22, 407–411. [Google Scholar] [CrossRef]
- Lu, Y.; Luo, S.; Li, Q.; Li, N.; Du, W.; Yu, P.; Wang, X.; Zhang, W.; Xuan, S.; Zhou, X.; et al. Phenotypic Characterization and Differential Gene Expression Analysis Reveal That Dwarf Mutant dwf Dwarfifism Is Associated with Gibberellin in Eggplant. Horticulturae 2021, 7, 114. [Google Scholar] [CrossRef]
- Jia, Q.J.; Li, C.D.; Shang, Y.; Zhu, J.H.; Hua, W.; Wang, J.M.; Yang, J.M.; Zhang, G.P. Molecular characterization and functional analysis of barley semi-dwarf mutant Riso no. 9265. BMC Genom. 2015, 16, 927–938. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.R.; Liu, L.; Zhi, X.N.; Bai, J.R.; Cui, Y.N.; Shu, J.S.; Li, J.M. Genetic analysis of tomato internode length via mixed major gene plus polygene inheritance model. Sci. Hortic. 2019, 246, 759–764. [Google Scholar] [CrossRef]
- Wu, Z.; Liu, Z.Z.; Chang, S.F.; Zhao, Y.X. An EMS mutant library for carrot and genetic analysis of some mutants. Breed Sci. 2020, 70, 540–546. [Google Scholar] [CrossRef]
- Sun, J.; Luu, N.S.; Chen, Z.H.; Chen, B.; Cui, X.A.; Wu, J.X.; Zhang, Z.G.; Lu, T.G. Generation and Characterization of a Foxtail Millet (Setaria italica) Mutant Library. Front. Plant Sci. 2019, 10, 369. [Google Scholar] [CrossRef] [Green Version]
- Kim, Y.; Schumaker, K.S.; Zhu, J.K. EMS mutagenesis of Arabidopsis. Methods Mol. Biol. 2006, 323, 101–103. [Google Scholar]
- Michelmore, R.W.; Paran, I.; Kesseli, R.V. Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA 1991, 88, 9828–9832. [Google Scholar] [CrossRef] [Green Version]
- Stokes, T.L.; Richards, E.J. Induced in stability of two Arabidopsis constitutive pathogen-response alleles. Proc. Natl. Acad. Sci. USA 2002, 99, 7792–7796. [Google Scholar] [CrossRef] [Green Version]
- Laursen, T.; Jensen, K.; Moller, B.L. Conformational changes of the NADPH-dependent cytochrome P450 reductase in the course of electron transfer to cytochromes P450. Biochim. Biophys. Acta (BBA)-Proteins Proteom. 2011, 1814, 132–138. [Google Scholar] [CrossRef]
- Dae-Kyun Ro, D.-K.; Jürgen, E.; Douglas, C.J. Cloning, Functional Expression, and Subcellular Localization of Multiple NADPH-Cytochrome P450 Reductases from Hybrid Poplar. Plant Physiol. 2002, 130, 1837–1851. [Google Scholar]
- Szalai, G.; Tajti, J.; Hamow, K.A.; Ildikó, D.; Khalil, R.; Vanková, R.; Dobrev, P.; Mishueva, S.P.; Janda, T.; Pál, M. Molecular background of cadmium tolerance in Rht dwarf wheat mutant is related to a metabolic shift from proline and polyamine to phytochelatin synthesis. Environ. Sci. Pollut. Res. Int. 2020, 27, 23664–23676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nelissen, H.; Rymen, B.; Jikumaru, Y.; Demuynck, K.; Lijsebettens, M.V.; Kamiya, Y.; Inzé, D.; Beemster, G.T.S. A local maximum in gibberellin levels regulates maize leaf growth by spatial control of cell division. Curr. Biol. 2012, 22, 1183–1187. [Google Scholar] [CrossRef] [Green Version]
- Bishop, G.J. Brassinosteroid mutants of crops. J. Plant Growth Regul. 2003, 22, 325–335. [Google Scholar] [CrossRef]
- Muro-Villanueva, F.; Mao, X.; Chapple, C. Linking phenylpropanoid metabolism, lignin deposition, and plant growth inhibition. Curr. Opin. Biotechnol. 2019, 56, 202–208. [Google Scholar] [CrossRef] [PubMed]





| Gene ID | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
|---|---|---|
| GAPDH | GTACGACAACGAATGGGGTTA | TCATATCAGCAGCACCAGCA |
| SmCPR1 | CGAGTGGCCCAATCAACAGAT | CCGTCCTCCTCCTCCTCCAAAACCG |
| CPR2 | GAAAGAACCACTATGCGTATAAACATC | CACCGTGTTTGTTTGTTTGTG |
| Generation | WT Phenotype | Dwarf Phenotype | Theoretical Segregation Ratio | χ2 |
|---|---|---|---|---|
| F2 | 123 | 43 | 2.86:1 | 0.823 |
| Gene ID | Variant | Scaffold | Position | Reference | Alter |
|---|---|---|---|---|---|
| Sme2.5_01158.1_g00001.1 | Nonsynonymous | Sme2.5_01158.1 | 8216 | G | A |
| Sme2.5_00670.1_g00001.1 | Nonsynonymous | Sme2.5_00670.1 | 1811 | C | A |
| Sme2.5_06691.1_g00001.1 | Nonsynonymous | Sme2.5_06691.1 | 1988 | T | C |
| Sme2.5_11667.1_g00003.1 | Nonsynonymous | Sme2.5_11667.1 | 28,891 | C | T |
| Sme2.5_16807.1_g00001.1 | Nonsynonymous | Sme2.5_16807.1 | 1476 | C | T |
| Sme2.5_19952.1_g00001.1 | Nonsynonymous | Sme2.5_19952.1 | 2943 | G | T |
| Sme2.5_21615.1_g00001.1 | Stop gain | Sme2.5_21615.1 | 2478 | C | T |
| Sme2.5_08332.1_g00001.1 | Splicing | Sme2.5_08332.1 | 3974 | C | T |
| Sme2.5_01689.1_g00001.1 | Upstream | Sme2.5_01689.1 | 4262 | A | T |
| Sme2.5_01689.1_g00001.1 | Upstream | Sme2.5_01689.1 | 4265 | C | G |
| Sme2.5_06855.1_g00002.1 | Upstream | Sme2.5_06855.1 | 10,623 | C | T |
| Sme2.5_19942.1_g00002.1 | Upstream | Sme2.5_19942.1 | 11,896 | T | C |
| Sme2.5_22728.1_g00001.1 | Upstream | Sme2.5_22728.1 | 4016 | G | A |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, Y.; Luo, S.; Li, N.; Li, Q.; Du, W.; Zhang, W.; Yu, P.; Xuan, S.; Wang, Y.; Zhao, J.; et al. Candidate Gene, SmCPR1, Encoding CPR1 Related to Plant Height of the Eggplant Dwarf Mutant dwf. Horticulturae 2021, 7, 196. https://doi.org/10.3390/horticulturae7070196
Lu Y, Luo S, Li N, Li Q, Du W, Zhang W, Yu P, Xuan S, Wang Y, Zhao J, et al. Candidate Gene, SmCPR1, Encoding CPR1 Related to Plant Height of the Eggplant Dwarf Mutant dwf. Horticulturae. 2021; 7(7):196. https://doi.org/10.3390/horticulturae7070196
Chicago/Turabian StyleLu, Yang, Shuangxia Luo, Na Li, Qiang Li, Wenchao Du, Weiwei Zhang, Ping Yu, Shuxin Xuan, Yanhua Wang, Jianjun Zhao, and et al. 2021. "Candidate Gene, SmCPR1, Encoding CPR1 Related to Plant Height of the Eggplant Dwarf Mutant dwf" Horticulturae 7, no. 7: 196. https://doi.org/10.3390/horticulturae7070196
APA StyleLu, Y., Luo, S., Li, N., Li, Q., Du, W., Zhang, W., Yu, P., Xuan, S., Wang, Y., Zhao, J., Chen, X., & Shen, S. (2021). Candidate Gene, SmCPR1, Encoding CPR1 Related to Plant Height of the Eggplant Dwarf Mutant dwf. Horticulturae, 7(7), 196. https://doi.org/10.3390/horticulturae7070196
