Next Article in Journal
Physiological, Biochemical, and Transcriptome Analyses Reveal the Potential Role of ABA in Dufulin-Induced Tomato Resistance to Tomato Brown Rugose Fruit Virus (ToBRFV)
Next Article in Special Issue
Identification and Fungicide Control of Alternaria alternantherae Causing Leaf Spot on Celosia cristata and Alternanthera philoxeroides in China
Previous Article in Journal
Variability and Permanency: Variation in the Density of Leaf Glandular Trichomes and Terpene Composition in Mentha spicata var. crispa (Benth.) Danert and M. × piperita var. citrata (Ehrh.) Briq.
Previous Article in Special Issue
A Potassium Phosphite Solution as a Dual-Action Strategy Against Bean Anthracnose: Antifungal Activity and Defense Gene Priming
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

In Vivo Screening of Rhizobacteria Against Phytophthora capsici and Bacillus subtilis Induced Defense Gene Expression in Chili Pepper (Capsicum annuum L.)

by
José Luis Ávila-Oviedo
,
Carlos Méndez-Inocencio
,
María Dolores Rodríguez-Torres
,
María Valentina Angoa-Pérez
,
Erika Karina Martínez-Mendoza
and
Edgar Villar-Luna
*
Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional (CIIDIR), Unidad Michoacán, Departamento de Investigación, Instituto Politécnico Nacional, Justo Sierra 28, Jiquilpan 59510, Michoacán, Mexico
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Horticulturae 2026, 12(1), 59; https://doi.org/10.3390/horticulturae12010059
Submission received: 27 November 2025 / Revised: 29 December 2025 / Accepted: 30 December 2025 / Published: 3 January 2026
(This article belongs to the Special Issue Plant–Microbial Interactions: Mechanisms and Impacts)

Abstract

Phytophthora capsici (Pc) affects the production of Capsicum annuum L., particularly in susceptible genotypes like ‘California Wonder’ (CW). Beneficial bacteria offer a sustainable strategy for enhancing plant defense. Five bacterial strains, Bacillus subtilis (BMBA), Bacillus amyloliquefaciens (BMBC), Bacillus sp. (BMBH), Pseudomonas putida (BMBI), and Paenibacillus sp. (BMBP), were tested against P. capsici in chili pepper. By 11 days post-inoculation (dpi), BMBH, BMBC, BMBI and BMBP showed a trend toward accelerated symptom development, reaching severity scores of 4–5, compared with control (3.66 ± 0.55), whereas BMBA delayed disease progression (2.5 ± 0.71). At 14 dpi, control plants reached maximum severity (6.0 ± 0.0), whereas BMBA-treated plants maintained lower severity (5.0 ± 0.44). Mortality was 100% in the control, compared with 33.3% in the BMBA+Pc treatment, indicating a partial and transient protective effect. Gene expression analysis in CW roots revealed strong upregulation of PR-1, PR-5, and EAS by P. capsici. In BMBA plants, PR-1 decreased at 24 h post-inoculation (hpi), whereas EAS initially declined at 8 hpi but increase 18.5% at 24 hpi. These results indicate modulation of defense-related gene expression and reduced mortality, supporting the potential of BMBA as a partial biocontrol agent against P. capsici in chili peppers.

Graphical Abstract

1. Introduction

Capsicum annuum L. is a chili species of major economic and social importance worldwide [1]. However, its production is severely affected by the oomycete pathogen Phytophthora capsici [2], which also infects a wide range of host plants, including eggplant, tomato, watermelon, squash [3], chayote [4], pumpkin, and cucumber [5]. In chili pepper, P. capsici induces wilting and infects all plant tissues [6], including roots, stems, leaves, and fruits [7].
In susceptible chili pepper genotypes, infection by P. capsici causes root, crown, stem, foliar, and fruit blight, manifested as damping off, necrosis, and fruit lesions that render pods unmarketable [8]. In contrast, resistant genotypes activate multiple defense mechanisms in response to pathogen attack, including reinforcement of cell walls through lignin deposition [9], oxidative response involving phenylalanine ammonia lyase (PAL) [10], antioxidant enzymes such as peroxidases (POX), superoxide dismutase (SOD), polyphenol oxidase (PPO), and catalase (CAT) [11]. These responses are accompanied by the accumulation of secondary metabolites, including flavonoids [12], phenolic compounds [11], and sesquiterpene phytoalexins such as capsidiol [13]. Additionally, signaling pathways related to Ca2+ regulation [12], carbon fixation, and pyruvate metabolism [14] are induced during infection.
In Capsicum annuum, incompatible interactions with P. capsici activate defense-related genes, including PR-1 (pathogenesis-related protein 1), PR-2 (β-1,3-glucanase), PR-5 (thaumatin-like protein), and EAS (5-epi-aristolochene synthase, involved in capsidiol biosynthesis). These genes serve as markers of systemic acquired resistance (SAR) and defense pathway activation [12,15,16,17].
Beyond intrinsic plant defenses, biological control agents such as rhizobacteria can influence pathogen establishment and disease development. Beneficial rhizobacteria enhance plant nutrition, growth, and immunity by fixing nitrogen, solubilizing nutrients, producing phytohormones, or triggering induced systemic resistance (ISR) [18,19,20,21].
Rhizobacteria produce a wide range of bioactive molecules capable of activating plant signaling pathways and promoting the synthesis of defense-related compounds [22]. For instance, inoculation of C. annuum with Paenibacillus polymyxa reduces disease severity by increasing PAL, PPO, and SOD activities, as well as the expression of CaPR4 (PR4) and CaChi2 (PR3) [23].
Moreover, B. amyloliquefaciens produces elicitors such as fengycin, bacillomycin D, surfactin, bacillaene, macrolactin, difficidin, bacilysin, 2,3-butanediol, and exopolysaccharides, which induce the transcription of defense genes in Arabidopsis thaliana by activating signaling pathways regulated by salicylic acid, jasmonic acid, and ethylene [24]. Similarly, inoculation of tomato with Bacillus amyloliquefaciens TBorg1 enhances the activity of antioxidant enzymes (PPO and POX), decreases oxidative stress markers (H2O2 and MDA), and upregulates phenylpropanoid (C4H, HCT, CHI) and PR genes (PR-1, PR-5) [25]. These findings highlight the potential of rhizobacteria to trigger systemic defense responses in plants against a broad range of pathogens.
Although PR-1, PR-5, and EAS are widely recognized markers of systemic acquired resistance, few studies have investigated how rhizobacteria modulate the expression of these genes in Capsicum annuum. To address this gap, we evaluated the effects of Bacillus sp. (BMBH), Pseudomonas putida (BMBI), Bacillus subtilis (BMBA), B. amyloliquefaciens (BMBC), and Paenibacillus sp. (BMBP) on plants challenged with P. capsici. Gene expression analyses were focused on BMBA-pretreated plants, in which mRNA levels of key defense genes (EAS, PR-1, and PR-5) were quantified. This approach provides insights into how beneficial rhizobacteria modulate SAR-related defense markers in the susceptible chili pepper ‘California Wonder’.

2. Materials and Methods

2.1. Microbiological Material

The bacterial strains used in this study were Bacillus sp. (BMBH), Pseudomonas putida (BMBI), Bacillus subtilis (BMBA), B. amyloliquefaciens (BMBC), and Paenibacillus sp. (BMBP). Bacterial strains were isolated from various plant sources and rhizosphere environments in the Ciénega de Chapala region, Michoacán, Mexico: Bacillus sp. from Euphorbia antisyphillitica, Pseudomonas putida from Medicago sativa, Bacillus subtilis from Solanum lycopersicum var. cerasiforme, B. amyloliquefaciens from Echeveria sp., and Paenibacillus sp. from Solanum ferrugineum. All strains were identified by 16S rRNA gene sequencing (Sanger sequencing; Macrogen Inc., Rockville, MD, USA) and are part of the microbial collection of the Molecular Biology Laboratory at CIIDIR-IPN Michoacán. These strains had previously demonstrated biocontrol potential against P. capsici in in vitro confrontation assays, and the present study aimed to validate their effects in planta to assess their suitability as biocontrol candidates. B. subtilis has been reported in previous studies from our group as a plant growth–promoting rhizobacterium (PGPR). Phytophthora capsici (strain 6143) was kindly provided by Dr. S. P. Fernández-Pavía of the Universidad Michoacana de San Nicolás de Hidalgo.

2.2. Inoculum Preparation

Bacterial strains were cultured on potato dextrose agar (PDA) (PDA; Difco Bacto, BD, Franklin Lakes, NJ, USA) for 24 h. The resulting colonies were suspended in sterile distilled water and adjusted to a concentration of 1 × 108 CFU mL−1. Bacterial cell concentration was initially determined by plating serial dilutions and enumerating colony-forming units (CFUs) on agar plates, after which the inoculum concentration was adjusted using spectrophotometry. P. capsici was cultured on V8 agar medium, prepared by mixing 200 mL L−1 of V8 juice (V8 Vegetable Juice, Campbell Soup Company, Camden, NJ, USA), 3 g L−1 of calcium carbonate (CaCO3; Sigma-Aldrich, St. Louis, MO, USA), and 16 g L−1 of bacteriological agar (Difco Bacto, BD, Franklin Lakes, NJ, USA) in distilled water.
Infective zoospores of P. capsici were obtained from seven-day-old mycelium. To prepare the culture, an 8 mm-diameter mycelial disk was placed in a Petri dish containing 20 mL of V8 medium. The resulting mycelium was fragmented and transferred to a 0.9% sodium chloride isotonic solution (PISA®, Industrial Química, Mexico City, Mexico) for 10 min. To promote sporangium formation, the fragments were then incubated in Petri dishes with sterile distilled water at room temperature under fluorescent light for 48 h. Zoospore release was induced by subjecting the aqueous suspension to a thermal shock of −20 °C for 15 min, followed by incubation at room temperature for 20 min. The resulting aqueous suspension was collected, and the zoospore concentration was determined using a hemocytometer (Marienfeld®, Lauda-Königshofen, Germany). The P. capsici inoculum was then adjusted to 105 zoospores mL−1.

2.3. Plant Growth Conditions and Inoculation

Seeds of chili pepper ‘California Wonder’ (CW), a cultivar susceptible to P. capsici [2], were used in this study. The seeds were surface sterilized as described by [15] and germinated at 27 ± 2 °C under a 14 h photoperiod. Chili pepper seedlings were inoculated by immersing the roots in 1 mL of bacterial suspension and transplanted into pots containing 25 cm3 of sterilized sand (one seedling per pot). The plants were maintained under the temperature and photoperiod conditions described above. Watering was performed every 24 h with sterile water (SW), and fortnightly fertilization was applied using a Nitrofoska® NPK 12–12–17 (EuroChem Agro GmbH, Frankfurt, Germany; distributed by Fertilizantes Tepeyac, Mexico City, Mexico) solution (3.15 g L−1 SW). When the plants had developed four to six true leaves (approximately one-month-old), they were uniformly inoculated at the base of the stem with 105 zoospores of P. capsici.

2.4. In Vivo Effect of Rhizobacteria on the Severity of P. capsici-Induced Disease

The effect of rhizobacterial inoculation on the severity of P. capsici-induced disease in chili pepper CW plants was evaluated under a completely randomized design (Experiment 1). Treatments consisted of plants inoculated with P. capsici alone (Pc) and plants co-inoculated with P. capsici and each bacterial strain (BMBH+Pc, BMBI+Pc, BMBA+Pc, BMBC+Pc, and BMBP+Pc). Each treatment included six biological replicates. Disease severity was recorded at 4-, 7-, 11-, and 14 days post-inoculation (dpi) with P. capsici. Severity was assessed according to the scale described by [26], where 0 = No visible disease symptoms; 1 = Stem necrosis without girdling; 2 = Stem necrosis with girdling; 3 = Stem necrosis with <50% defoliation; 4 = Stem necrosis with >50% defoliation; 5 = Wilted plant; and 6 = Dead plant. Mortality (%) was calculated as the number of dead plants divided by six and multiplied by 100, with no intermediate scores assigned.

2.5. Accumulation of Defense Gene Transcripts in Chili Pepper Plants

A second experiment was established to assess the expression of defense-related genes in chili pepper (CW) plants inoculated with P. capsici (Pc), Bacillus subtilis (BMBA), or sequentially with B. subtilis followed by P. capsici (BMBA+Pc). Non-inoculated plants served as the control treatment. The experiment was conducted under a completely randomized design, with each treatment consisting of three biological replicates (three groups of three pots each). The defense-related genes analyzed included those encoding pathogenesis-related proteins (PR-1 and PR-5) and 5-epi-aristolochene synthase (EAS). Sampling was performed at 8- and 24 h post-inoculation (hpi) with P. capsici. For each replicate, roots were collected, immediately frozen in liquid nitrogen, and stored at −80 °C until further analysis.
Total RNA extraction, cDNA synthesis, and quantitative real-time PCR were performed as follows. For gene expression analysis, only root tissues were used. Frozen roots were ground to a fine powder in liquid nitrogen. Total RNA was extracted using the RNeasy® Plant Mini Kit (Qiagen, Hilden, Germany), including an on-column DNase digestion step (Qiagen), following the manufacturer’s protocol. RNA purity was assessed spectrophotometrically, and integrity was confirmed by electrophoresis on a 1% agarose gel prepared with 1× TAE buffer. First-strand cDNA was synthesized using M-MLV reverse transcriptase (Promega, Maldison, WI, USA) with oligo(dT)12-18 primers (Invitrogen, Carlsbad, CA, USA), a dNTP mix (Promega), and nuclease-free water (IDT, Integrated DNA Technologies, Coralville, IA, USA), according to the manufacturer’s instructions.
Transcript accumulation of PR-1 (Pathogenesis-related protein 1), PR-5 (Thaumatinlike protein), and EAS (5-epi-aristolochene synthase) genes was quantified by real-time PCR using the CFX Connect™ Real Time PCR Detection System (Bio-Rad, Hercules, CA, USA) with gene-specific primers (Table 1). Reactions were carried out in a final volume of 25 µL, containing 0.2 mM dNTP mix (Promega, Maldison, WI, USA), 1 mM MgCl2 (Biotecmol, Mexico City, Mexico), 0.4 µM of each primer, SYBR® Green I (1:75,000) (Molecular Probes, Invitrogen), Taq polymerase (Biotecmol), 10× buffer (Biotecmol), 5 µL of cDNA, and nuclease free water (IDT, Integrated DNA Technologies, Coralville, IA, USA). Amplification was performed under the following conditions: an initial denaturation at 95 °C for 4 min, followed by 40 cycles of 95 °C for 15 s, 65 °C for 35 s (annealing), and 72 °C for 35 s (extension). The absence of nonspecific products was confirmed by dissociation (melting curve) analysis. Relative gene expression levels (mRNA levels) were calculated using the 2−∆∆Ct method [27]. Expression of target genes was normalized using the GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene as the internal reference, and expression values were calibrated using Ct values obtained from control plants (non-inoculated CW).

2.6. Statistical Analysis

Disease severity and gene expression data in chili pepper plants were subjected to analysis of variance (ANOVA), and mean comparisons were performed using Fisher’s least significant difference (LSD) test (p < 0.05). Statistical analyses were performed using Minitab® Statistical Software version 21 (Minitab LLC, State College, PA, USA), and all graphs were generated using GraphPad Prism version 9.5 (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. In Vivo Effect of Rhizobacteria on the Severity of P. capsici Induced Disease

Initial symptoms (4 dpi) consisted of basal stem necrosis without girdling (severity rating = 1). At this early evaluation, variation in symptom severity was observed among treatments, ranging from stem necrosis without girdling to stem necrosis with girdling; however, no statistically significant differences were detected among treatments.
At 7 dpi, the BMBH+Pc treatment showed significantly higher disease severity compared with the control (Pc), with plants exhibiting stem necrosis accompanied by partial to severe defoliation (>50%) (Table 2). The remaining treatments (BMBP+Pc, BMBC+Pc, BMBA+Pc, and BMBI+Pc) did not differ significantly from the control at this time point, although numerical differences in mean severity values were observed.
At 11 dpi, control plants inoculated with P. capsici reached a mean severity rating of 3.66 ± 0.55, corresponding to stem necrosis with less than 50% defoliation. Higher mean severity values were observed in plants co-inoculated with P. capsici and the bacterial strains BMBI, BMBC, BMBH, or BMBP, which were associated with severe wilting symptoms; however, these treatments did not consistently differ significantly from the control (Table 2). In contrast, co-inoculation with B. subtilis (BMBA+Pc) resulted in a significantly lower disease severity (2.5 ± 0.71), indicating delayed disease progression, with symptoms mainly limited to stem necrosis with girdling.
At 14 dpi, control plants inoculated with P. capsici (Pc) reached the maximum severity rating (6.0 ± 0.0), corresponding to plant death. Similar severity values were observed in plants co-inoculated with BMBP+Pc, BMBC+Pc, BMBH+Pc, and BMBI+Pc, none of which differed significantly from the control. In contrast, plants treated with B. subtilis (BMBA+Pc) exhibited a significantly lower disease severity (5.0 ± 0.44), corresponding plants that were still alive, indicating delayed disease progression rather than complete suppression (Table 2).

3.2. Mortality Caused by P. capsici

Mortality caused by P. capsici was evaluated at 14 days post-inoculation (dpi), showing clear differences among treatments. The control treatment (Pc) reached 100% mortality, with plants completely collapsed and exhibiting total tissue necrosis (Figure 1a). Plants treated with BMBC and BMBP also showed 100% mortality, whereas BMBH reached 90% (Figure 1b), indicating no protective effect against P. capsici infection.
The BMBI+Pc treatment exhibited an intermediate mortality rate of 66.7%, with some plants retaining green tissue but displaying clear wilting symptoms. In contrast, the BMBA treatment performed best, showing 33.3% mortality, with surviving plants exhibiting markedly less wilting than other treatments. These results indicate that BMBA functionsas a partial biocontrol agent against P. capsici, delaying disease development whereas reducing mortality in chili pepper plants.

3.3. Accumulation of Defense Related Gene Transcripts in Chili Pepper Plants Bacterized and Challenged with Phytophthora capsici

The expression of PR-1, PR-5, and EAS genes was evaluated at 8 and 24 h post-inoculation (hpi) with P. capsici in chili pepper plants (Pc), treated with B. subtilis (BMBA) or subjected to the tripartite interaction (Pc+BMBA) (Figure 2a–c). For the PR-1 gene (Figure 2a), plants inoculated with P. capsici (Pc) showed significant upregulation at 8 hpi, reaching a maximum at 24 hpi, representing a 59.95% increase relative to 8 hpi. Plants treated with BMBA alone exhibited no significant changes in expression over time. In the tripartite treatment (BMBA+Pc), PR-1 expression increased by 64.44% at 24 hpi. At this time point, BMBA+Pc exhibited 3.22-fold higher expression compared to BMBA alone, whereas plants inoculated only with P. capsici showed a 1.5-fold increase (Figure 2a).
For the PR-5 gene (Figure 2b), maximum upregulation was observed in the Pc treatment at 8 hpi. In contrast, the tripartite treatment (BMBA+Pc) showed a 1.98-fold higher versus Pc treatment, but BMBA treatment was 1.27-fold lower compared to plants inoculated only with P. capsici (Pc).
At 24 hpi, PR-5 expression in the Pc treatment decreased by 58.60%. A similar trend was detected in the BMBA+Pc treatment, which showed early upregulation at 8 hpi followed by a 43.26% reduction at 24 hpi. In contrast, plants treated with BMBA alone exhibited relatively stable expression levels, and the gene was even downregulated at 24 hpi (Figure 2b).
For the EAS gene, upregulation in plants inoculated with P. capsici (Pc) reached its maximum level at 8 hpi, showing 2.65-fold and 1.24-fold higher than BMBA and BMBA+Pc, respectively. In the tripartite interaction (BMBA+Pc), upregulation was 2.12-fold higher compared to BMBA treatment (Figure 2c).
In a similar manner, the trend of EAS gene expression was maintained at 24 hpi; however, expression in the Pc treatment declined by 66.15%. Plants inoculated with BMBA alone exhibited a modest but sustained increase in EAS expression, maintaining comparable levels at both 8 and 24 hpi. At 24 hpi, under tripartite interaction (BMBA+Pc), EAS expression was 2.15-fold and 1.29-fold higher than in the BMBA and Pc treatments, respectively, indicating a prolonged induction of this gene relative to the individual treatments (Figure 2c).

4. Discussion

Microorganisms can establish various types of interactions with plants, including beneficial, neutral, pathogenic, and mutualistic relationships [30]. In this context, the application of certain beneficial bacteria in agriculture plays a crucial role in enhancing plant defense against plant pathogens through both direct and indirect mechanisms [31,32,33]. A key mechanism involves the production of elicitors that modulate systemic signaling networks, triggering activation of defense-related pathways [34].
Our findings indicate that not all bacterial strains confer protection against P. capsici, as B. amyloliquefaciens (BMBC), Bacillus sp. (BMBH), and Paenibacillus sp. (BMBP) either failed to reduce disease severity or may facilitate pathogen colonization. This suggests that certain bacteria, despite showing antagonistic activity in vitro [35], may influence the host defense signaling or the rhizosphere environment in ways that inadvertently favor pathogen establishment, highlighting the importance of evaluating microbial effects in planta [30,36,37].
In contrast, B. subtilis (BMBA) demonstrated a protective effect by delaying disease progression and reducing mortality. Previous studies have reported that B. subtilis strains can reduce disease incidence caused by Colletotrichum lagenarium and Pythium aphanidermatum in cucumber and tomato, respectively [38]. The protective effect of B. subtilis is mainly attributed to the production of secondary metabolites such as acetoin and 2,3-butanediol, as well as antimicrobial bacteriocins, lipopeptides, polyketides, and hydrolytic enzymes that contribute to pathogen inhibition and the induction of plant defense responses [24].
To explore the underlying defense mechanisms, we analyzed the expression of PR-1 and PR-5 [39] and EAS [40], which are commonly associated with the salicylic acid pathway and capsidiol biosynthesis [33,40]. Following inoculation with P. capsici, these genes were upregulated at 8 hpi, indicating activation of the defense response during the early stages of infection. However, this transcriptional response alone was insufficient to suppress pathogen colonization, as disease progression was still observed (Table 2).
Although strains of the genus Bacillus have been reported to induce systemic resistance in several crops, including tomato [41], bell pepper, muskmelon, watermelon, sugar beet, and tobacco [42], such responses are often associated with induced systemic resistance (ISR) mediated mainly through jasmonic acid (JA) and ethylene (ET) signaling pathways. However, the present study evaluated only a limited set of defense-related marker genes associated with salicylic acid-dependent responses (PR-1 and PR-5) and capsidiol biosynthesis (EAS).
In this context, during the early stage of the tripartite interaction (BMBA+Pc), the expression of PR-1 and PR-5 at 8 h post-inoculation (hpi) was lower than in plants inoculated only with the pathogen. These results indicate that, at this early time point, BMBA-treated plants showed a reduced early transcriptional response of these SA-dependent markers. However, only a limited set of genes and two time points were evaluated, and further studies are needed to determine whether this pattern reflects broader modulation of defense responses.
Similar patterns of defense modulation have been reported for other Bacillus strains. For example, B. amyloliquefaciens SQR9 produces extracellular compounds that activate SA, JA, and ET-mediated defenses and upregulate pathogenesis-related genes such as PR-1, PR-2, and PR-5 [24]. Additionally, B. subtilis MBI600 enhances transcription of PR-1 and GLUA (SA markers) as well as CHI3, LOXD, and PAL (JA/ET markers) in tomato, demonstrating activation of multiple defense pathways and systemic resistance [43]. In this context, although our data are limited to SA-associated markers, the observed modulation of PR-1 and PR-5 expression may contribute to the delayed disease progression and reduced stress observed during the early stages of P. capsici infection.
Notably, at 24 hpi, EAS expression in BMBA-treated plants increased relative to 8 hpi, whereas it declined in untreated plants. This pattern suggests that BMBA may later sustain or reactivate the phytoalexin capsidiol biosynthetic pathway, reinforcing defense responses during later stages of infection; however, additional time points need to be evaluated to confirm this trend. Similar observations have been reported, indicating that the timing and magnitude of defense gene activation are critical determinants of resistance or susceptibility to P. capsici and vary according to chili genotype and pathogen inoculum density [44].
The upregulation of the EAS gene plays an important role in plant defense against P. capsici. Previous studies have shown that flagellin elicitor, produced by B. amyloliquefaciens, can activate EAS1 transcription in C. annuum, promoting the accumulation of the phytoalexin capsidiol [45]. Capsidiol exhibits antifungal activity, contributes to cell wall reinforcement, and restricts pathogen penetration, with higher phytoalexin levels correlating with reduced severity of damage caused by P. capsici [46,47].
In the present study, inoculation with B. subtilis (BMBA) induced moderate and sustained expression of PR-1 and EAS in C. annuum plants, with similar expression levels observed at 8 and 24 h post-inoculation (hpi). This pattern suggests that bacterial inoculation, applied 30 days prior to pathogen challenge, may contribute to maintaining basal activation of specific defense-related pathways.
During the early stage of the tripartite interaction (BMBA+Pc), the expression of defense-related genes was lower than in plants inoculated with P. capsici alone. This observation suggests that BMBA may modulate early pathogen-induced transcriptional responses, potentially by limiting pathogen proliferation or delaying infection progression (Table 2), rather than by amplifying early defense gene expression.
At 24 hpi, bacterized plants exhibited increased EAS expression compared with untreated plants, which maintained relatively low transcript levels (18.54%). This indicates that, at later stages of infection, the capsidiol biosynthetic pathway remains active in bacterized plants, potentially contributing to enhanced phytoalexin accumulation and restriction of pathogen development in B. subtilis-treated plants.
Similar defense responses have been reported by Chávez-Díaz et al., 2017 [48], who showed that bacterial consortia composed of Pseudomonas putida S4 and Pseudomonas tolaasii A46 provided up to 90% protection against necrosis caused by P. capsici in chili pepper (C. annuum ‘pasilla’). In that study, plants received three bacterial inoculations (3 × 108 CFU) at different developmental stages, resulting in stronger induction of defense-related genes, including EAS, GLU (PR-2, β-1,3-glucanase), PR-1, and POX (PR-9, peroxidase). Compared with those findings, the lower transcriptional induction observed in the present study suggests that increasing bacterial concentration and/or inoculation frequency could enhance the level of protection against P. capsici in C. annuum ‘California Wonder’.
Overall, BMBA appears to modulate the temporal dynamics of host defense, reducing disease severity and mortality without completely preventing infection. Future studies should explore broader hormonal pathways, additional defense markers, and the effect of inoculation timing and concentration to optimize the biocontrol potential of B. subtilis in C. annuum.
Taken together, all genes were upregulated in response to the biotic stress imposed on ‘California Wonder’ chili pepper plants. These results indicate that P. capsici infection activates defense genes associated with the salicylic acid-dependent SAR (PR-1 and PR-5) and capsidiol biosynthesis (EAS), whereas treatment with B. subtilis (BMBA+Pc) maintained marginal gene expression levels, with no apparent biological impact on the pathogen.

5. Conclusions

Inoculation with the screened bacteria produced differential effects on disease severity in chili pepper plants. BMBH, BMBC, and BMBP strains appeared to facilitate P. capsici infection, whereas treatment with B. subtilis (BMBA+Pc) maintained marginal gene expression levels, with no apparent biological impact on the pathogen. The transient protective effect is likely associated with the modulation of defense-related genes, including PR-1 and EAS. Overall, these findings support the potential of B. subtilis (BMBA) as a partial biocontrol agent and highlight the importance of comprehensive assessments of plant microbe pathogen interactions prior to field application to optimize inoculation strategies for protecting susceptible C. annuum cultivars such as ‘California Wonder’.

Author Contributions

Conceptualization, E.V.-L. and C.M.-I.; methodology, E.V.-L. and C.M.-I.; software, J.L.Á.-O. and C.M.-I.; validation, C.M.-I., E.K.M.-M. and M.V.A.-P.; formal analysis, J.L.Á.-O., M.D.R.-T. and M.V.A.-P.; investigation, J.L.Á.-O., M.D.R.-T. and E.K.M.-M.; resources, E.V.-L.; data curation, E.V.-L.; writing—original draft preparation, J.L.Á.-O. and C.M.-I.; writing—review and editing, E.V.-L.; visualization, J.L.Á.-O. and C.M.-I.; supervision, E.V.-L.; project administration, E.V.-L.; funding acquisition, E.V.-L. All authors have read and agreed to the published version of the manuscript.

Funding

This research received financial support from the Secretaría de Investigación y Posgrado of the Instituto Politécnico Nacional (IPN), which provided the necessary funds to carry out this study.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

J.L.A.-O. thanks the Secretaría de Ciencia, Humanidades, Tecnología e Innovación (Secihti) Mexico, for the economic support provided through a national scholarship (780557).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Olatunji, T.L.; Afolayan, A.J. The suitability of chili pepper (Capsicum annuum L.) for alleviating human micronutrient dietary deficiencies: A Review. Food Sci. Nutr. 2018, 6, 2239–2251. [Google Scholar] [CrossRef] [Scilit]
  2. Moreira-Morrillo, A.A.; Monteros-Altamirano, Á.; Reis, A.; Garcés-Fiallos, F.R. Phytophthora capsici on Capsicum Plants: A destructive pathogen in chili and pepper crops. In Capsicum–Current Trends and Perspectives; IntechOpen: London, UK, 2023. [Google Scholar]
  3. Roberts, P.D.; McGovern, R.J.; Kucharek, T.A.; Mitchell, D.J. Vegetable Diseases Caused by Phytophthora capsici in Florida 1; University of Florida: Gainesville, FL, USA, 2001. [Google Scholar]
  4. Arroyo-Axol, J.R.; Miranda-Solares, A.K.; Zúñiga-Aguilar, J.J.; Solano-Báez, A.R.; Llarena-Hernández, R.C.; Rojas-Avelizapa, L.I.; Núñez-Pastrana, R. Chitosan mitigates Phytophthora blight in chayote (Sechium edule) by direct pathogen inhibition and systemic resistance induction. Int. J. Plant Biol. 2025, 16, 96. [Google Scholar] [CrossRef] [Scilit]
  5. Saltos, L.A.; Monteros-Altamirano, Á.; Reis, A.; Garcés-Fiallos, F.R. Phytophthora capsici: The diseases it causes and management strategies to produce healthier vegetable crops. Hortic. Bras. 2022, 40, 5–17. [Google Scholar] [CrossRef] [Scilit]
  6. Thangavelu, R.; Gopi, M. Field suppression of Fusarium wilt disease in banana by the combined application of native endophytic and rhizospheric bacterial isolates possessing multiple functions. Phytopathol. Mediterr. 2015, 54, 241–252. [Google Scholar] [CrossRef] [Scilit]
  7. Majid, M.U.; Awan, M.F.; Fatima, K.; Tahir, M.S.; Ali, Q.; Rashid, B.; Rao, A.Q.; Nasir, I.A.; Husnain, T. Genetinė ir biologinė Phytophthora capsici kontrolė aitriosios paprikos (Capsicum annuum L.) augalams: Apžvalga. Zemdirbyste 2016, 103, 419–430. [Google Scholar] [CrossRef] [Scilit]
  8. Barchenger, D.W.; Lamour, K.H.; Bosland, P.W. Challenges and strategies for breeding resistance in Capsicum annuum to the multifarious pathogen, Phytophthora capsici. Front. Plant Sci. 2018, 9, 628. [Google Scholar] [CrossRef] [Scilit]
  9. Vandana, V.V.; Suseela Bhai, R.; Ramakrishnan Nair, R.; Azeez, S. Role of cell wall and cell membrane integrity in imparting defense response against Phytophthora capsici in black pepper (Piper nigrum L.). Eur. J. Plant Pathol. 2019, 154, 359–375. [Google Scholar] [CrossRef] [Scilit]
  10. Li, Y.; Yu, T.; Wu, T.; Wang, R.; Wang, H.; Du, H.; Xu, X.; Xie, D.; Xu, X.M. The dynamic transcriptome of pepper (Capsicum annuum) whole roots reveals an important role for the phenylpropanoid biosynthesis pathway in root resistance to Phytophthora capsici. Gene 2020, 728, 144288. [Google Scholar] [CrossRef] [Scilit]
  11. Mohammadbagheri, L.; Nasr-Esfahani, M.; Abdossi, V.; Naderi, D. Genetic diversity and biochemical analysis of Capsicum annuum (bell pepper) in response to root and basal rot disease, Phytophthora capsici. Phytochemistry 2021, 190, 112884. [Google Scholar] [CrossRef] [Scilit]
  12. Lei, G.; Zhou, K.H.; Chen, X.J.; Huang, Y.Q.; Yuan, X.J.; Li, G.G.; Xie, Y.Y.; Fang, R. Transcriptome and metabolome analyses revealed the response mechanism of pepper roots to Phytophthora capsici Infection. BMC Genom. 2023, 24, 626. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Chávez-Moctezuma, M.P.; Lozoya-Gloria, E. Plant cell reports biosynthesis of the sesquiterpenic phytoalexin capsidiol in elicited root cultures of chili pepper (Capsicum annuum). Plant Cell Rep. 1996, 15, 360–366. [Google Scholar] [CrossRef]
  14. Shi, F.; Zhang, X.; Wang, Z.; Wang, X.; Zou, C. Unveiling molecular mechanisms of pepper resistance to Phytophthora capsici through grafting using ITRAQ-based proteomic analysis. Sci. Rep. 2024, 14, 4789. [Google Scholar] [CrossRef] [Scilit]
  15. Villar-Luna, E.; Rojas-Martínez, R.I.; Reyes-Trejo, B.; Gómez-Rodríguez, O.; Zavaleta-Mejía, E. Mevalonate pathway genes expressed in chilli CM334 inoculated with Phytophthora capsici and infected by Nacobbus aberrans and Meloidogyne enterolobii. Eur. J. Plant Pathol. 2017, 148, 867–881. [Google Scholar] [CrossRef] [Scilit]
  16. Yeom, S.-I.; Baek, H.-K.; Oh, S.-K.; Kang, W.-H.; Lee, S.J.; Lee, J.M.; Seo, E.; Rose, J.K.C.; Kim, B.-D.; Choi, D. Use of a secretion trap screen in pepper following Phytophthora capsici infection reveals novel functions of secreted plant proteins in modulating cell death. Mol. Plant-Microbe Interact. 2011, 24, 671–684. [Google Scholar] [CrossRef] [Scilit]
  17. Boava, L.P.; Cristofani-Yaly, M.; Stuart, R.M.; Machado, M.A. Expression of defense-related genes in response to mechanical wounding and Phytophthora parasitica infection in Poncirus trifoliata and Citrus sunki. Physiol. Mol. Plant Pathol. 2011, 76, 119–125. [Google Scholar] [CrossRef] [Scilit]
  18. Montejano-Ramírez, V.; Valencia-Cantero, E. Cross-talk between iron deficiency response and defense establishment in plants. Int. J. Mol. Sci. 2023, 24, 6236. [Google Scholar] [CrossRef] [Scilit]
  19. Rosier, A.; Medeiros, F.H.V.; Bais, H.P. Defining plant growth promoting rhizobacteria molecular and biochemical networks in beneficial plant-microbe interactions. Plant Soil. 2018, 428, 35–55. [Google Scholar] [CrossRef] [Scilit]
  20. Timofeeva, A.M.; Galyamova, M.R.; Sedykh, S.E. Plant growth-promoting soil bacteria: Nitrogen fixation, phosphate solubilization, siderophore production, and other biological activities. Plants 2023, 12, 4074. [Google Scholar] [CrossRef] [Scilit]
  21. Nascimento, F.X.; Hernandez, A.G.; Glick, B.R.; Rossi, M.J. The extreme plant-growth-promoting properties of pantoea phytobeneficialis MSR2 revealed by functional and genomic analysis. Environ. Microbiol. 2020, 22, 1341–1355. [Google Scholar] [CrossRef] [Scilit]
  22. Sahu, P.K.; Singh, S.; Gupta, A.; Singh, U.B.; Brahmaprakash, G.P.; Saxena, A.K. Antagonistic potential of bacterial endophytes and induction of systemic resistance against collar rot pathogen Sclerotium rolfsii in tomato. Biol. Control 2019, 137, 104014. [Google Scholar] [CrossRef] [Scilit]
  23. Xu, S.; Kim, B.S. Evaluation of Paenibacillus polymyxa strain SC09-21 for biocontrol of Phytophthora blight and growth stimulation in pepper plants. Trop. Plant Pathol. 2016, 41, 162–168. [Google Scholar] [CrossRef] [Scilit]
  24. Wu, G.; Liu, Y.; Xu, Y.; Zhang, G.; Shen, Q.; Zhang, R. Exploring elicitors of the beneficial rhizobacterium Bacillus amyloliquefaciens SQR9 to induce plant systemic resistance and their interactions with plant signaling pathways. Mol. Plant-Microbe Interact. 2018, 31, 560–567. [Google Scholar] [CrossRef] [Scilit]
  25. Abdelkhalek, A.; Aseel, D.G.; Király, L.; Künstler, A.; Moawad, H.; Al-Askar, A.A. Induction of systemic resistance to tobacco mosaic virus in tomato through foliar application of Bacillus amyloliquefaciens strain TBorg1 culture filtrate. Viruses 2022, 14, 1830. [Google Scholar] [CrossRef] [Scilit]
  26. Sanogo, S. Response of chile pepper to Phytophthora capsici in relation to soil salinity. Plant Dis. 2004, 88, 205–209. [Google Scholar] [CrossRef] [Scilit]
  27. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit]
  28. Trejo-Saavedra, D.L.; García-Neria, M.A.; Rivera-Bustamante, R.F. Benzothiadiazole (BTH) induces resistance to pepper golden mosaic virus (PepGMV) in pepper (Capsicum annuum L.). Biol. Res. 2013, 46, 333–340. [Google Scholar] [CrossRef] [Scilit]
  29. García-Neria, M.A.; Rivera-Bustamante, R.F. Characterization of geminivirus resistance in an accession of Capsicum chinense Jacq. Mol. Plant-Microbe Interact. 2011, 24, 172–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Zhou, X.K.; Ma, L.; Yang, Z.X.; Bao, L.F.; Mo, M.H. Rhizosphere-associated microbiota strengthen the pathogenicity of Meloidogyne incognita on Arabidopsis thaliana. Agronomy 2024, 14, 664. [Google Scholar] [CrossRef] [Scilit]
  31. Chávez-Avilés, M.N.; García-Álvarez, M.; Ávila-Oviedo, J.L.; Hernández-Hernández, I.; Bautista-Ortega, P.I.; Macías-Rodríguez, L.I. Volatile organic compounds produced by Trichoderma asperellum with antifungal properties against Colletotrichum acutatum. Microorganisms 2024, 12, 2007. [Google Scholar] [CrossRef] [Scilit]
  32. Ávila-Oviedo, J.L.; Chávez-Avilés, M.N. Efecto de los extractos hexánicos obtenidos del cultivo individual y co-cultivo de Trichoderma sp. y Bacillus subtilis sobre el crecimiento de Colletotrichum acutatum in vitro. Mex. J. Biotechnol. 2025, 10, 15–43. [Google Scholar] [CrossRef] [Scilit]
  33. Montejano-Ramírez, V.; Ávila-Oviedo, J.L.; Campos-Mendoza, F.J.; Valencia-Cantero, E. Microbial volatile organic compounds: Insights into plant defense. Plants 2024, 13, 2013. [Google Scholar] [CrossRef] [Scilit]
  34. Anil, K.; Das, S.N.; Podile, A.R. Induced defense in plants: A short overview. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2014, 84, 669–679. [Google Scholar] [CrossRef] [Scilit]
  35. Ávila-Oviedo, J.L.; Méndez-Inocencio, C.; Rodríguez-Torres, M.D.; Angoa-Pérez, M.V.; Chávez-Avilés, M.N.; Martínez-Mendoza, E.K.; Oregel-Zamudio, E.; Villar-Luna, E. Antagonistic effects and volatile organic compound profiles of rhizobacteria in the biocontrol of Phytophthora capsici. Plants 2024, 13, 3224. [Google Scholar] [CrossRef] [Scilit]
  36. Raya-Hernández, A.I.; López-Carmona, D.; Jaramillo-López, P.; Fernández-Pavía, S.P.; Carreón-Abud, Y.; Fraire-Velázquez, S.; Larsen, J. Well known microbial plant growth promoters provoke plant growth suppression and increase chili pepper wilt caused by the root pathogen Phytophthora capsici. Eur. J. Plant Pathol. 2023, 167, 787–799. [Google Scholar] [CrossRef] [Scilit]
  37. Beskrovnaya, P.; Melnyk, R.A.; Liu, Z.; Liu, Y.; Higgins, M.A.; Song, Y.; Ryan, K.S.; Haney, C.H. Comparative genomics identified a genetic locus in plant associated Pseudomonas spp. that is necessary for induced systemic susceptibility. mBio 2020, 11, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Ongena, M.; Duby, F.; Jourdan, E.; Beaudry, T.; Jadin, V.; Dommes, J.; Thonart, P. Bacillus subtilis M4 decreases plant susceptibility towards fungal pathogens by increasing host resistance associated with differential gene expression. Appl. Microbiol. Biotechnol. 2005, 67, 692–698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Zarate, S.I.; Kempema, L.A.; Walling, L.L. Silverleaf whitefly induces salicylic acid defenses and suppresses effectual jasmonic acid defenses. Plant Physiol. 2007, 143, 866–875. [Google Scholar] [CrossRef] [Scilit]
  40. Maldonado-Bonilla, L.D.; Betancourt-Jiménez, M.; Lozoya-Gloria, E. Local and systemic gene expression of sesquiterpene phytoalexin biosynthetic enzymes in plant leaves. Eur. J. Plant Pathol. 2008, 121, 439–449. [Google Scholar] [CrossRef] [Scilit]
  41. Zhou, C.; Zhu, J.; Qian, N.; Guo, J.; Yan, C. Bacillus subtilis SL18r induces tomato resistance against Botrytis cinerea, involving activation of long non-coding RNA, MSTRG18363, to decoy MiR1918. Front. Plant Sci. 2021, 11, 634819. [Google Scholar] [CrossRef] [Scilit]
  42. Choudhary, D.K.; Johri, B.N. Interactions of Bacillus spp. and plants—With special reference to induced systemic resistance (ISR). Microbiol. Res. 2009, 164, 493–513. [Google Scholar] [CrossRef] [Scilit]
  43. Samaras, A.; Roumeliotis, E.; Ntasiou, P.; Karaoglanidis, G. Bacillus subtilis Mbi600 promotes growth of tomato plants and induces systemic resistance contributing to the control of soilborne pathogens. Plants 2021, 10, 1113. [Google Scholar] [CrossRef] [Scilit]
  44. Silvar, C.; Merino, F.; Díaz, J. Differential activation of defense-related genes in susceptible and resistant pepper cultivars infected with Phytophthora capsici. J. Plant Physiol. 2008, 165, 1120–1124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Rajamanickam, S.; Nakkeeran, S. Flagellin of Bacillus amyloliquefaciens works as a resistance inducer against groundnut bud necrosis virus in chilli (Capsicum annuum L.). Arch. Virol. 2020, 165, 1585–1597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Egea, C.; Pérez, M.D.G.; Candela, M.E. Capsidiol accumulation in Capsicum annuum stems during the hypersensitive reaction to Phytophthora capsici. J. Plant Physiol. 1996, 149, 762–764. [Google Scholar] [CrossRef] [Scilit]
  47. Hwang, B.K.; Kim, Y.J. Capsidiol production in pepper plants associated with age-related resistance to Phytophthora capsici. Plant Pathol. J. 1990, 6, 193–200. [Google Scholar]
  48. Chávez-Díaz, I.F. Expresión de Respuesta de Defensa en Chile Jalapeño Inoculado con Agentes de Control Biológico de Phytophthora capsici Leo. Ph.D. Thesis, Colegio de Postgraduados, Montecillo, Mexico, 2017. [Google Scholar]
Figure 1. Mortality index at 14 days post-inoculation (dpi) with P. capsici in bacterized ‘California Wonder’ chili pepper plants. BMBA: B. subtilis. BMBP: Paenibacillus sp. BMBC: B. amyloliquefaciens. BMBH: Bacillus sp. BMBI: Pseudomonas putida. Pc: P. capsici inoculated with P. capsici. (a) Visual appearance of the symptomatic plants. (b) Mortality percentage recorded for each treatment.
Figure 1. Mortality index at 14 days post-inoculation (dpi) with P. capsici in bacterized ‘California Wonder’ chili pepper plants. BMBA: B. subtilis. BMBP: Paenibacillus sp. BMBC: B. amyloliquefaciens. BMBH: Bacillus sp. BMBI: Pseudomonas putida. Pc: P. capsici inoculated with P. capsici. (a) Visual appearance of the symptomatic plants. (b) Mortality percentage recorded for each treatment.
Horticulturae 12 00059 g001
Figure 2. Relative accumulation of defense related gene transcripts in the roots of chili pepper plants (Capsicum annuum L. ‘California Wonder’) inoculated with Bacillus subtilis and infected with Phytophthora capsici. (a) Pathogenesis-related protein 1 (PR-1); (b) Thaumatin-like protein (PR-5); (c) 5-epi-aristolochene synthase (EAS). Gene expression was analyzed at 8 h and 24 h post-inoculation (hpi) with P. capsici. Treatments: P. capsici + C. Wonder (Pc); C. Wonder + B. subtilis (BMBA); C. Wonder + B. subtilis + P. capsici (BMBA+Pc). Each bar represents the mean of three replicates, and the line on each bar is the standard error. Different uppercase letters denote significant differences among all treatments. Data were analyzed using one-way ANOVA followed by Fisher’s LSD post hoc test (p ≤ 0.05). Arrows indicate temporal changes in gene expression. Values below the horizontal dotted (red) line indicate downregulation, and values above the line indicate upregulation; the control group was set to 1 according to the 2−ΔΔCt (Livak) method.
Figure 2. Relative accumulation of defense related gene transcripts in the roots of chili pepper plants (Capsicum annuum L. ‘California Wonder’) inoculated with Bacillus subtilis and infected with Phytophthora capsici. (a) Pathogenesis-related protein 1 (PR-1); (b) Thaumatin-like protein (PR-5); (c) 5-epi-aristolochene synthase (EAS). Gene expression was analyzed at 8 h and 24 h post-inoculation (hpi) with P. capsici. Treatments: P. capsici + C. Wonder (Pc); C. Wonder + B. subtilis (BMBA); C. Wonder + B. subtilis + P. capsici (BMBA+Pc). Each bar represents the mean of three replicates, and the line on each bar is the standard error. Different uppercase letters denote significant differences among all treatments. Data were analyzed using one-way ANOVA followed by Fisher’s LSD post hoc test (p ≤ 0.05). Arrows indicate temporal changes in gene expression. Values below the horizontal dotted (red) line indicate downregulation, and values above the line indicate upregulation; the control group was set to 1 according to the 2−ΔΔCt (Livak) method.
Horticulturae 12 00059 g002
Table 1. Primer sequences used for gene expression analysis.
Table 1. Primer sequences used for gene expression analysis.
GeneAccession Number Sequences (5′–3′)
PR-1XM_016683907FW: CCCAAAATTACGCCAATCAAAG
RV: ACATCTTCACGGCACCAG
PR-5NM_001324896FW: TGGTGGAGTCTTGCAGTGC
RV: CGTGCAATGGATCGCGTG
EASAJ005588FW: GCTCAAGAAATTGAACCGCCGAAG
RV: TCTTCATTATAGACATCGCCCTCG
GAPDHAJ246011FW: GGCCTTATGACTACAGTTCACTCC
RV: GATCAACCACAGAGACATCCACAG
PR-1 (Pathogenesis-related protein 1) [28], PR-5 (Thaumatin-like protein) [29], EAS (5-epi-aristolochene synthase) [15], GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) [15]. NCBI (National Center for Biotechnology Information).
Table 2. Disease severity caused by Phytophthora capsici in bacterized chili pepper plants.
Table 2. Disease severity caused by Phytophthora capsici in bacterized chili pepper plants.
TreatmentSeverity (0–6)
471114
Pc1.0 ± 0.68 a1.5 ± 0.76 bc3.66 ± 0.55 ab6.0 ± 0.0 a
BMBA+Pc1.0 ± 0.33 a1.0 ± 0.68 b2.5 ± 0.71 c5.0 ± 0.44 b
BMBI+Pc0.33 ± 0.33 a0.83 ± 0.40 b4.16 ± 0.70 bc5.66 ± 0.21 a
BMBC+Pc1.0 ± 0.44 a3.0 ± 0.63 ab5.66 ± 0.21 a6.0 ± 0.0 a
BMBH+Pc0.33±0.33 a4.0 ± 0.63 a5.33 ± 0.21 ab5.83 ± 0.16 a
BMBP+Pc2.0 ± 1.0 a2.5 ± 0.5 abc5.83 ± 0.16 a6.0 ± 0.0 a
Values represent the mean ± standard error (n = 6), and different letters within each column indicate significant differences according to the LSD test (p ≤ 0.05). Evaluations were conducted at 4, 7, 11, and 14 days post-inoculation (dpi) with P. capsici in bacterized ‘California Wonder’ chili pepper plants. BMBA: B. subtilis. BMBP: Paenibacillus sp. BMBC: B. amyloliquefaciens. BMBH: Bacillus sp. BMBI: Pseudomonas putida. Pc: P. capsici. Disease severity scale: 0 = No visible symptoms; 1 = Necrosis at the stem base without girdling; 2 = Stem necrosis with girdling; 3 = Girdling stem necrosis with less than 50% defoliation; 4 = Girdling stem necrosis with more than 50% defoliation; 5 = Wilted plant; 6 = Dead plant [26].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ávila-Oviedo, J.L.; Méndez-Inocencio, C.; Rodríguez-Torres, M.D.; Angoa-Pérez, M.V.; Martínez-Mendoza, E.K.; Villar-Luna, E. In Vivo Screening of Rhizobacteria Against Phytophthora capsici and Bacillus subtilis Induced Defense Gene Expression in Chili Pepper (Capsicum annuum L.). Horticulturae 2026, 12, 59. https://doi.org/10.3390/horticulturae12010059

AMA Style

Ávila-Oviedo JL, Méndez-Inocencio C, Rodríguez-Torres MD, Angoa-Pérez MV, Martínez-Mendoza EK, Villar-Luna E. In Vivo Screening of Rhizobacteria Against Phytophthora capsici and Bacillus subtilis Induced Defense Gene Expression in Chili Pepper (Capsicum annuum L.). Horticulturae. 2026; 12(1):59. https://doi.org/10.3390/horticulturae12010059

Chicago/Turabian Style

Ávila-Oviedo, José Luis, Carlos Méndez-Inocencio, María Dolores Rodríguez-Torres, María Valentina Angoa-Pérez, Erika Karina Martínez-Mendoza, and Edgar Villar-Luna. 2026. "In Vivo Screening of Rhizobacteria Against Phytophthora capsici and Bacillus subtilis Induced Defense Gene Expression in Chili Pepper (Capsicum annuum L.)" Horticulturae 12, no. 1: 59. https://doi.org/10.3390/horticulturae12010059

APA Style

Ávila-Oviedo, J. L., Méndez-Inocencio, C., Rodríguez-Torres, M. D., Angoa-Pérez, M. V., Martínez-Mendoza, E. K., & Villar-Luna, E. (2026). In Vivo Screening of Rhizobacteria Against Phytophthora capsici and Bacillus subtilis Induced Defense Gene Expression in Chili Pepper (Capsicum annuum L.). Horticulturae, 12(1), 59. https://doi.org/10.3390/horticulturae12010059

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop