Next Article in Journal
Regulation of Rhythmic Photosynthesis by Photoperiod and Light Intensity in Non-Heading Chinese Cabbage: A Computational Approach
Previous Article in Journal / Special Issue
Genome-Wide Characterization of the Cinnamyl Alcohol Dehydrogenase (CAD) Gene Family and Expression Profiling of Candidate ClCAD3 Gene Associated with Lignin Biosynthesis in Watermelon
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 12
Issue 9
10.3390/horticulturae12091125
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Expression Analysis of SHN Gene Family in Melon

by
Zhu Lian
1,
Mengze Li
1,
Xiaoyu Wang
2,
Meng Li
1,
Lan Li
3,
Xuxu Niu
1,
Xiang Li
1,
Juan Hou
1,
Qiong Li
1,
Wenwen Mao
1,
Lili Li
1,
Chen Luo
1,
Jianbin Hu
1,* and
Panqiao Wang
1,*
1
College of Horticulture, Henan Agricultural University, Zhengzhou 450046, China
2
China Joint Graduate School of Modern Agriculture, Zhengzhou 450046, China
3
Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences, Zhengzhou 450009, China
*
Authors to whom correspondence should be addressed.
Horticulturae 2026, 12(9), 1125; https://doi.org/10.3390/horticulturae12091125
Submission received: 20 July 2026 / Revised: 24 August 2026 / Accepted: 29 August 2026 / Published: 5 September 2026
(This article belongs to the Special Issue Cucurbitaceae Genetics, Physiology and Breeding)
Browse Figures
Versions Notes

Abstract

SHN (SHINE) transcription factors belong to the AP2/ERF superfamily. They regulate cuticular wax biosynthesis and abiotic stress responses in plants, and play crucial roles in fruit netting development of cucurbit crops. However, a systematic genome-wide analysis of the SHN gene family in melon has not yet been reported. In this study, the thick-skinned melon cultivar ‘L5283’ was used as experimental material, and nine CmSHN family members were identified at the whole-genome level. We systematically analyzed their physicochemical properties, chromosomal distribution, evolutionary conservation, promoter cis-acting elements, and expression patterns under four types of stresses. The results showed that the nine CmSHN genes were unevenly distributed across six chromosomes. Extensive synteny was observed among SHN genes of cucurbit species including melon, watermelon and cucumber, with higher genomic structural conservation detected between cucumber and melon. Six categories of cis-elements were enriched in CmSHN gene promoters, namely light-responsive, hormone-responsive, stress-related, and development-associated elements, along with circadian rhythm and flavonoid biosynthesis elements. Light-responsive elements were the most abundant, suggesting that light signals may contribute to the regulation of CmSHN transcription. RT-qPCR analysis under ABA, cold, drought and salt stresses revealed that all CmSHN genes were induced to varying degrees, with obvious differences in response patterns and duration. Notably, CmSHN7 exhibited markedly higher fold induction than other family members under all four stress treatments. This study systematically characterizes the fundamental features and stress response patterns of the CmSHN family in melon, provides baseline data for elucidating the molecular mechanisms underlying wax biosynthesis and fruit netting formation, and supplies candidate genes for molecular breeding of stress resistance in cucurbit crops.

1. Introduction

Melon (Cucumis melo L.) is an economically important cucurbit crop widely cultivated worldwide, exhibiting abundant morphological diversity and extensive varietal differentiation in fruit traits [1,2]. The mature rind of the thick-skinned melon forms distinctive fissured netting. This specialized epidermal trait arises from mechanical tearing of the cuticle as the fruit expands, which is subsequently accompanied by cumulative deposition of suberin and lignin. Such a developmental pathway is unique to melon rind formation [3]. Rind netting exerts essential effects not only on the commercial exterior quality of melon fruits, but also modulates rind crack tolerance, long-term storability and diverse postharvest physiological behaviors [3,4]. Plant epidermal wax and cutin constitute the outermost hydrophobic cuticular barrier, which restricts trans-cuticular water transpiration, shields fruit tissues from abiotic extremes and pathogenic infection, and functions as the foremost defensive structure for plants coping with variable external habitats [5,6]. Melon (Cucumis melo) encompasses highly diverse botanical groups and landraces with remarkable genotypic diversity [7,8,9]. Melon accessions differ greatly in rind-netting intensity, cuticular wax composition, and stress tolerance [3,10]. Natural allelic variation at loci such as CmSN accounts for rind-netting diversity among melon germplasm [10]. In cucumber (Cucumis sativus), copy-number variation in CsSHN1 also contributes to natural variation in rind-netting intensity [11]. Thus, multi-genotype validation is needed to fully unravel the functional divergence of the CmSHN gene family.
The SHN (SHINE) proteins constitute the B-6 subgroup of the AP2/ERF transcription factor superfamily and are well-established core regulators of plant wax biosynthesis. In Arabidopsis, AtSHN1 overexpression significantly enhances cuticular wax deposition and improves drought adaptation [12,13]. While the function of SHN proteins in modulating cutin and suberin biosynthesis is largely conserved across plant species, accumulating evidence indicates substantial functional divergence among SHN homologs from different taxa. In tomato, SlSHN3 (SlSHINE3) acts as a vital regulator responsible for fruit cutin biosynthesis and cuticle assembly, and it also participates in epidermal-cell development [14]. In cucumber, copy-number variation in CsSHN1 is closely associated with the intensity of rind netting. Elevated transcript abundance accelerates rind-net formation by aggravating the suberization and lignification of epidermal cells [11]. Rice OsWR1 triggers wax-synthesis pathways via a distinctive transcriptional cascade to reduce epidermal water loss. Its regulatory mechanism differs greatly from its Arabidopsis homolog, which illustrates the functional diversification of the SHN family [15]. To date, SHN homologs characterized in tomato, soybean, moso bamboo and wolfberry exhibit tissue-specific expression profiles. These genes integrate multiple signaling cascades, including abscisic-acid- and light-dependent pathways to cope with drought and salt stresses [16,17,18,19]. Notably, crosstalk between light-signal and ABA-hormone pathways can take place at the promoter level of target transcription factors, jointly governing cuticle development and abiotic stress responses [20]. Given the evolutionary divergence among cucurbit species, we hypothesize that independent evolution drives functional divergence within the melon CmSHN family. The regulatory model of rind-net development and wax biosynthesis mediated by CmSHN differs from the well-characterized SHN homologs in cucumber and tomato.
SHN transcription factors belong to the ERF-B6 (also classified as ERF-V) subgroup of the ERF family within the AP2/EREBP superfamily, and function as crucial transcriptional modulators of wax biosynthesis in plants [21,22]. To date, genome-wide characterization of the SHN family has been conducted in a wide range of plant species. However, systematic identification and functional profiling of the SHN gene family have not yet been reported in melon. Cuticular wax serves as a vital protective barrier that mediates plant adaptation to multiple abiotic stresses, including drought, salinity, low temperature and high light, while also defending plants against pathogenic infection [23]. Accumulating evidence has confirmed that variations in rind wax abundance are closely associated with melon fruit storability and drought tolerance [24]. Given the indispensable role of SHN genes in regulating wax metabolism, comprehensive characterization of the CmSHN family is of great significance for uncovering the molecular basis of rind-netting formation and exploring promising candidate genes for molecular breeding of melon.
In the present study, genome-wide identification of the CmSHN gene family was performed using the thick-skinned melon cultivar ‘L5283’. We systematically analyzed the physicochemical properties, chromosomal distribution, gene structure, and interspecific collinearity of CmSHN members. Promoter cis-element prediction was applied to explore the potential upstream regulatory signals. Tissue-specific expression patterns were characterized based on public transcriptome data, and the expression responses of nine CmSHN genes to ABA, low temperature, drought, and salt stresses were further validated via RT-qPCR. This study aims to verify the potential species-specific functional divergence of the CmSHN family, provide preliminary regulatory clues for cuticular wax metabolism and rind-netting development, and supply candidate gene resources for future quality improvement and stress tolerance breeding in melon.

2. Materials and Methods

2.1. Plant Materials

The thick-skinned melon cultivar ‘L5283’ features vigorous growth, high resistance to powdery mildew, and robust low-temperature adaptability, making it well suited for protected cultivation in early spring and late autumn. Uniform, plump seeds were selected, disinfected via hot water treatment, and germinated. After radicle protrusion, the seeds were sown in 72-cell plug trays and maintained under routine greenhouse conditions. Seedlings at the one-leaf-one-bud stage were transplanted into 7 cm × 7 cm nutrient pots and cultivated in an intelligent light incubator. The controlled growth parameters were set as follows: a photoperiod of 12 h light/12 h dark, light intensity of 22,000 lx, day/night temperature regime of 28 °C/18 °C, and relative humidity of 70%.
At the three-leaf-and-one-bud stage, melon seedlings were subjected to four abiotic stress treatments: salinity stress (300 mmol/L NaCl), drought stress (15% PEG 6000), cold stress (day/night temperature of 15 °C/6 °C), and ABA treatment (100 μmol/L abscisic acid, ABA). The third fully expanded true leaf was harvested at 0, 6, 12, and 24 h post-treatment. All leaf samples were immediately frozen in liquid nitrogen and stored at −80 °C for subsequent total RNA extraction and quantitative real-time PCR (RT-qPCR) analysis.

2.2. Identification of CmSHN Gene Family Members in Melon

Whole-genome protein sequences of melon genotype DHL92 v4.0 were downloaded from the Cucurbit Genomics Database (CuGenDB; http://cucurbitgenomics.org/, accessed on 17 April 2025). A total of 132 AP2/EREBP protein sequences of Arabidopsis thaliana retrieved from The Arabidopsis Information Resource (TAIR; https://www.arabidopsis.org/, accessed on 17 Aperil 2025) were used as queries for BLASTP v2.9.0 homology searches with an E-value threshold of 1 × 10−5, generating preliminary candidate AP2/ERF genes in melon. Conserved domain validation of all candidate sequences was performed using Pfam v38.0 and SMART v10 online tools. Only sequences carrying complete AP2 domains (PF00847, SM00380) were retained, while sequences with truncated domains or redundant duplicates were discarded to acquire the full repertoire of melon AP2/ERF family proteins. Multiple sequence alignment of these AP2/ERF proteins was conducted in MAFFT v7.310. Referring to the established classification scheme of the Arabidopsis AP2/ERF family, and combining phylogenetic topology with conserved domain features, the melon AP2/ERF family was categorized into ten subfamilies, including AP2, A1, and B1. The resulting phylogenetic tree was further annotated and visualized via the iTOL web server (https://itol.embl.de/, accessed on 14 January 2026). Melon proteins clustered phylogenetically adjacent to Arabidopsis SHN members were regarded as putative CmSHN candidates. These candidate sequences were subsequently cross-checked against the NCBI Conserved Domain Database (CDD; https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 20 January 2026) based on the conserved domain cd00018 to confirm authentic CmSHN family members. The chromosomal positional information of each CmSHN gene was extracted from melon GFF3 genome annotations. TBtools v2.142 was utilized to map the chromosomal distribution of all CmSHN genes, and each gene was numbered and named according to its physical order on the chromosomes.
The amino acid count, molecular weight, theoretical isoelectric point (pI) and other physicochemical parameters of CmSHN proteins were analyzed via the ExPASy ProtParam web server (http://web.expasy.org/protparam/, accessed on 21 March 2026). The Plant-mPLoc tool within the Cell-PLoc suite (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/, accessed on 21 March 2026) was used to predict the subcellular localization of all melon SHN family proteins.

2.3. Structural Characteristics and Phylogenetic Analysis of the CmSHN Gene Family in Melon

Gene structural features (exons and introns) of all CmSHN genes were analyzed from melon GFF3 annotation files. Conserved domain prediction of CmSHN protein sequences was carried out using the SMART v10 database. Conserved motifs within CmSHN proteins were identified and graphically displayed using the MEME web server (http://meme-suite.org/tools/meme, accessed on 2 April 2026), with the maximum number of motifs set to 9 and motif width ranging from 6 to 50 amino acids. Gene structure schematics, conserved domain architecture diagrams, and motif distribution patterns were all visualized in TBtools v2.142. The Neighbor-Joining (NJ) phylogenetic tree of SHN family proteins from melon, Arabidopsis thaliana, tomato, rice, and soybean was constructed in MEGA 7.0. The Poisson correction model and pairwise deletion for missing data were implemented, bootstrap tests were set to 1000 replicates, and all remaining parameters were maintained at default values.

2.4. Collinearity Analysis of SHN Family Genes in Cucurbitaceae

Whole-genome sequences and corresponding annotation files of watermelon (97103 v2.5), melon (DHL92 v4.0), and cucumber (ChineseLong v3) were downloaded from the Cucurbit Genomics Database (CuGenDB; http://cucurbitgenomics.org/, accessed on 17 April 2025). Intragenomic gene duplication events and intergenomic collinear relationships were identified via BLASTP v2.9.0 and MCScanX (https://github.com/wyp1125/MCScanX, accessed on 17 April 2025), and collinearity diagrams were visualized using TBtools v2.311 and Circos v0.69.

2.5. Cis-Acting Element Analysis of Promoters of the CmSHN Gene Family in Melon

The 2000 bp promoter sequences upstream of the start codon for each CmSHN gene were extracted from the Cucurbit Genomics Database (CuGenDB; http://cucurbitgenomics.org/, accessed on 17 April 2025). Cis-acting regulatory elements harbored in these promoter fragments were predicted via the PlantCARE online server (https://bioinformatics.psb.ugent.be/, accessed on 28 May 2026). The captured cis-elements were functionally categorized and annotated with reference to published studies. TBtools v2.142 was applied to generate illustrative figures summarizing the promoter profiling results of all CmSHN family members.

2.6. Expression Pattern Analysis of the SHN Gene Family in Melon

2.6.1. Tissue-Specific Expression of Melon SHN Genes

To explore differential expression patterns of melon SHN family genes across various tissues and organs, transcriptome datasets of melon seeds, roots, stems, leaves, female flowers, male flowers, ovaries and fruits (flesh and peel) were downloaded from the NCBI SRA database (accession number: PRJNA603204) and DDBJ SRA database (accession No. DRA006228). Data corresponding to all CmSHN genes were extracted and imported into TBtools v2.142 for heatmap construction. Potential biological functions of these genes during melon development were further inferred based on their distinct expression profiles.

2.6.2. Expression Analysis of CmSHN Genes Under Abiotic Stress Treatments

Total RNA was extracted using the Vazyme RNA Extraction Kit (RC401, Vazyme Biotech, Nanjing, China). First-strand cDNA was synthesized with the HiScript® II 1st Strand cDNA Synthesis Kit (R212, Vazyme Biotech, Nanjing, China). Quantitative real-time PCR (RT-qPCR) was performed using Daling Bio 2× Universal SYBR qPCR Mix (blue, Beijing Tsingke Biotech Co., Ltd., Beijing, China). The melon reference gene MELO3C008032 (CmActin) was used for gene expression normalization [25,26]. All primers were designed using NCBI Primer-Blast (https://www.ncbi.nlm.nih.gov/, accessed on 1 March 2026), and detailed primer sequences are listed in Table 1. Each treatment included three independent biological replicates, with three technical replicates performed for each biological sample. The relative gene expression levels were calculated using the 2−ΔΔCt method, and all data are presented as mean ± standard deviation (SD). Statistical analyses were conducted in GraphPad Prism 8.0. Bartlett’s test was used to confirm homogeneity of variance (p > 0.05), followed by one-way ANOVA. Tukey’s HSD post hoc test was applied for all pairwise multiple comparisons. A significance threshold of p < 0.05 was adopted, and all gene expression graphs were generated using GraphPad Prism 8.0.

3. Results

3.1. Genome-Wide Identification and Physicochemical Characterization of the CmSHN Gene Family in Melon

Genome-wide screening of melon ERF transcription factors was performed, and a total of 126 genes encoding proteins harboring the canonical AP2 conserved domain (PF00847) were identified. Phylogenetic clustering resolved these sequences into ten distinct subfamilies: AP2, A-14 (A-1 and A-4), A-23 (A-2 and A-3), A-5, A-6, B-1, B-24 (B-2 and B-4), B-3, B-5, and B-6. SHN-type transcription factors fell within the B-6 subfamily. By integrating sequence homology with Arabidopsis thaliana SHN proteins and shared conserved domain signatures, nine authentic melon CmSHN family members were ultimately identified (Figure 1). Four melon CmSHN proteins formed a tight monophyletic group with the well-characterized Arabidopsis homologs AtSHN1 (AT1G15360), AtSHN2 (AT5G11190), and AtSHN3 (AT5G25390). The other five melon paralogs clustered alongside At5G25190, a putative SHN-like protein (AtSHN4); nevertheless, all nine melon CmSHNs retained high sequence identity to AtSHN1/2/3 (Figure 1 and Figure 2).
Chromosomal localization mapping revealed an uneven distribution pattern of the nine CmSHN genes across six melon chromosomes, with each gene assigned a unique identifier based on its physical coordinate along the chromosome (Figure 3). Chromosome 7 contained three CmSHN paralogs (CmSHN7, CmSHN8, CmSHN9), while chromosome 3 harbored two members (CmSHN3, CmSHN4). Chromosomes 1, 2, 4, and 5 each carried a single CmSHN gene copy (Figure 3).
Physicochemical properties, including amino acid length, molecular weight, theoretical isoelectric point (pI), instability index, grand average of hydropathicity (GRAVY), and subcellular localization were predicted for the nine CmSHN proteins in melon (Table 2). Physicochemical characterization revealed that the amino acid lengths of melon SHN proteins ranged from 157 to 246 residues, with molecular weights varying from 17.79 kDa to 27.20 kDa. Distinct divergence was observed in isoelectric points: only CmSHN2 and CmSHN7 were acidic proteins, whereas all other family members were basic polypeptides. The instability index of all CmSHN proteins exceeded 40, indicating that they are unstable proteins. The aliphatic index ranged from 61.66 to 77.25, showing relatively high values overall. Additionally, all proteins possessed negative GRAVY values (−0.78 to −0.45), confirming their hydrophilic nature. Subcellular localization prediction demonstrated that CmSHN proteins predominantly reside in the nucleus. CmSHN2, CmSHN5, CmSHN6, CmSHN7, and CmSHN8 were exclusively localized to the nucleus. CmSHN1 and CmSHN3 were simultaneously targeted to the nucleus and mitochondria; CmSHN4 was distributed in the nucleus and chloroplasts; and CmSHN9 was predicted to localize to chloroplasts and peroxisomes. These findings suggest that, in addition to functioning as nuclear transcription factors, members of the CmSHN family may participate in physiological processes associated with other organelles.

3.2. Gene Structure and Conserved Motifs of the SHN Gene Family in Melon

To dissect the intrinsic sequence characteristics of melon SHN members, systematic analyses of gene architecture and conserved protein motifs were conducted (Figure 4). The results revealed that all nine CmSHN proteins harbored the typical AP2 conserved domain, and Motif 2 and Motif 4 constituted the core universal motifs across the whole family. Each gene contained multiple CDS and UTR fragments, and the discrepancies in total gene length were primarily determined by variable untranslated region sizes. Regarding exon–intron organization, the exon count of CmSHN genes ranged from six to eight (Figure 4). Exon lengths were relatively conserved among paralogs, whereas intron lengths displayed remarkable divergence, a feature that may underpin complex transcriptional regulation. Consistent with the phylogenetic topology (Figure 1), genes within the same subclade (e.g., CmSHN2, CmSHN5, CmSHN6) shared highly similar gene structures, further supporting their close evolutionary affinity. Collectively, melon SHN proteins possess highly conserved motif arrangements at the protein level, whereas gene structures, particularly intron lengths, exhibit moderate divergence among different subclades. This structural differentiation could provide a molecular basis for functional diversification of the SHN family.

3.3. Phylogenetic and Collinearity Analysis of the CmSHN Gene Family

To unravel the evolutionary pattern of melon SHN genes, homologous relationships of SHN proteins from melon, Arabidopsis thaliana, tomato, rice, and soybean were systematically characterized. As presented in Figure 5, all SHN proteins were clearly grouped into five separate clades, marked as I, II, III, IV, and V. Rather than forming an exclusive melon-specific clade, all CmSHN proteins were distributed evenly among different branches and exhibited high sequence identity with their orthologs from tomato, rice, and Arabidopsis. This interspecies interleaved clustering topology suggests that the SHN transcription factor family originated before the divergence of monocots and dicots. The core sequences of SHN proteins have been highly conserved over long evolutionary timescales. Moreover, this phylogenetic arrangement indicates that distinct paralogs of the CmSHN family have undergone partial functional divergence during evolution.
Multiple copies of CmSHN genes arose from segmental duplication or whole-genome duplication (WGD) events prior to the divergence of Cucurbitaceae species. These paralogs have retained core sequence signatures and conserved chromosomal positions under long-term evolutionary selection. The homologous clustering of melon CmSHN proteins with SHN homologs from the model plant Arabidopsis thaliana and economic crops (tomato and rice) further supports the putative roles of CmSHNs in regulating cuticular wax biosynthesis and abiotic stress responses. These findings lay a solid biological foundation for subsequent functional characterization and molecular breeding targeting melon SHN family members.
To further elucidate the chromosomal arrangement of CmSHN genes and their evolutionary conservation within Cucurbitaceae, intergenomic synteny analysis was conducted among melon, cucumber, and watermelon (Citrullus lanatus) (Figure 6). The results showed that CmSHN genes displayed a characteristic spatial distribution across the 12 melon chromosomes, and prominent syntenic blocks (represented by connecting lines) were detected between melon and orthologous chromosomal regions of cucumber and watermelon. Widespread syntenic regions were shared among the three cucurbit crops. In particular, SHN orthologous segments between melon and cucumber exhibited more compact collinear pairing and stronger sequence conservation. Taken together, these observations indicate that the SHN gene family arose from the shared ancestral genome of Cucurbitaceae. Segmental duplication, combined with chromosomal rearrangements occurring during species radiation, coordinately shaped the genomic distribution profile of the melon CmSHN family.

3.4. Cis-Acting Element Profiling in Promoters of Melon CmSHN Family Genes

Cis-regulatory elements within promoter regions are indispensable for governing gene transcription and coordinating cellular responses to exogenous environmental cues. To unravel the underlying transcriptional regulatory networks and functional diversification of melon SHN paralogs, we isolated 2000 bp promoter sequences upstream of the translation start codon (ATG) for each CmSHN gene and performed genome-wide prediction of cis-acting motifs (Figure 7). All detected motifs were grouped into six functional classes: light responsiveness, hormone responsiveness, abiotic stress response, developmental control, circadian rhythm, and flavonoid biosynthesis. Figure 7A shows that motifs of each functional category were evenly dispersed along the entire promoter length of all CmSHN members. Figure 7B indicates that light- and hormone-associated motifs including G-box, ABRE, and TGACG-motif showed significantly higher copy numbers relative to other cis-elements. Figure 7C further confirms that light-responsive motifs represented the most abundant category across all CmSHN promoters. CmSHN9 contained the largest number of light-responsive elements (23 copies) among the whole family, with hormone-responsive motifs ranking as the second-most prevalent.
Moreover, CmSHN promoters harbor abundant cis-regulatory motifs linked to light signaling, phytohormone pathways, and stress responses. This pattern illustrates that the CmSHN paralogs are centrally governed by light and hormonal signals, and function coordinately in melon developmental progression, stress adaptation and secondary metabolic regulation. Collectively, the widespread enrichment of hormone- and stress-responsive motifs within CmSHN promoter regions provides straightforward transcriptional evidence that this gene family modulates melon stress tolerance. Meanwhile, these results lay an important theoretical foundation for screening functional candidate genes to carry out genetic improvement of melon.

3.5. Tissue-Specific Expression Profiling of SHN Genes in Melon

To delineate the tissue-specific expression signatures of CmSHN paralogs, publicly available melon transcriptome data were adopted to construct clustering heatmaps reflecting transcript abundance of the nine CmSHN genes across diverse tissues and developmental stages (Figure 8). The tested samples covered callus, dry seeds, imbibed seeds, seedling vegetative tissues, roots, stems, leaves, female flowers, and male flowers, as well as fruit flesh and peel from sequential fruit developmental phases. CmSHN3, CmSHN4, and CmSHN5 displayed robust transcription in most vegetative tissues, seeds and floral organs. CmSHN1 reached its maximum expression in callus, with CmSHN3 and CmSHN5 showing secondary abundance, which points to their essential roles in floral organ morphogenesis. Noticeable transcript accumulation of CmSHN3, CmSHN4, and CmSHN5 was also observed in stems and leaves. In contrast, CmSHN1, CmSHN7, and CmSHN8 only presented faint signals in a limited range of seedling tissues, implying their potential functions in regulating early fruit development during ovary differentiation. Compared with other family members, CmSHN5 maintained consistently high transcript levels throughout almost all examined tissues, with the highest enrichment detected in fruit flesh at every developmental stage. In contrast, CmSHN2 was specifically enriched in fruit peel during early fruit expansion, while negligible transcript signals were captured in fruit flesh. This observation indicates that CmSHN2 may be indispensable for melon peel differentiation and epidermal netting formation.

3.6. Expression Profiling of Melon CmSHN Family Genes in Response to Various Abiotic Stresses

Quantitative real-time PCR (RT-qPCR) was applied to examine the transcript abundance of nine melon CmSHN paralogs under four abiotic stress conditions: abscisic acid (ABA), cold, drought, and salt stress. The results demonstrated obvious discrepancies in stress-responsive patterns among different CmSHN members (Figure 9). When melon seedlings were subjected to 100 μmol/L ABA treatment, all nine CmSHN genes were significantly upregulated, with expression maxima primarily appearing at 6 h or 12 h after treatment. CmSHN5 and CmSHN7 displayed the strongest response to ABA; their relative expression levels at 12 h were approximately 200-fold and 250-fold higher than the 0 h control, respectively. Marked transcriptional induction was also detected in CmSHN1, CmSHN4, CmSHN8, and CmSHN9, while the fold induction of CmSHN2, CmSHN3, and CmSHN6 remained relatively mild. Upon cold exposure, most CmSHN genes were sharply induced, with peak transcript levels generally observed at 12 h. CmSHN1, CmSHN4, CmSHN7, and CmSHN9 reached their expression maxima at 12 h and exhibited substantially higher abundance relative to the 0 h control. In contrast, CmSHN3, CmSHN6, and CmSHN8 showed peak expression at 0 h, followed by a gradual reduction with prolonged cold treatment. Judging by induction amplitude, CmSHN7 was the most cold-responsive gene, whose relative expression at 12 h was approximately 20 times that of the untreated control; CmSHN1, CmSHN4, and CmSHN9 also underwent prominent transcriptional activation.
All nine CmSHN paralogs were responsive to drought stress simulated with 15% PEG 6000. Seven family members, namely CmSHN1, CmSHN3, CmSHN4, CmSHN5, CmSHN7, CmSHN8, and CmSHN9, attained their expression maxima at 12 h, with transcript levels significantly higher than the 0 h baseline. Regarding induction amplitude, CmSHN7 showed the strongest drought responsiveness, with its relative expression at 12 h reaching approximately 280-fold that of the untreated control. Individual CmSHN genes exhibited remarkable divergence in both the time point of drought-triggered induction and the degree of transcriptional activation. These observations indicate that the whole family extensively participates in drought response pathways and performs diverse and indispensable functions in regulating melon drought tolerance.
When melon seedlings were exposed to 300 mmol/L NaCl to impose salt stress, all CmSHN genes were significantly transcriptionally upregulated following treatment, with expression maxima predominantly occurring at 12 h. Consistently, all nine paralogs exhibited maximum transcript abundance at 12 h, showing markedly higher expression compared with the 0 h baseline. In terms of induction amplitude, CmSHN7 displayed the most robust salt responsiveness, with its relative expression level at 12 h approximately 150-fold that of the untreated control.
Collectively, all melon CmSHN paralogs were transcriptionally induced to variable degrees upon ABA, cold, drought, and salinity treatments. Individual family members displayed striking disparities in both their stress-responsive profiles and temporal activation kinetics. These results indicate that the CmSHN gene family performs diverse and indispensable regulatory functions to facilitate melon adaptation to multiple abiotic stresses.

4. Discussion

In melon production, the composition and structural characteristics of fruit cuticular wax directly determine fruit visual quality, postharvest shelf-life, and plant environmental adaptability [27]. The SHN transcription factor family plays conserved roles in regulating cuticular wax biosynthesis, epidermal development, and abiotic stress responses, and its functions have been extensively characterized in Arabidopsis, cucumber, tomato, rice, and soybean [17,18,28,29]. Nevertheless, most previous studies have focused on model plants and common vegetable species, while systematic investigations of the SHN family in the context of unique reticulated rind development in melon remain insufficient. Therefore, the comprehensive analysis of the evolutionary features, promoter regulatory patterns, and expression response characteristics of CmSHN family members is of great significance for elucidating the molecular mechanisms underlying melon rind development and stress tolerance, as well as identifying potential gene resources for melon molecular breeding.
The SHN gene family exhibits functionally conserved properties across both monocot and dicot species, while substantial functional divergence has occurred during plant evolution. For instance, rice OsWR1 activates wax biosynthesis through a species-specific transcriptional regulatory pathway that differs from its Arabidopsis homolog. Ectopic overexpression of soybean GmSHN1 and GmSHN9 increases leaf wax content by 7.8-fold and 9.9-fold, respectively, and these two homologs display distinct regulatory effects on cutin synthesis, which are inconsistent with the canonical SHN pathway in Arabidopsis [29]. These findings collectively indicate that SHN homologs have undergone obvious functional diversification across different plant species. In the present study, a total of nine CmSHN members were identified in the melon genome. This gene number varies from that of previously reported SHN families in Arabidopsis (3 members) [28], soybean (10 members) [29], and rice (4 members) [15]. Such variation in family size implies that cucurbit crops may have experienced independent gene family expansion or contraction during evolution, further suggesting that melon CmSHN members may have evolved unique regulatory functions distinct from their well-characterized homologs in other plant species.
Cis-acting elements located in gene promoters regulate plant responses to biotic and abiotic stresses. The category and abundance of cis-regulatory motifs vary considerably among different gene families [30,31]. In this study, multiple cis-elements related to light response, hormone signaling, stress tolerance and secondary metabolism were identified in CmSHN promoters. Light-responsive elements (e.g., G-box) were widely distributed across CmSHN promoters. Considering the conserved regulatory characteristics of SHN homologs reported in cucumber, tomato and soybean [11,16,29], our results suggest that light signaling may serve as a central upstream regulator governing the transcription of CmSHN genes. The enrichment of ABRE, DRE, and LTRE elements provides transcriptional evidence for the stress-inducible expression of CmSHN genes under ABA, drought, salt, and cold conditions. The identification of flavonoid biosynthesis-related elements further suggests that CmSHN genes may participate in rind secondary metabolism and UV resistance, in addition to their potential roles in wax accumulation. Notably, CmSHN promoters simultaneously harbor numerous light- and ABA-responsive cis-elements. Light and ABA signaling pathways show extensive crosstalk during plant epidermal development and stress adaptation [32]. Combined with the canonical functions of the SHN family in plant cuticle regulation [13], we propose that CmSHN genes act as key signal integrators at the transcriptional level. They may coordinate external light signals and endogenous ABA stress signals, thereby modulating melon rind development and abiotic stress tolerance. This regulatory model requires further verification through yeast one-hybrid and EMSA assays. SHN homologs from a wide range of horticultural crops have been functionally characterized, confirming their conserved roles in cuticle biosynthesis and stress adaptation [33,34]. Apple MdSHINE2 enhances drought tolerance by activating wax-biosynthesis pathways [33], and cotton GhWIN2 regulates both cuticle formation and salicylic-acid- or jasmonic-acid-associated defense signalling [34]. Collectively, results from cucumber, tomato, soybean, apple and cotton illustrate that SHN genes exhibit conserved as well as species-specific diversified functions across plant species [35]. Differential cis-element distribution among family members further indicates functional divergence of CmSHN genes during melon evolution.
Tissue expression profiling revealed distinct tissue-specific expression patterns of CmSHN family genes. CmSHN2 was specifically and highly expressed in the rind at all fruit developmental stages, with negligible expression in the flesh. This expression pattern is highly similar to that of cucumber CsSHN1, a key gene responsible for rind-netting formation [11]. Combined with its rind-specific expression feature, we speculate that CmSHN2 may be a candidate gene potentially involved in melon rind-netting development [3,4], while its precise biological function requires further functional validation. In contrast, CmSHN5 exhibited widespread high expression in roots, stems, leaves, flowers, flesh, and rind, implying its potential dual roles in both vegetative growth and reproductive development [14]. Meanwhile, CmSHN1, CmSHN8, and CmSHN9 showed relatively restricted expression profiles in only a few tissues. The differential tissue-specific expression patterns are consistent with the divergence in the types and copy numbers of promoter cis-elements among CmSHN members [30,31], further supporting the functional diversification of the CmSHN family during melon evolution [22,35].
Abiotic stress assays revealed that all nine CmSHN genes were significantly upregulated following ABA treatment, with CmSHN5 and CmSHN7 showing the most dramatic induction levels. These results are consistent with earlier studies reporting ABA-dependent activation of AtSHN1 in Arabidopsis [12,13], suggesting that SHN homologs may act downstream of the ABA signaling cascade [20] and positively regulate drought adaptation by modulating cuticular wax biosynthesis [5,6,23,27]. The conserved roles of SHN-type transcription factors in wax biosynthesis and cuticle regulation have been widely demonstrated across plant species, including rice [15], tomato [16], soybean [29], apple [33], cotton [34], barley [36,37], wheat [38], and poplar [39]. In contrast, CmSHN members exhibited highly divergent expression profiles under low-temperature conditions. CmSHN4, CmSHN7, and CmSHN9 reached their expression peaks at 12 h of cold treatment, while CmSHN3, CmSHN6, and CmSHN8 displayed maximum transcript abundance at 0 h, followed by a gradual decline over the treatment period. Among these genes, CmSHN7 showed the most prominent cold responsiveness, with an approximately 20-fold increase at 12 h, indicating its putative crucial function in melon cold tolerance [18]. This observation aligns with previous findings that cold-induced wax accumulation stabilizes cell membrane systems by reducing membrane phase transition temperature [5,23]. The diverse stress-responsive behaviors of individual CmSHN members further reinforce the functional divergence of this gene family in mediating multiple abiotic stress adaptations in melon [35], consistent with reports of multi-stress tolerance conferred by SHN homologs in other species [40,41,42].
CmSHN7 exhibited prominent stress-responsive expression in melon. Its transcript levels were induced approximately 280-fold under drought stress, 150-fold under salt stress, and 20-fold under cold stress. These strong induction responses suggest that CmSHN7 may be involved in melon responses to abiotic stress [35]. It should be noted that these stress-expression data were obtained only from the inbred line L5283. This stress-response pattern may be genotype-specific [1,7,8,9]. In this study, we systematically analyzed the gene structure, evolutionary characteristics, promoter regulatory elements [30], and transcription patterns of the CmSHN family. Our results provide basic information for subsequent functional tests and exploration of CmSHN-related regulatory pathways. Moreover, the possible function of CmSHN2 in rind-netting formation [3,10,11,26] and the stress-related role of CmSHN7 still need further experimental evidence. Gene editing, stable transformation of multiple melon genotypes, and trait-association analysis can be used to confirm their functions. Yeast one-hybrid assays can also help identify their upstream regulators and downstream target genes [12,13]. These future experiments will clarify the molecular mechanisms of melon rind development and stress responses. In conclusion, this work provides useful theoretical support and candidate genes for melon quality improvement and stress-tolerance molecular breeding [2,17,24].

5. Conclusions

In this study, nine CmSHN family members were identified in melon using genome-wide bioinformatic analysis. We investigated their physicochemical properties, chromosomal locations, phylogenetic traits, and promoter cis-element compositions. RT-qPCR analysis was adopted to detect gene expression profiles under ABA, cold, drought, and salt treatments. Our results provide foundational data for exploring the regulatory functions of melon SHN genes in cuticular wax synthesis and abiotic stress responses.

Author Contributions

Conceptualization, P.W. and J.H. (Jianbin Hu); methodology, Z.L., X.W., L.L. (Lan Li), X.L., J.H. (Juan Hou), Q.L., W.M. and C.L.; validation, Z.L., M.L. (Mengze Li) and X.W.; formal analysis, Z.L. and X.W.; experimental treatment and investigation, Z.L., X.N., M.L. (Meng Li) and L.L. (Lili Li); resources, M.L. (Meng Li) and P.W.; data curation, Z.L. and P.W.; writing—original draft preparation, Z.L. and P.W.; writing—review and editing, J.H. (Juan Hou) and P.W.; visualization, X.W. and M.L. (Mengze Li); supervision, J.H. (Jianbin Hu) and P.W.; project administration, J.H. (Jianbin Hu) and P.W.; funding acquisition, P.W., X.L. and J.H. (Jianbin Hu). All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (Grant Nos. 32102388, 32573009), the Key Research and Promotion Projects from Henan Province (Grant No. 242102111136), and the Scientific and Technological Innovation Team in Colleges and Universities in Henan (Grant No. 26IRTSTHN014).

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Michel, P. Phenotypic diversity in wild and cultivated melons (Cucumis melo). Plant Biotechnol. 2013, 30, 273–278. [Google Scholar] [CrossRef] [Scilit]
  2. Shahwar, D.; Khan, Z.; Park, Y. Molecular marker-assisted mapping, candidate gene identification, and breeding in melon (Cucumis melo L.): A Review. Int. J. Mol. Sci. 2023, 24, 15490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Cohen, H.; Dong, Y.H.; Szymanski, J.; Lashbrooke, J.; Meir, S.; Almekias-Siegl, E.; Zeisler-Diehl, V.V.; Schreiber, L.; Aharoni, A. A multilevel study of melon fruit reticulation provides insight into skin ligno-suberization hallmarks. Plant Physiol. 2019, 179, 1486–1501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Puthmee, T.; Takahashi, K.; Sugawara, M.; Kawamata, R.; Motomura, Y.; Nishizawa, T.; Aikawa, T.; Kumpoun, W. The role of net development as a barrier to moisture loss in netted melon fruit (Cucumis melo L.). HortScience 2013, 48, 1463–1469. [Google Scholar] [CrossRef] [Scilit]
  5. Xue, D.W.; Zhang, X.Q.; Lu, X.L.; Chen, G.; Chen, Z.H. Molecular and evolutionary mechanisms of cuticular wax for plant drought tolerance. Front. Plant Sci. 2017, 8, 621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Yeats, T.H.; Rose, J.K.C. The formation and function of plant cuticles. Plant Physiol. 2013, 163, 5–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Zhao, G.; Liu, S.; Gao, P.; Zhu, Q.L.; Zhu, Z.C.; Liu, H.Y.; Wang, X.Z.; Weng, Y.Q.; Gao, M.L.; Luan, F.S. Resequencing of 297 melon accessions reveals the genomic history of improvement and loci related to fruit traits in melon. Plant Biotechnol. J. 2020, 18, 2545–2558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Luan, F.; Delannay, I.; Staub, J.E. Chinese melon (Cucumis melo L.) diversity analyses provide strategies for germplasm curation, genetic improvement, and evidentiary support of domestication patterns. Euphytica 2008, 164, 445–461. [Google Scholar] [CrossRef] [Scilit]
  9. Cong, Y.D.; Yan, G.R.; Li, Z.Q.; Deng, C.H.; Ma, Y.; Wang, F.; Zhao, L.J.; Liu, N.; Wang, W.; Song, Y. Phenotypic variation and classification of melon germplasm resources based on DUS test characteristics. Plants 2026, 15, 2384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Liang, X.X.; Li, Q.; Cao, L.; Du, X.Y.; Qiang, J.H.; Hou, J.; Li, X.; Zhu, H.Y.; Yang, S.; Liu, D.M.; et al. Natural allelic variation in the EamA-like transporter, CmSN, is associated with fruit skin netting in melon. Theor. Appl. Genet. 2023, 136, 192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Zhang, H.; Wang, Y.; Tan, J.; Weng, Y. Functional copy number variation of CsSHINE1 is associated with fruit skin netting intensity in cucumber, Cucumis sativus. Theor. Appl. Genet. 2022, 135, 2101–2119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Broun, P.; Poindexter, P.; Osborne, E.; Jiang, C.Z.; Riechmann, J.L. WIN1, a transcriptional activator of epidermal wax accumulation in Arabidopsis. Proc. Natl. Acad. Sci. USA 2004, 101, 4706–4711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Aharoni, A.; Dixit, S.; Jetter, R.; Thoenes, E.; van Arkel, G.; Pereira, A. The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis. Plant Cell 2004, 16, 2463–2480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Shi, J.X.; Adato, A.; Alkan, N.; He, Y.H.; Lashbrooke, J.; Matas, A.J.; Meir, S.; Malitsky, S.; Isaacson, T.; Prusky, D.; et al. The tomato SlSHINE3 transcription factor regulates fruit cuticle formation and epidermal patterning. New Phytol. 2013, 197, 468–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Wang, Y.H.; Wan, L.Y.; Zhang, L.X.; Zhang, Z.J.; Zhang, H.W.; Quan, R.D.; Zhou, S.R.; Huang, R.F. An ethylene response factor OsWR1 responsive to drought stress transcriptionally activates wax synthesis related genes and increases wax production in rice. Plant Mol. Biol. 2012, 78, 275–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Al-Abdallat, A.M.; Al-Debei, H.S.; Ayad, J.Y.; Hasan, S. Over-expression of SlSHN1 gene improves drought tolerance by increasing cuticular wax accumulation in tomato. Int. J. Mol. Sci. 2014, 15, 19499–19515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Petit, J.; Bres, C.; Mauxion, J.-P.; Bakan, B.; Rothan, C. Breeding for cuticle-associated traits in crop species: Traits, targets, and strategies. J. Exp. Bot. 2017, 68, 5369–5387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Huang, Z.; Zhu, P.L.; Zhong, X.J.; Qiu, J.R.; Xu, W.X.; Song, L. Transcriptome analysis of moso bamboo (Phyllostachys edulis) reveals candidate genes involved in response to dehydration and cold stresses. Front. Plant Sci. 2022, 13, 960302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Wang, P.; Wang, J.J.; Zhang, H.Y.; Wang, C.; Zhao, L.N.K.; Huang, T.; Qing, K. Chemical composition, crystal morphology, and key gene expression of the cuticular waxes of goji (Lycium barbarum L.) berries. J. Agric. Food Chem. 2021, 69, 7874–7883. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Mukherjee, A.; Dwivedi, S.; Bhagavatula, L.; Datta, S. Integration of light and ABA signaling pathways to combat drought stress in plants. Plant Cell Rep. 2023, 42, 829–841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Sakuma, Y.; Liu, Q.; Dubouzet, J.G.; Abe, H.; Shinozaki, K.; Yamaguchi-Shinozaki, K. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 2002, 290, 998–1009. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Nakano, T.; Suzuki, K.; Fujimura, T.; Shinshi, H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol. 2006, 140, 411–432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Lewandowska, M.; Keyl, A.; Feussner, I. Wax biosynthesis in response to danger: Its regulation upon abiotic and biotic stress. New Phytol. 2020, 227, 698–713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Zhang, W.D.; Wang, Y.; Guo, H.J.; Yang, W.T.; Guo, M.R.; Chen, G.G. Cuticular wax removal on reactive oxygen species-related mechanisms and on the quality of hami melon cultivars. Postharvest Biol. Technol. 2022, 193, 112060. [Google Scholar] [CrossRef] [Scilit]
  25. Zhang, R.; Chen, J.; Zhang, Y.B.; Lu, X.M.; Cheng, C.Y.; Li, J.; Lou, Q.F.; Wang, Y.H.; Qian, C.T. Long noncoding RNA–messenger RNA (lncRNA–mRNA) network in resistance to gummy stem blight (Stagonosporopsis cucurbitacearum) of melon plant introduction (PI) 420145. Horticulturae 2025, 11, 31. [Google Scholar] [CrossRef] [Scilit]
  26. Shen, J.; Xu, X.Y.; Zhang, Y.J.; Niu, X.W.; Shou, W.S. Genetic mapping and identification of the candidate genes for mottled rind in Cucumis melo L. Front. Plant Sci. 2021, 12, 769989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Wu, W.J.; Jiang, B.; Liu, R.L.; Han, Y.C.; Fang, X.J.; Mu, H.L.; Farag, M.A.; Simal-Gandara, J.; Prieto, M.A.; Chen, H.J.; et al. Structures and functions of cuticular wax in postharvest fruit and its regulation: A comprehensive review with future perspectives. Engineering 2023, 23, 118–129. [Google Scholar] [CrossRef] [Scilit]
  28. Shi, J.X.; Malitsky, S.; De Oliveira, S.; Branigan, C.; Franke, R.B.; Schreiber, L.; Aharoni, A. SHINE transcription factors act redundantly to pattern the archetypal surface of Arabidopsis flower organs. PLoS Genet. 2011, 7, e1001388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Xu, Y.Y.; Wu, H.Y.; Zhao, M.M.; Wu, W.W.; Xu, Y.N.; Gu, D. Overexpression of the transcription factors GmSHN1 and GmSHN9 differentially regulates wax and cutin biosynthesis, alters cuticle properties, and changes leaf phenotypes in Arabidopsis. Int. J. Mol. Sci. 2016, 17, 587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Lu, Z.F.; Marand, A.P.; Ricci, W.A.; Ethridge, C.L.; Zhang, X.Y.; Schmitz, R.J. The prevalence, evolution and chromatin signatures of plant regulatory elements. Nat. Plants 2019, 5, 1250–1259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Mahapatra, K.; Dwivedi, S.; Mukherjee, A.; Pradhan, A.A.; Rao, K.V.; Singh, D.; Bhagavatula, L.; Datta, S. Interplay of light and abscisic acid signaling to modulate plant development. J. Exp. Bot. 2024, 76, 730–745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Zhang, Y.L.; Zhang, C.L.; Wang, G.L.; Wang, Y.X.; Qi, C.H.; You, C.X.; Li, Y.Y.; Hao, Y.J. Apple AP2/EREBP transcription factor MdSHINE2 confers drought resistance by regulating wax biosynthesis. Planta 2019, 249, 1627–1643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Li, X.; Liu, N.; Sun, Y.; Wang, P.; Ge, X.; Pei, Y.; Liu, D.; Ma, X.; Li, F.; Hou, Y. The cotton GhWIN2 gene activates the cuticle biosynthesis pathway and influences the salicylic and jasmonic acid biosynthesis pathways. BMC Plant Biol. 2019, 19, 379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Khoudi, H. SHINE clade of ERF transcription factors: A significant player in abiotic and biotic stress tolerance in plants. Plant Physiol. Biochem. 2023, 195, 77–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. McAllister, T.; Campoli, C.; Eskan, M.; Liu, L.; McKim, S.M. A gene encoding a SHINE1/WAX INDUCER1 transcription factor controls cuticular wax in barley. Agronomy 2022, 12, 1088. [Google Scholar] [CrossRef] [Scilit]
  37. Djemal, R.; Mila, I.; Bouzayen, M.; Pirrello, J.; Khoudi, H. Molecular cloning and characterization of novel WIN1/SHN1 ethylene responsive transcription factor HvSHN1 in barley (Hordeum vulgare L.). J. Plant Physiol. 2018, 228, 39–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Ger, K.J.; Miskó, A.; Fábián, A.; Deák, C.; Kiss Bába, E.; Polgári, D.; Barnabás, B.; Papp, I. Expression of a WIN/SHN-type regulator from wheat triggers disorganized proliferation in the Arabidopsis leaf cuticle. Biol. Plant. 2015, 59, 29–36. [Google Scholar] [CrossRef] [Scilit]
  39. Lawson, S.S. Investigation of the effect of AtWIN1/SHN1 overexpression on poplar trees. Res. J. Bot. 2016, 12, 1–13. [Google Scholar] [CrossRef] [Scilit][Green Version]
  40. Djemal, R.; Khoudi, H. TdSHN1, a WIN1/SHN1 type transcription factor, imparts multiple abiotic stress tolerance in transgenic tobacco. Environ. Exp. Bot. 2016, 131, 89–100. [Google Scholar] [CrossRef] [Scilit]
  41. Djemal, R.; Khoudi, H. The barley SHN1-type transcription factor HvSHN1 imparts heat, drought and salt tolerances in transgenic tobacco. Plant Physiol. Biochem. 2021, 164, 44–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Liu, Y.; Wei, M.; Hou, C.; Lu, T.; Liu, L.; Wei, H.; Cheng, Y.; Wei, Z. Functional characterization of Populus PsnSHN2 in coordinated regulation of secondary wall components in tobacco. Sci. Rep. 2017, 7, 42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Horticulturae 12 01125 g001
Figure 1. Phylogenetic tree analysis of the AP2/ERF family in melon. Note: Red fonts indicate genes from Arabidopsis thaliana, whereas blue fonts indicate genes from Cucumis melo.
Figure 1. Phylogenetic tree analysis of the AP2/ERF family in melon. Note: Red fonts indicate genes from Arabidopsis thaliana, whereas blue fonts indicate genes from Cucumis melo.
Horticulturae 12 01125 g001
Horticulturae 12 01125 g002
Figure 2. Sequence analysis of CmSHN with AtSHN-like proteins. Note: The intensity of shading represents the level of sequence identity, with darker colors indicating higher sequence identity.
Figure 2. Sequence analysis of CmSHN with AtSHN-like proteins. Note: The intensity of shading represents the level of sequence identity, with darker colors indicating higher sequence identity.
Horticulturae 12 01125 g002
Horticulturae 12 01125 g003
Figure 3. Chromosomal localization of CmSHN gene family members in melon. Note: The lines represent intragenomic collinear gene pairs, among which the red lines denote CmSHN family genes, and the gray-purple lines represent other gene pairs.
Figure 3. Chromosomal localization of CmSHN gene family members in melon. Note: The lines represent intragenomic collinear gene pairs, among which the red lines denote CmSHN family genes, and the gray-purple lines represent other gene pairs.
Horticulturae 12 01125 g003
Horticulturae 12 01125 g004
Figure 4. Gene structure and conserved motif analysis of SHN family members in melon.
Figure 4. Gene structure and conserved motif analysis of SHN family members in melon.
Horticulturae 12 01125 g004
Horticulturae 12 01125 g005
Figure 5. Phylogenetic analysis of SHN protein family members derived from Cucumis melo, Arabidopsis thaliana, Solanum lycopersicum, Oryza sativa and Glycine max.
Figure 5. Phylogenetic analysis of SHN protein family members derived from Cucumis melo, Arabidopsis thaliana, Solanum lycopersicum, Oryza sativa and Glycine max.
Horticulturae 12 01125 g005
Horticulturae 12 01125 g006
Figure 6. Collinearity analysis of CmSHN among different species. Note: Numbers represent chromosome IDs. Green lines indicate collinear pairs of SHN genes between cucumber and melon. Red lines represent collinear SHN gene pairs between watermelon and melon. Gray lines denote other inter-species collinear gene pairs.
Figure 6. Collinearity analysis of CmSHN among different species. Note: Numbers represent chromosome IDs. Green lines indicate collinear pairs of SHN genes between cucumber and melon. Red lines represent collinear SHN gene pairs between watermelon and melon. Gray lines denote other inter-species collinear gene pairs.
Horticulturae 12 01125 g006
Horticulturae 12 01125 g007
Figure 7. Cis-element analysis of the promoter regions of CmSHN genes. (A) Different cis-element types and their locations in each CmSHN gene are indicated using colored blocks. (B) The numbers of different promoter elements in CmSHN genes are represented using different colors and numbers. (C) Number of different cis-element types.
Figure 7. Cis-element analysis of the promoter regions of CmSHN genes. (A) Different cis-element types and their locations in each CmSHN gene are indicated using colored blocks. (B) The numbers of different promoter elements in CmSHN genes are represented using different colors and numbers. (C) Number of different cis-element types.
Horticulturae 12 01125 g007
Horticulturae 12 01125 g008
Figure 8. Analysis of SHN gene expression in different tissues of melon.
Figure 8. Analysis of SHN gene expression in different tissues of melon.
Horticulturae 12 01125 g008
Horticulturae 12 01125 g009
Figure 9. Expression pattern analysis of CmSHN family genes under ABA, low temperature, drought and salt treatments. (A) ABA treatment; (B) low-temperature treatment; (C) salt treatment; (D) drought treatment. Bars represent the mean ± standard deviation (SD) from three independent biological replicates. Prior to statistical analysis, all datasets were subjected to normality and homogeneity-of-variance tests. One-way ANOVA followed by Tukey’s HSD post hoc test was conducted, and the significance threshold was set at p < 0.05. Different lowercase letters above bars indicate statistically significant differences among different sampling-time-point groups.
Figure 9. Expression pattern analysis of CmSHN family genes under ABA, low temperature, drought and salt treatments. (A) ABA treatment; (B) low-temperature treatment; (C) salt treatment; (D) drought treatment. Bars represent the mean ± standard deviation (SD) from three independent biological replicates. Prior to statistical analysis, all datasets were subjected to normality and homogeneity-of-variance tests. One-way ANOVA followed by Tukey’s HSD post hoc test was conducted, and the significance threshold was set at p < 0.05. Different lowercase letters above bars indicate statistically significant differences among different sampling-time-point groups.
Horticulturae 12 01125 g009
Table 1. Primer sequences used for quantitative real-time PCR of melon CmSHN genes.
Table 1. Primer sequences used for quantitative real-time PCR of melon CmSHN genes.
GeneForward PrimerReverse Primer
CmSHN1CACAAACAACACCCTGGATTCGGCTAGTGGTGGCTCCGGTAAT
CmSHN2CGCACTCCTTCACCGTCAATGTCCTAGCTCGACCGTCATAACC
CmSHN3GCTGACGGTGGAGGGAAACATGAGAGGGTGGCACAACAGAG
CmSHN4AATCTTCCTCTGCCGCTCGTCCCCACAATCCACGCTTTCCATT
CmSHN5CCTACGGCTCGACAGTGACAGCTTGTGGATTCAGACGAAGGT
CmSHN6GATGAGCCAAACGACGGTGTCGCGTGGAGAATCTCCGATAAGC
CmSHN7GACATTACCTCGGCGTTTCC CACACTTCTCACCATCCAATCC
CmSHN8AATCCGCCGACCCAACTCAAAGCTGGAGACCCATCTGGCCTCTT
CmSHN9TTGGCAGAGGCGTACAGGACACTTGGTAACCGTCGTCGTTCT
CmActinGCCCTTCCTCATGCCATTCTCAATTTCCCGTTCGGCAGTG
Table 2. The physicochemical characteristics of the CmSHN proteins in Cucumis melo.
Table 2. The physicochemical characteristics of the CmSHN proteins in Cucumis melo.
Gene NameSequence IDNumber of Amino AcidMolecular Weight (kDa)Theoretical pIInstability IndexAliphatic IndexGrand Average of HydropathicityLocation Prediction
CmSHN1MELO3C02345815717.799.8463.2461.66−0.67Mitochondria, Nuclear
CmSHN2MELO3C01034122024.865.8065.8070.50−0.72Nuclear
CmSHN3MELO3C01128716418.467.7848.8571.46−0.47Mitochondria, Nuclear
CmSHN4MELO3C01128617519.788.5160.6675.89−0.50Chloroplast, Nuclear
CmSHN5MELO3C00369518921.236.9665.1364.07−0.76Nuclear
CmSHN6MELO3C00450324627.209.0178.0565.41−0.67Nuclear
CmSHN7MELO3C01698019922.535.7862.2765.83−0.45Nuclear
CmSHN8MELO3C01786017019.457.7658.3663.76−0.78Nuclear
CmSHN9MELO3C01788819322.398.5549.2377.25−0.66Chloroplast, Peroxisome
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lian, Z.; Li, M.; Wang, X.; Li, M.; Li, L.; Niu, X.; Li, X.; Hou, J.; Li, Q.; Mao, W.; et al. Identification and Expression Analysis of SHN Gene Family in Melon. Horticulturae 2026, 12, 1125. https://doi.org/10.3390/horticulturae12091125

AMA Style

Lian Z, Li M, Wang X, Li M, Li L, Niu X, Li X, Hou J, Li Q, Mao W, et al. Identification and Expression Analysis of SHN Gene Family in Melon. Horticulturae. 2026; 12(9):1125. https://doi.org/10.3390/horticulturae12091125

Chicago/Turabian Style

Lian, Zhu, Mengze Li, Xiaoyu Wang, Meng Li, Lan Li, Xuxu Niu, Xiang Li, Juan Hou, Qiong Li, Wenwen Mao, and et al. 2026. "Identification and Expression Analysis of SHN Gene Family in Melon" Horticulturae 12, no. 9: 1125. https://doi.org/10.3390/horticulturae12091125

APA Style

Lian, Z., Li, M., Wang, X., Li, M., Li, L., Niu, X., Li, X., Hou, J., Li, Q., Mao, W., Li, L., Luo, C., Hu, J., & Wang, P. (2026). Identification and Expression Analysis of SHN Gene Family in Melon. Horticulturae, 12(9), 1125. https://doi.org/10.3390/horticulturae12091125

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop