Next Article in Journal
Different Responses to NaCl vs. NaHCO3 Stress in Three Limonium Species: Linking Seed Phenotype to Physiological Tolerance
Next Article in Special Issue
Genome-Wide Characterization and Expression Analysis of CBP60 Gene Family in Citrullus lanatus in Response to Fusarium oxysporum Infection and Aphid Infestation
Previous Article in Journal
Effects of 1-Methylcyclopropene and Polyethylene Bags on Maintaining the Postharvest Quality in Sugar-Cored ‘Fuji’ Apple During Storage
Previous Article in Special Issue
Leucine-Rich Repeat Protein 13 Activates Immunity Against Ralstonia solanacearum and Thermotolerance in Pepper
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 12
Issue 1
10.3390/horticulturae12010031
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Optimization of a VIGS System Suitable for the Functional Study of Resistance Genes of Chinese Cabbage Against Clubroot Disease

by
Bo Zhang
†,
Ping Zhang
†,
Xin-Ming Li
,
Su-Meng Zhang
,
Xue-Mei Ma
,
Ran Yu
,
Nan Wang
* and
Rui-Qin Ji
*
Liaoning Provincial Key Laboratory of Cruciferous Vegetable Genetics and Breeding, College of Horticulture, Shenyang Agricultural University, Shenyang 110866, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work as co-first authors.
Horticulturae 2026, 12(1), 31; https://doi.org/10.3390/horticulturae12010031
Submission received: 29 October 2025 / Revised: 18 December 2025 / Accepted: 24 December 2025 / Published: 26 December 2025
(This article belongs to the Special Issue Biotic and Abiotic Stress Responses of Horticultural Plants: 2nd Edition)
Browse Figures
Versions Notes

Abstract

Clubroot disease caused by Plasmodiophora brassicae has greatly affected the quality and yield of Chinese cabbage. Excavating the key resistance genes and verifying their function is important for clarifying disease resistance mechanisms. Virus-induced gene silencing (VIGS) technology has been widely used in gene function research. However, the VIGS system specifically designed for the functional analysis of clubroot resistance genes is currently unavailable. In this study, it was found that the vacuum infiltration VIGS method is more effective for gene silencing than the seed soaking method. When seedlings were VIGS-treated using vacuum infiltration for 10 min, genes were effectively silenced on the 6th-35th days (d) after treatment, ensuring high seedling survival rate and plant transformation rate. To investigate the optimal inoculation time with P. brassicae, plants were inoculated 3, 6, 9, and 15 d after VIGS treatment. Results showed that the difference of clubroot resistance between gene-silenced and control plants was most significant when plants were inoculated 6 d after VIGS treatment. This result suggests that, when the target gene began to silence (6 d after VIGS), immediate inoculation with P. brassicae should be suitable for the functional study of clubroot-resistance genes.

1. Introduction

Chinese cabbage (Brassica rapa) has become one of the popular vegetable crops worldwide due to its high nutritional value and minimal economic cost [1]. The clubroot disease caused by Plasmodiophora brassicae is a soil-borne disease of cruciferous vegetables [2], such as Chinese cabbage. Currently, the occurrence of clubroot disease has been rapidly and widely expanding and spreading in the world, which results in a decline in the yield and quality of cruciferous vegetables in general [3,4]. Therefore, exploring disease-resistant genes, verifying their functions, and applying them to breeding practice will provide important clues for the study of resistance to clubroot disease in Chinese cabbage [5,6]. In modern times, molecular work aimed at deciphering plant–pathogen interactions has generally produced valuable insights into genes and pathways that may be important to design strategies for enhancing disease resistance in plants [7,8]. However, due to the extremely low transformation efficiency of Chinese cabbage, most of the functions have not been validated. The tobacco rattle virus (TRV)-induced gene silencing (VIGS) has been widely accepted as an important tool for studying plant gene function due to its high efficiency, convenience [9,10,11,12,13], overcoming functional redundancy of genes, avoiding genotype-specific effects between different genetic backgrounds [14], and almost no viral harm [15]. VIGS has been used for verifying the function of some genes in Chinese cabbage. Silencing of BrERF2/BrERF109 using TRV-BrFLSs VIGS technology significantly upregulated the expression of BrFLS1 and BrFLS3.2, promoted flavonoid accumulation, and delayed leaf senescence [16]. The use of VIGS technology induced the silencing of wheat (Triticum aestivum) gene WT-1, thereby reducing tiller bud initiation [17]. VIGS of the cotton (Gossypium hirsutum) gene GhPRL confirmed its essential role in maintaining plant health under cold stress, with GhPRL-silenced plants showing greater phenotypic damage, increased ion leakage, and reduced antioxidant activity [18]. The VIGS methods utilized in different experiments are notably different in currently reported research.
At present, there are two main methods for VIGS virus transfection: seed soaking and vacuum infiltration. The seed soaking method is the application of solution containing exogenous DNA to soak seeds [19]. The construction experiment of the VIGS system for the genes of Atriplex canescens showed that soaking germinating seeds in Agrobacterium transfection solution with OD600 = 0.8–1 for 40 min can silence the expression of AcPDS gene [20]. Vacuum infiltration method is a technique that uses negative pressure to immerse transfection solution into tissues [21], which exhausts air from the microcavities and creates gaps inside the seedlings. It is easier for exogenous DNA or Agrobacterium resuspended solution to penetrate into plant cells to improve gene transformation efficiency [22]. Vacuum infiltration not only has high conversion efficiency but also is easy to operate and takes less time to conduct [23]. Previous results showed that the expression of BcPDS gene was inhibited by using vacuum infiltration for 5 min and co-cultivation for 15 h [24]. Vacuum soaking for 10 min (0.5 kPa, 5 min per time) can silence the expression of Atriplex canescens AcPDS gene [25]. Vacuum infiltration at 0.8 Mpa for 15 min achieves a silencing rate of over 75% for the “Bartzella” petal IpAUX1 gene. It can be seen that the treatment conditions used for different crops are different [26]. Currently, there are few effective VIGS systems available for identifying resistance genes to clubroot disease.
A key challenge in functionally characterizing clubroot resistance genes using VIGS hinges on the inoculation timeline. An inoculation too soon after VIGS may precede effective silencing, and one too late can lead to attenuated disease symptoms. The objectives of this study were to construct a suitable VIGS system in Chinese cabbage to identify the function of clubroot-resistance genes by optimizing the transfection method of VIGS silencing and the P. brassicae-inoculation time. The result will provide an important technical system for functional verification of defense genes against clubroot disease in Chinese cabbage.

2. Materials and Methods

2.1. Preparation of Test Materials

The Chinese cabbage variety “E05” used in this study was provided by the Laboratory of Genetics, Breeding and Biotechnology of Shenyang Agricultural University. Chinese cabbage BrUFO was used as a representative of defense genes for subsequent VIGS experiments. The suspension of P. brassicae was prepared as follows: fresh swollen roots of Chinese cabbage infected with P. brasiccae were collected from an experimental field at the Shenyang Agricultural University. One hundred grams of swollen roots were washed with sterile water and homogenized in a blender (Joyoung, Shandong, China) and subsequently diluted to 500 mL with double distilled water (ddH2O). Diluted suspensions were incubated in the dark at room temperature for 4 d to activate P. brassicae.

2.2. Preparation of Transfection Solutions of pTRV1+pTRV2-00 or pTRV1+pTRV2-BrUFO

To construct the pTRV2-BrUFO recombinant vector, 300 bp of BrUFO cDNA needs to be acquired firstly. In detail, total RNA was extracted from the roots of Chinese cabbage using the RNA pure kit (Acres Bio, Hunan, China) and reversed into cDNA using the HiScript 1st Strand cDNA Synthesis Kit Reverse Transcription Kit (Vazyme, Nanjing, China). The target fragment of BrUFO was cloned using the above cDNA and BrUFO-300-F/R primers (F: 5′ ATGGAAACAAATATGTTCA 3′, R: 5′ CTTCCTCCCCGACACAACTGT 3′). The BrUFO fragment was ligated into pTRV2 vector to acquire pTRV2-BrUFO recombinant vector using the ClonExpress II One Step Cloning Kit (Vazyme, Nanjing, China). The recombinant vector pTRV2-BrUFO was detected using TRV-F/R universal primers (F: 5′ GTGTCAACAAAGATGGACATTGTT 3′, R: 5′ TAAAACTTCAGACACGGATCTACTT 3′). pTRV2-BrUFO, pTRV1, and pTRV2 were, respectively, transferred into the competent cells of Agrobacterium GV3101 [6] and then Agrobacterium cells were centrifuged at 6000 rpm/min for 20 min and resuspended with Magnesium chloride (MgCl2 · 6H2O) suspension [27]. The transfection solution pTRV1 was mixed with those of pTRV2 or pTRV2-BrUFO in the same proportions, and the concentration of the bacterial mixture was adjusted to an absorbance value of 1.0 at OD600 [28].

2.3. Optimization of VIGS Method for Gene Silencing in Chinese Cabbage

The seeds “E05” were put into a triangular bottle filled with 50 mL ddH2O and shaken at 200 rpm in the dark at 28 °C until germination. To evaluate which method had the highest transfection efficiency, seedlings were exposed to each transfection solution either by soaking or vacuum infiltration methods. The experimental design is shown in Figure 1. For the soaking method, germinated seeds were transferred to transfection solutions pTRV1+pTRV2-00 or pTRV1+pTRV2-BrUFO for soaking for 0.5 h, 1 h, or 2 h. For the vacuum infiltration method, germinated seeds were vacuum infiltrated with transfection solutions pTRV1+pTRV2-00 or pTRV1+pTRV2-BrUFO at a pressure of −2 kPa for 10 min, 15 min, and 20 min using a vacuum pump (FY-1.5C-N, VALUE, China). The infiltrated or soaked seedlings were rinsed twice with sterile water and sowed in nutrient soil (vsubstrate: vsoil = 2:1) in an incubator at 23 °C with 16 h light/8 h dark cycles. Untreated plants served as controls. A randomized block design was used with three replications, and each replication was soaked with 70 seeds.

2.4. Detection of the Silencing Efficiency of Target Gene

Silencing efficiency of target gene was analyzed by detecting the dynamic changes in its expression in pTRV1+pTRV2-00 and pTRV1+pTRV2-BrUFO treated plants. After infiltrating or soaking treatment, the growth status of the treated plants was recorded, and the expression levels of the target gene in treated plants were analyzed using quantitative reverse-transcription polymerase chain reaction (qRT-PCR). In detail, total RNA was extracted from pTRV1+pTRV2-00 or pTRV1+pTRV2-BrUFO treated plants, using the RNA pure kit (Acres Bio, Hunan, China), and reversed into cDNA using the HiScript 1st Strand cDNA Synthesis Kit Reverse Transcription Kit (Vazyme, NJ). The qRT-PCR was conducted using ChamQ Universal SYBR qPCR Master Mix* reagent (Vazyme, NJ) with the resulting cDNA template, internal reference primer BrActin-F/R, and specific primer qRT-BrUFO-F/R (Table 1) under the QuantStudio6 Real Time PCR System (ThermoFisher, Waltham, MA, USA). The relative gene expression data was analyzed using the 2−ΔΔCt method. All treatments were performed in triplicate with five randomly selected plants per treatment for each replicate. Duncan’s multiple range tests (a = 0.05) were conducted to evaluate significant differences. Data were analyzed by SPSS 11.5 (IBM, Armonk, NY, USA), and OriginPro 7.5 (OriginLab Corp., Northampton, MA, USA) and SigmaPlot 12.5 (Systat Software, Inc., San Jose, CA, USA) were used to produce graphs.

2.5. Optimization Inoculation Time of P. brassicae for VIGS-Treated Chinese Cabbage

To determine the optimal P. brassicae-inoculation time, the Chinese cabbage seedlings were inoculated with P. brassicae on the 3rd d, 6th d, 9th d, 12th d, or 15th d after VIGS treatment by gently injecting 1 mL of P. brassicae suspension into the soil around the roots. The control test was conducted by replacing the P. brassicae suspension with sterile water to treat the roots.
After 15 d of P. brassicae infection, the substrate covering the surface of the plant roots was gently removed every day and the swelling of the roots was observed. When the typical swelling symptom of clubroot disease was obvious, the plants were uprooted for assessment as the onset of the disease. Mortality and disease incidence was observed and recorded, and disease index was calculated following previously published formulas [29,30]. Dates were analyzed using a randomized block design with three replicates and 30 seedlings per experimental unit by Student’s t test (a = 0.05 and a = 0.01).

3. Results

3.1. Construction of pTRV2-BrUFO Recombinant Vector

The first 300 bp sequence of BrUFO’s cDNA was cloned (Figure 2a) and connected into the pTRV2 vector (Figure 2b). The results of PCR identification showed that the product of control (pTRV2) was 192 bp, while the product of pTRV2-BrUFO was 492 bp (Figure 2c). The recombinant vector pTRV2-BrUFO was successfully constructed.

3.2. The Transfection Efficiency of VIGS Treatment Using Seed Soaking Method

To find the optimal time using the soaking treatment, seedlings of Chinese cabbage were soaked in the transfection solutions of pTRV1+pTRV2-00 or pTRV1+pTRV2-BrUFO for 0.5, 1, or 2 h, and gene silencing and plant mortality rate were investigated. The results of differential expression patterns of target gene showed that the downregulation of the target gene persisted for approximately 12 d in both the 0.5 and 1 h treatment groups; gene downregulation occurred on the 12–24th d post-soaking in the 0.5 h group and the highest efficiency (80%) occurred on the 18th d. For the 6–18th d post-soaking in the 1 h group, the highest efficiency (30%) occurred on the 12th d. While, in the 2 h treatment group, the downregulated expression of target gene occurred on the 3–18th d after seed soaking, lasting for about 15 d, and the highest efficiency (80%) occurred on the 7–14th d (Figure 3). These results suggested that, the longer the soaking time, the earlier gene silencing occurs and the longer the silencing duration.
Observations of growth status revealed that, in both 0.5 and 1 h treatment groups, all plants soaked with pTRV1+pTRV2-00 and pTRV1+pTRV2-BrUFO grew normally. But, in the 2 h treatment groups, the plants began to die from the 7th d after soaking treatment. But no significant difference of mortality rate was found between the treatment groups of pTRV1+pTRV2-00 and pTRV1+pTRV2-BrUFO (Table 2). Therefore, the time for VIGS treatment with seed soaking method should be less than 2 h.
After a comprehensive analysis of the data on silencing efficiency and plant mortality rate, it was found that, as the soaking time prolongs, the mortality rate of plants increases. The optimal seed soaking time for VIGS treatment should be 0.5 h, which can cause the target gene to be downregulated for 12 d and an 80% silencing rate.

3.3. The Transfection Efficiency of VIGS Treatment Using Vacuum Infiltration Method

To find the optimal treatment time for vacuum infiltration method, we vacuum infiltrated the seedlings of Chinese cabbage in the transfection solutions of pTRV1+pTRV2-00 or pTRV1+pTRV2-BrUFO for 10 min, 15 min, or 20 min and investigated the gene silencing efficiency and plant mortality rate. Gene expression analysis found that, in the 10 min treatment group, the downregulated expression of target gene occurred on the 6–36th d after vacuum treatment, lasting for about 30 d, and the highest efficiency (80%) occurred on the 6th d. Meanwhile, it persisted for 33 d (3–36th d after vacuum treatment) in the 15 min treatment group, with the highest efficiency (50%) occurring on the 18th d, and 12 d (6–18th d after vacuum treatment) in the 20 min treatment group, with the highest efficiency (40%) occurring on the 6th d (Figure 4). These results indicated that the vacuum infiltration time must be limited to within 20 min. When vacuum-infiltrated for 10–15 min, the silence period could be extended to over 30 d.
Observations of growth status revealed that all plants in the 10 min vacuum-treatment group with pTRV1+pTRV2-00 or pTRV1+pTRV2-BrUFO grew normally, while some plants died in both 15 min and 20 min vacuum treatment groups. In the 15 min treatment group, plants began to die on the 21st d when infiltrating in the pTRV1+pTRV2-BrUFO solution and on the 42nd d after infiltrating in pTRV1+pTRV2-00 solution. In the 20 min treatment group, plants began to die on the 21st d after infiltrating in the pTRV1+pTRV2-BrUFO solution and on the 14th d after vacuum infiltrating in pTRV1+pTRV2-BrUFO solution (Table 3). These results suggested that vacuum infiltration for more than 15 min can cause plant death. The optimal vacuum infiltration time for VIGS treatment of Chinese cabbage plants should be 10 min, which was significantly better than the soaking method. The duration of 10 min VIGS treatments extended the silencing period of target genes to more than 30 d and enhanced the silencing rate to 80%.

3.4. Optimization of P. brassicae-Inoculation Time and Disease Resistance Investigation for Gene-Silenced Plants

In order to obtain the most suitable inoculation time to detect the clubroot resistance of gene-silenced plants, VIGS-treated plants (obtained by vacuum filtration of seedlings) were inoculated with P. brassicae on the 3rd d, 6th d, 9th d, 12th d, or 15th d after VIGS treatment. The investigation results showed that the incidence rate and disease index in BrUFO-silenced (pTRV1+pTRV2-BrUFO treatment) groups was lower than that in control (pTRV1+pTRV2-00 treated) group. And the disease progress was postponed in BrUFO-silenced plants. Especially, on the 6th or 9th d inoculation group, the difference of incidence rate and disease index was highest between BrUFO-silenced and control groups (Figure 5b,c). The incidence rate in BrUFO-silenced groups was 10–20%, while it was 40–60% in the control group; the disease index in BrUFO-silenced groups was 2–5%, while it was 40–50% in the control group (Figure 5). These results indicated that P. brassicae inoculation on the 6th d to 9th d after VIGS treatment clearly demonstrates the resistance function of target gene to clubroot disease after gene silencing.

4. Discussion

Since the development of the VIGS system as a useful genetic tool to verify the function of genes linked to specific traits of interest [31], VIGS has been widely applied to effectively inhibit the expression of target genes in numerous plant species of agricultural or environmental significance. In tomato (Solanum tuberosum L.), tomato yellow leaf curl virus (TYLCV) genome was silenced using VIGS technology and this eliminated the curling and yellowing phenomenon of S. tuberosum L. leaves [32]. The use of VIGS technology to silence the cotton (Gossypium spp.) gene GhSDR500 increased susceptibility to Verticillium dahliae and reduced the expression of genes related to the pathogenesis [33]. The use of VIGS technology to silence the rice (Oryza sativa) gene OsRPM1 increased susceptibility to Xanthomonas oryzae pv. oryzae, leading to more severe disease symptoms [34].
At present, seed soaking and vacuum infiltration are two common methods for VIGS virus transfection. There have been many related reports on the application of these two methods. Wang et al. (2024) successfully silenced HtMYB2 gene by soaking the peeled S. tuberosum L. in a transfection solution with OD600 = 0.6 for 2 d through the VIGS experiment. The silencing rate was as high as 73.96% [35]. Wan et al. (2024) successfully silenced the expression of PDS gene by soaking seeds in bacterial solution with OD600 = 0.2 for 24 h in the VIGS experiment of Cucumis melo L. crops [36]. The silencing rates of this gene in Cucurbita moschata, Cucumis melo L., and Citrullus lanatus exceeded 50%, 20%, and 20%, respectively [36]. The vacuum method has been widely used, and the vacuum conditions for different crop seeds were various. Phytoene desaturase (PDS) was a key enzyme in the carotenoid biosynthesis pathway. Mutations in the PDS gene could affect the biosynthesis of chlorophyll, carotenoids, and gibberellins, leading to plant dwarfism and whitening phenomena [37]. Peng et al. (2024) found that 0.8 kPa for 5 min (0.8 kPa/5 min) can efficiently silence CsPDS in Camellia sinensis (L.) O. Kuntze., resulting in the highest survival rate and albinism rate [38]. A 15 kPa vacuum for 120 s can effectively silence ApTT8 gene expression and thereby inhibit the expression of anthocyanin structural genes downstream of Agapanthus praecox subsp. orientalis [20]. Wan et al. (2024) successfully silenced the Cucumis melo L. gene PDS using VIGS technology under a vacuum pressure of −1.0 kPa for 5 min and then soaking the seedlings for 24 h [36]. Vacuum infiltration of Bacillus subtilis for 60 min could successfully silence ZmMAC3 gene expression and achieve the highest gene silencing efficiency in Zea mays L. plants [39], which suggested that different experiments required distinct processing conditions for VIGS treatment. In this study, two VIGS transfection techniques, vacuum infiltration and seed dipping, were evaluated and compared, and it was found that vacuum infiltration was easier and more effective. The vacuum infiltration method took less time and resulted in a lower initial mortality rate of the plants (Table 2 and Table 3). The optimal seed soaking time for VIGS treatment should be 0.5 h, which could cause the target gene to be downregulated for 12 d and with an 80% silencing rate. The optimal vacuum infiltration time for VIGS treatment of Chinese cabbage plants should be 10 min, which extended the silencing period of target gene to more than 30 d and enhanced the silencing rate to 80%. In summary, although the highest silencing efficiencies of seed soaking and vacuum infiltration methods were both 80%, the silencing period of vacuum infiltration for 10 min was significantly longer than soaking for 0.5 h. Finally, vacuum infiltration for 10 min should be the optimal VIGS treatment method.
When using VIGS technology to identify resistance genes of different pathogens in different species, the inoculation period of pathogens varies. After silencing CMV-2a in Cucumis sativus L. by VIGS, inoculating cucumber mosaic virus (CMV) at 14th d, the CMV-2a gene is silenced on the 7th d after inoculation of CMV and can effectively inhibit the spread of CMV in plants, delay the onset time, and achieve the best prevention and control effect [40]. Silencing MeHsfB3a gene in Manihot esculenta Crantz by VIGS and injecting Xanthomonas phoseoli pv.manihotis (Xpm) pathogen into cassava leaves after 45 d of VIGS treatment, the silencing of MeHsfB3a increased the sensitivity of cassava to Xpm pathogen on the 3rd and 6th d after Xpm inoculation [41]. To identify candidate genes conferring resistance to clubroot disease on Chinese cabbage, it is crucial to determine the appropriate inoculation period after silencing the candidate genes using the VIGS system. Generally, if inoculations are performed too early, the target genes may not yet be silenced. If inoculations are performed too late, the plants may become less susceptible to the disease. Results from this study showed that P. brassicae inoculation on the 6th to the 9th d after VIGS treatment can result in the most significant difference in disease incidence between the BrUFO-silencing group and the control group, which can more clearly demonstrate the function of target gene on clubroot disease. When Chinese cabbage BrUFO was silenced by TRV-based VIGS, the expression of target gene decreased, and silencing continued for about 6–30 d.

5. Conclusions

This study explored a VIGS system suitable for functional identification of clubroot-resistance genes using the BrUFO gene as an example. It was found that using vacuum infiltration VIGS method to treat Chinese cabbage seedlings for 10 min extended the silencing period beyond 30 d and improved the survival rate of young seedlings. Collectively, these findings demonstrate that vacuum infiltration is a more suitable method for exploring and identifying clubroot-resistance genes in Chinese cabbage than the seed soaking method when using VIGS technology. We determined that P. brassicae inoculation in the 6–9th d (the period of the gene began to be silenced) after VIGS treatment can effectively evaluate clubroot resistance in effective time to evaluate clubroot resistance in gene-silenced Chinese cabbage plants. This study provides a theoretical basis for the study of clubroot-resistance genes of Chinese cabbage using VIGS technology.

Author Contributions

B.Z.: figures, study design, data collection, data analysis, data interpretation, writing and editing; P.Z.: figures, study design, data collection, data analysis, data interpretation, writing and editing; X.-M.L. and S.-M.Z.: literature search and image organization; X.-M.M. and R.Y.: literature search; N.W.: funding acquisition, supervision; R.-Q.J.: funding acquisition, conceptualization, formal analysis, supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China under grant 32102377 and 32272717 and the Science and Technology Mission Project of Shenyang under grant 22-319-2-05.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare that they have no competing interests.

Abbreviations

The following abbreviations are used in this manuscript:
VIGSVirus-induced gene silencing
P. brassicaePlasmodiophora brassicae
TRVTobacco rattle virus
CMVCucumber mosaic virus

References

  1. Kim, J.; Lim, J.; Jeong, Y.; Yu, H.; Park, Y.; Lim, C.; Chae, W. Only 11 simple sequence repeats needed to identify Chinese Cabbage (Brassica rapa L.) Cultivars. Horticulturae 2023, 9, 1123. [Google Scholar] [CrossRef]
  2. Kang, H.; Lin, Z.; Yuan, X.; Shi, Y.; Xie, X.; Li, L.; Fan, T.; Li, B.; Chai, A. The occurrence of clubroot in cruciferous crops correlates with the chemical and microbial characteristics of soils. Front. Microbiol. 2024, 14, 1293360. [Google Scholar] [CrossRef] [PubMed]
  3. Lan, M.; Hu, J.; Yang, H.; Zhang, L.; Xu, X.; He, J. Phytohormonal and metabolism analysis of Brassica rapa L. ssp. pekinensis with different resistance during P. brassicae infection. Inst. Hortic. Crops 2020, 44, 751–767. [Google Scholar] [CrossRef]
  4. Muhammad, K.; Rahman, S.U.; Sadaf-Ilyas, K.; Abid, A.; Hammed, G.; Nan, H. Plasmodiophora brassicae-The causal agent of clubroot and its biological control/suppression with fungi–review. S. Afr. J. Bot. 2022, 147, 325–331. [Google Scholar] [CrossRef]
  5. Zhao, Y.; Zhu, X.; Chen, X.; Zhou, J. From plant immunity to crop disease resistance. J. Genet. Genom. 2022, 49, 693–703. [Google Scholar] [CrossRef]
  6. Zhang, B.; Feng, H.; Ge, W.; Wang, X.; Zhang, J.; Ji, R. BrUFO positively regulates the infection of Chinese cabbage by Plasmodiophora brassicae. Front. Plant Sci. 2023, 14, 1128515. [Google Scholar] [CrossRef]
  7. Grover, A.; Gowthaman, R. Strategies for development of fungus-resistant transgenic plants. Curr. Sci. 2003, 84, 330–340. [Google Scholar]
  8. Duraisamy, P.; Andrea, M.; Wayne, T.; Aitken, E.; Chen, A. Fusarium yellows of ginger (Zingiber officinale Roscoe) caused by Fusarium oxysporum f. sp. zingiberi is associated with cultivar-specific expression of defense-responsive genes. Pathogens 2023, 12, 141. [Google Scholar] [CrossRef]
  9. Senthil-Kumar, M.; Mysore, K. Tobacco rattle virus-based virus-induced gene silencing in Nicotiana benthamiana. Nat. Protoc. 2014, 9, 1549–1562. [Google Scholar] [CrossRef]
  10. Ellison, E.; Nagalakshmi, U.; Gamo, M.; Huang, P.; Dinesh-kumar, S.P.; Voytas, D.F. Multiplexed heritable gene editing using RNA viruses and mobile single guide RNAs. Nat. Plants 2022, 6, 620–624. [Google Scholar] [CrossRef]
  11. Nagalakshmi, U.; Meier, N.; Liu, J.; Voytas, D.F.; Dinesh-kumar, S.P. High-efficiency multiplex biallelic heritable editing in Arabidopsis using an RNA virus. Plant Physiol. 2022, 189, 1241–1245. [Google Scholar] [CrossRef] [PubMed]
  12. Oh, Y.; Kim, S. RPS5A promoter-driven Cas9 produces heritable virus-induced genome editing in Nicotiana attenuata. Mol. Cells 2021, 44, 911–919. [Google Scholar] [CrossRef] [PubMed]
  13. Tian, Y.; Fang, Y.; Zhang, K.; Zhai, Z.; Yang, Y.; He, M.; Cao, X. Applications of Virus-Induced Gene Silencing in Cotton. Plants 2024, 13, 272. [Google Scholar] [CrossRef] [PubMed]
  14. Kim, Y.; Kim, H.; Yun, D.; Lee, S.; Kim, J.; Oh, S.; Kim, Y.; Jung, K.; Park, S. Redundant role of OsCNGC4 and OsCNGC5 encoding cyclic nucleotide-gated channels in rice pollen germination and tube growth. Plant Physiol. Biochem. 2024, 208, 108522. [Google Scholar] [CrossRef]
  15. Zhang, Y.; Niu, N.; Li, S.; Liu, Y.; Xue, C.; Wang, H.; Liu, M.; Zhao, J. Virus-induced gene silencing (VIGS) in Chinese Jujube. Plants 2023, 12, 2115. [Google Scholar] [CrossRef]
  16. Yue, L.; Kang, Y.; Zhong, M.; Kang, D.; Zhao, P.; Chai, X.; Yang, X. Melatonin delays postharvest senescence through suppressing the inhibition of BrERF2/BrERF109 on flavonoid biosynthesis in flowering Chinese Cabbage. Int. J. Mol. Sci. 2023, 24, 2933. [Google Scholar] [CrossRef]
  17. Maqbool, R.; Nagarajan, R.; Mutti, S.; Gill, K. Wheat Tiller-1 (WT-1), a GRAS domain encoding gene, controls both tillering and spikelet number per spike in wheat. Plant Mol. Biol. 2025, 115, 128. [Google Scholar] [CrossRef]
  18. Abro, A.; Abbas, M.; Liu, Q.; Jie, Z.; Xu, Y.; Hou, Y.; Zhou, Z.; Iqbal, R.; Liu, F.; Cai, X. Genetic insights into cold tolerance in cotton: GWAS identified GhPRL gene responsible for cold tolerance in cotton at seedling stage. Ind. Crop. Prod. 2025, 237, 122164. [Google Scholar] [CrossRef]
  19. Jiang, J.; Ma, H.; Zhou, Z.; Tian, S.; Li, K. Study on the genetic breeding effects of introducing exogenous DNA into soybeans using improved soaking method. Hunan Agric. Sci. 2004, 10–13. [Google Scholar] [CrossRef]
  20. Chen, G.; Song, J.; Zhang, Y.; Guo, X.; Shen, X. Development and application of virus-induced gene silencing (VIGS) for studying ApTT8 gene function in Agapanthus praecox ssp. orientalis. Sci. Hort. 2024, 324, 112595. [Google Scholar] [CrossRef]
  21. Ren, H.; Li, D.; Yu, Y.; Lv, W.; Hao, X.; Wang, X.; Wang, Y. Research and application progress on the construction strategy of plant VIGS vector. J. Hort. 2024, 51, 1455–1473. [Google Scholar] [CrossRef]
  22. Zhang, Y.; Adrian, J. Calter research on the transformation of plants by vacuum infiltration method. Biotechnology 1999, 37–38. [Google Scholar] [CrossRef]
  23. Manickavasagam, M.; Subramanyam, K.; Ishwarya, R.; Elayaraja, D.; Ganapathi, A. Assessment of factors influencing the tissue culture-independent Agrobacterium-mediated in planta genetic transformation of okra. Plant Cell Tissue Organ 2015, 123, 309–320. [Google Scholar] [CrossRef]
  24. Mardini, M.; Kazancev, M.; Ivoilova, E.; Utkina, V.; Vlasova, A.; Demurin, Y.; Soloviev, A.; Kirov, I. Advancing virus-induced gene silencing in sunflower: Key factors of VIGS spreading and a novel simple protocol. Plant Methods 2024, 20, 122. [Google Scholar] [CrossRef] [PubMed]
  25. Feng, S.; Chen, J.; Bao, A. Establishment and optimization of a tobacco rattle virus -based virus-induced gene Silencing in Atriplex canescens. Plant Methods 2025, 21, 107. [Google Scholar] [CrossRef] [PubMed]
  26. Fan, L.; Zhou, W.; Shang, S.; Zhou, S.; Gao, S.; Shaaban, M.; Wang, Z.; Shi, G. Deciphering the auxin-ethylene crosstalk in petal abscission through auxin influx carrier IpAUX1 of Itoh peony ‘Bartzella’. Postharvest Biol. Tec. 2024, 216, 113060. [Google Scholar] [CrossRef]
  27. Zhou, P.; Peng, J.; Zeng, M.; Wu, L.; Fan, Y.; Zeng, L. Virus-induced gene silencing (VIGS) in Chinese narcissus and its use in functional analysis of NtMYB3. Hort. Plant J. 2021, 7, 565–572. [Google Scholar] [CrossRef]
  28. Zhang, F.; Wang, C.; Zhang, J.; Zhang, J.; Chen, Y.; Liu, G.; Zhao, Y.; Hao, F.; Zhang, J. A novel VIGS method by agroinoculation of cotton seeds and application for elucidating functions of GhBI-1 in salt-stress response. Plant Cell Rep. 2018, 37, 1091–1100. [Google Scholar] [CrossRef]
  29. Horiuchi, S.; Hori, M. A simple greenhouse technique for obtaining high levels of clubroot incidence. Bull. Chugoku Natl. Agric. Exp. Stn. Ser. E 1980, 17, 33–55. Available online: https://api.semanticscholar.org/CorpusID:130296039 (accessed on 23 December 2025).
  30. Lv, M.; Liu, Y.; Wu, Y.; Zhang, J.; Liu, X.; Ji, R.; Feng, H. An improved technique for isolation and characterization of single-spore isolates of Plasmodiophora brassicae. Plant Dis. 2021, 105, 3932–3938. [Google Scholar] [CrossRef] [PubMed]
  31. Zhang, M.; Rao, Y.; Chen, X.; Shi, Y.; Wei, C.; Wang, X.; Wang, L.; Xie, C.; Pan, C.; Chen, J. Function verification of a chlorophyll a/b binding protein gene through a newly established tobacco rattle virus-induced gene silencing system in Kandelia obovata. Front. Plant Sci. 2023, 14, 1245555. [Google Scholar] [CrossRef] [PubMed]
  32. Bian, Y.; Zhang, X.; Chen, C.; Wang, G.; Zhang, P.; Liu, G.; Ma, F.; Bao, Z. Establish an efficient inoculation system of tomato yellow leaf curl virus to assist tomato resistance breeding. Sci. Hort. 2024, 324, 112567. [Google Scholar] [CrossRef]
  33. Abbas, M.; Umer, J.; Abro, A.; Zhang, M.; Lu, C.; Liu, Q.; Wang, H.; Yang, M.; Liu, Y.; Huang, W.; et al. A short-chain dehydrogenase/reductase gene confers resistance to Verticillium wilt in cotton and reveals adaptive selection during domestication. Plant Stress 2025, 17, 100971. [Google Scholar] [CrossRef]
  34. Lakshmi, A.; Kulshreshtha, A.; Mondal, K.; Dasgupta, I.; Tyagi, A.; Kumar, S.; Kalaivanan, N.S.; Mrutyunjaya, S.; Sreenayana, B.; Rashmi, E.R.; et al. Functional validation of OsRPM1 as a positive regulator of bacterial blight resistance in rice via virus-induced gene silencing. Folia Microbiol. 2025, 1–11. [Google Scholar] [CrossRef]
  35. Wang, H.; Zheng, Y.; Zhou, Q.; Li, Y.; Liu, T.; Hou, X. Fast, simple, efficient agrobacterium rhizogenes-mediated transformation system to non-heading Chinese cabbage with transgenic roots. Hortic. Plant J. 2024, 10, 450–460. [Google Scholar] [CrossRef]
  36. Wan, L.; Wang, Z.; Tang, M.; Zhang, X.; Ren, J.; Zeng, H.; Zhang, N.; Wei, J.; Xiong, J. Optimization of CGMMV-VIGS system for melon crops. Chin. J. Agric. 2024, 40, 40–47. [Google Scholar]
  37. Pan, C.; Ye, L.; Qin, L.; Liu, X.; He, Y.; Wang, J.; Chen, L.; Lu, G. CRISPR/Cas9-mediated efficient and heritable targeted mutagenesis in tomato plants in the first and later generations. Sci. Rep. 2016, 6, 24765. [Google Scholar] [CrossRef]
  38. Peng, K.; Xue, C.; Huang, X. Enhancing virus-induced gene silencing efficiency in tea plants (Camellia sinensis L.) and the functional analysis of CsPDS. Sci. Hort. 2024, 337, 113585. [Google Scholar] [CrossRef]
  39. Li, C.; An, X.; Zhang, Z.; Liu, K.; Sun, J. Optimization of maize TRV-VIGS and identification of top rot disease resistant genes. J. Nucl. Agric. 2019, 33, 2111–2118. [Google Scholar] [CrossRef]
  40. Guo, Y.; Liu, Z.; Kang, L.; Bao, T.; Yang, X.; Zhao, J.; Zhang, Z. Optimization of efficient silencing system for tomato VIGS based on PDS gene. Crops 2023, 39, 46–50. [Google Scholar] [CrossRef]
  41. Li, L.; Wang, C.; Li, C.; Luo, K.; Wang, H.; Chen, Y.; Zhang, X.; Geng, M. Cloning of MeHsfB3a gene in cassava and identification of its anti bacterial wilt function. J. Trop. Crops 2023, 44, 9–16. [Google Scholar] [CrossRef]
Horticulturae 12 00031 g001
Figure 1. Exploration method diagram of VIGS system suitable for functional research of resistance genes to Chinese cabbage clubroot disease.
Figure 1. Exploration method diagram of VIGS system suitable for functional research of resistance genes to Chinese cabbage clubroot disease.
Horticulturae 12 00031 g001
Horticulturae 12 00031 g002
Figure 2. Construction of pTRV2-BrUFO recombinant vector. (a) Comparison results of the first 300 bp BrUFO sequence between the cloned and reference sequence. (b) Structural diagram of pTRV2-BrUFO recombinant vector. (c) The photograph of the agarose gel of pTRV2-BrUFO recombinant vector. M: Marker of D2000. N: Negative control (pTRV2 empty vector). 1, 2, 3, 4: Different clones of pTRV2-BrUFO recombinant vector.
Figure 2. Construction of pTRV2-BrUFO recombinant vector. (a) Comparison results of the first 300 bp BrUFO sequence between the cloned and reference sequence. (b) Structural diagram of pTRV2-BrUFO recombinant vector. (c) The photograph of the agarose gel of pTRV2-BrUFO recombinant vector. M: Marker of D2000. N: Negative control (pTRV2 empty vector). 1, 2, 3, 4: Different clones of pTRV2-BrUFO recombinant vector.
Horticulturae 12 00031 g002
Horticulturae 12 00031 g003
Figure 3. Silencing efficiency of target gene for different soaking time for VIGS. Appraisal time, the sampling time point after soaking treatment for qRT-PCR. The difference significance was analyzed by Student’s t test. ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01; ***, p ≤ 0.001.
Figure 3. Silencing efficiency of target gene for different soaking time for VIGS. Appraisal time, the sampling time point after soaking treatment for qRT-PCR. The difference significance was analyzed by Student’s t test. ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01; ***, p ≤ 0.001.
Horticulturae 12 00031 g003
Horticulturae 12 00031 g004
Figure 4. Silencing efficiency of different vacuum infiltration times for VIGS. Appraisal time, the sampling time after vacuum treatment. The difference significance was analyzed by Student’s t test, ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001.
Figure 4. Silencing efficiency of different vacuum infiltration times for VIGS. Appraisal time, the sampling time after vacuum treatment. The difference significance was analyzed by Student’s t test, ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001.
Horticulturae 12 00031 g004
Horticulturae 12 00031 g005
Figure 5. Optimization of P. brassicae-inoculation time for VIGS-treated Chinese cabbage. (a) Phenotypic of VIGS-treated Chinese cabbage under different P. brassicae-inoculation times. (b) Incidence rate of VIGS -treated Chinese cabbage under different inoculation times. (c) Disease index of VIGS-treated Chinese cabbage under different inoculation times. 3 d, 6 d,… 15 d, P. brassicae-inoculated time after VIGS treatment. The difference significance was analyzed by Student’s t test, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001.
Figure 5. Optimization of P. brassicae-inoculation time for VIGS-treated Chinese cabbage. (a) Phenotypic of VIGS-treated Chinese cabbage under different P. brassicae-inoculation times. (b) Incidence rate of VIGS -treated Chinese cabbage under different inoculation times. (c) Disease index of VIGS-treated Chinese cabbage under different inoculation times. 3 d, 6 d,… 15 d, P. brassicae-inoculated time after VIGS treatment. The difference significance was analyzed by Student’s t test, *, p ≤ 0.05, **, p ≤ 0.01, ***, p ≤ 0.001.
Horticulturae 12 00031 g005
Table 1. Primers for qRT-PCR.
Table 1. Primers for qRT-PCR.
Primer NamesSequence (5′→3′)
BrActinF: ATCTACGAGGGTTATGCT
R: CCACTGAGGACGATGTTT
qRT-BrUFOF: TGAAATCAGATGGTATCGTC
R: AGCCTTCCTCTGCTCTCTAA
Table 2. The mortality rate (%) of the seeds soaking in pTRV1+pTRV2 or pTRV1+pTRV2-BrUFO treated solutions for 0.5, 1, and 2 h.
Table 2. The mortality rate (%) of the seeds soaking in pTRV1+pTRV2 or pTRV1+pTRV2-BrUFO treated solutions for 0.5, 1, and 2 h.
Soaking TimePlant MaterialsMortality (%)
3 d7 d14 d21 d28 d35 d42 d
0.5 hpTRV1+pTRV20000000
pTRV1+pTRV2-BrUFO0000000
1 hpTRV1+pTRV20000000
pTRV1+pTRV2-BrUFO0000000
2 hpTRV1+pTRV201.9 ± 0.96 *6.67 ± 1.91 ***6.67 ± 1.91 ***9.05 ± 0.96 ***9.05 ± 0.96 ***10.48 ± 0.96 ***
pTRV1+pTRV2-BrUFO00.47 ± 0.96 *4.29 ± 1.43 ***5.71 ± 1.43 ***6.67 ± 0.96 ***8.57 ± 2.86 ***12.38 ± 3.34 ***
Mortality was assessed 3, 7....... 42 d after soaking treatment was performed. Data was analyzed using Student’s t test (a = 0.05 and a = 0.01) using a randomized block design with three replicates and 30 seedlings per experimental unit. The difference significance was analyzed by Student’s t test, *, p ≤ 0.05, ***, p ≤ 0.001.
Table 3. Mortality of Chinese cabbage under different vacuum time in the transfection solutions of pTRV1+pTRV2 or pTRV1+pTRV2-BrUFO.
Table 3. Mortality of Chinese cabbage under different vacuum time in the transfection solutions of pTRV1+pTRV2 or pTRV1+pTRV2-BrUFO.
Vacuuming TimePlant MaterialsMortality Rate (%)
3 d7 d14 d21 d28 d35 d42 d
10 minpTRV1+pTRV20000000
pTRV1+pTRV2-BrUFO0000000
15 minpTRV1+pTRV20000000.95 ± 0.96 *
pTRV1+pTRV2-BrUFO0001.90 ± 0.96 *2.38 ± 0.96 **4.29 ± 1.43 **5.71 ± 2.86 ***
20 minpTRV1+pTRV20002.38 ± 0.96 **4.29 ± 1.43 **4.76 ± 0.96 ***6.19 ± 1.43 ***
pTRV1+pTRV2-BrUFO002.38 ± 0.96 **4.29 ± 1.43 **4.76 ± 0.96 ***6.19 ± 4.29 ***6.19 ± 4.29 ***
Mortality was assessed 3, 7, ...... 42 d after vacuum treatment was performed. Data was analyzed using Student’s t test (a = 0.05 and a = 0.01) using a randomized block design with three replicates and 30 seedlings per experimental unit. The difference significance was analyzed by Student’s t test, *, p ≤ 0.05, **, p ≤ 0.01; ***, p ≤ 0.001.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, B.; Zhang, P.; Li, X.-M.; Zhang, S.-M.; Ma, X.-M.; Yu, R.; Wang, N.; Ji, R.-Q. Optimization of a VIGS System Suitable for the Functional Study of Resistance Genes of Chinese Cabbage Against Clubroot Disease. Horticulturae 2026, 12, 31. https://doi.org/10.3390/horticulturae12010031

AMA Style

Zhang B, Zhang P, Li X-M, Zhang S-M, Ma X-M, Yu R, Wang N, Ji R-Q. Optimization of a VIGS System Suitable for the Functional Study of Resistance Genes of Chinese Cabbage Against Clubroot Disease. Horticulturae. 2026; 12(1):31. https://doi.org/10.3390/horticulturae12010031

Chicago/Turabian Style

Zhang, Bo, Ping Zhang, Xin-Ming Li, Su-Meng Zhang, Xue-Mei Ma, Ran Yu, Nan Wang, and Rui-Qin Ji. 2026. "Optimization of a VIGS System Suitable for the Functional Study of Resistance Genes of Chinese Cabbage Against Clubroot Disease" Horticulturae 12, no. 1: 31. https://doi.org/10.3390/horticulturae12010031

APA Style

Zhang, B., Zhang, P., Li, X.-M., Zhang, S.-M., Ma, X.-M., Yu, R., Wang, N., & Ji, R.-Q. (2026). Optimization of a VIGS System Suitable for the Functional Study of Resistance Genes of Chinese Cabbage Against Clubroot Disease. Horticulturae, 12(1), 31. https://doi.org/10.3390/horticulturae12010031

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop