Next Article in Journal
Characterization of the Salt Overly Sensitive 1 (SOS1) Pathway Genes in Tea Plant (Cameliia sinensis) Under Environmental Stress
Previous Article in Journal
Amino Acid Biostimulants Enhance Drought and Heat Stress Tolerance of Creeping Bentgrass (Agrostis Stolonifera L.)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 11
Issue 7
10.3390/horticulturae11070854
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Differentiation of Ornamental and Fruit-Bearing Prunus laurocerasus Revealed by SSR and S-Locus Markers

by
Attila Hegedűs
1,
Péter Honfi
2,
Sezai Ercisli
3,
Gulce Ilhan
3,
Endre György Tóth
4 and
Júlia Halász
1,*
1
Horticultural Plant Genetics Group, Department of Plant Biotechnology, Institute of Genetics and Biotechnology, Hungarian University of Agriculture and Life Sciences, 1118 Budapest, Hungary
2
Department of Floriculture and Dendrology, Institute of Landscape Architecture, Urban Planning and Garden Art, Hungarian University of Agriculture and Life Sciences, 1118 Budapest, Hungary
3
Department of Horticulture, Faculty of Agriculture, Ataturk University, 25240 Erzurum, Türkiye
4
National Coalition of Independent Scholars (NCIS), Brattleboro, VT 05301, USA
*
Author to whom correspondence should be addressed.
Horticulturae 2025, 11(7), 854; https://doi.org/10.3390/horticulturae11070854
Submission received: 9 June 2025 / Revised: 5 July 2025 / Accepted: 18 July 2025 / Published: 19 July 2025
(This article belongs to the Special Issue Breeding of Ornamental Plants—Genetic Resources, New Challenges and Prospects: 2nd Edition)
Browse Figures
Versions Notes

Abstract

Cherry laurel (Prunus laurocerasus) is an understudied, highly polyploid (22×) species that is widely used as an ornamental shrub and as a fruit-bearing plant in Türkiye. We analyzed 43 accessions—33 ornamental cultivars and 10 fruit-bearing selections—by examining size variations in 10 simple sequence repeat (SSR) markers and the first intron region of the self-incompatibility ribonuclease (S-RNase) gene. A total of 498 alleles were detected across 11 loci, with the highest number of alleles observed at the S-locus. The SSR loci amplified between 4 (ASSR63) and 17 (BPPCT039) alleles per accession, with eight of the 11 primers generating more than 12 alleles per accession. Two markers, BPPCT040 and CPSCT021, uniquely distinguished all tested accessions. Of the alleles, only 178 (36%) were shared between the ornamental and fruit-bearing groups, reflecting significant genetic differentiation. A dendrogram and principal coordinate analysis revealed three distinct groups. Group 1 included most Hungarian and some European cultivars. Groups 2 (Western European cultivars) and 3 (Turkish selections) exhibited higher average allele numbers, suggesting greater genetic diversity in these groups. Our results indicate that cultivated cherry laurels originate from a broad genetic base and show clear genetic divergence between ornamental and fruit-bearing selections, likely due to differing long-term selection pressures. The observed genetic variability is consistent with the polyploid nature of the species and supports the presumed self-incompatible phenotype. This is the first study to report SSR fingerprints for ornamental cultivars and fruit-bearing selections, providing a potential tool for use in breeding programs.

Graphical Abstract

1. Introduction

Cherry laurel (Prunus laurocerasus L.) is an evergreen shrub or small tree belonging to the genus Prunus within the family Rosaceae. Native to Southeastern Europe and Western Asia—particularly the Black Sea region, including northern Türkiye and western Georgia—this fast-growing and resilient species possesses a rich genetic pool [1,2,3]. P. laurocerasus belongs to the racemose group of the Prunus genus, characterized by species with higher ploidy levels. It is a docosaploid species with an extreme chromosome number (2n = 22× = 176) [4]. Although the exact origin of the species remains unknown, nuclear sequence data suggest a paraphyletic lineage and multiple independent allopolyploidy events in the evolutionary history of the racemose group [5]. The species was first recorded in 1546 by the French scientist P. Belan in Northeastern Türkiye, after which it was introduced into ornamental gardens across Europe [1].
Today, cherry laurel is widely cultivated as an ornamental plant, commonly used for tall hedges, group plantings [6], or as a solitary specimen for focal points in landscapes [7]. It has also been employed in afforestation efforts against desertification [8]. Its glossy, robust foliage presents a year-round decorative appeal [9] and is frequently used in floral arrangements, particularly in wreaths and grave bouquets [10]. The species demonstrates strong tolerance to air pollution and pests, making it a preferred evergreen in urban landscapes [6].
Cherry laurel produces saucer-shaped, white hermaphroditic flowers in racemose clusters that attract a wide range of generalist pollinators. Owing to its prolonged and abundant flowering, along with high nectar production, it is recommended as a pollinator-friendly plant in both urban and rural settings [11]. The seeds are dispersed primarily by the common blackbird and various omnivorous mammals that consume the fruit [12]. The red–black, oval to round fruits contain a single seed and vary in taste from sweet to bitter or acrid [13]. They are used in multiple forms—including fresh, dried, canned, and pickled, or as jam, marmalade, or syrup (Pekmez)—and are valued for their nutritional content [14]. The fruits are rich in calcium, magnesium, antioxidant phenolics, anthocyanins, and carotenoids [8,15,16].
The intensive breeding of P. laurocerasus began in the latter half of the 20th century, leading to the development and commercialization of numerous cultivars worldwide. Early breeding efforts focused on genotypes selected from wild populations, with particular emphasis on improving winter hardiness. In extremely cold climates, cherry laurel may lose foliage, show reduced growth, or even die [17]. Consequently, resistance to pests and pathogens, contributing to improved foliage health, remains a breeding priority. Growth habit is another important ornamental trait, with cultivars ranging from columnar to spreading or compact forms, offering versatility in landscape applications [18]. Recently, attention has shifted to foliage coloration, including different shades of green, variegation, and bronze-tinted shoot tips. Currently, around 50 cultivars are available commercially. Breeding programs are concentrated mainly in Europe—particularly in The Netherlands, France, Germany, Hungary, and England—but efforts are also underway in the United States [19]. In the Black Sea region, fruit-producing types are cultivated for fresh consumption. ‘Odü’ is the first officially registered fruit cultivar in both Türkiye and the world, while ‘Kiraz’ is a widely grown local table cultivar from the Trabzon province [20,21]. Increasing attention is being directed toward breeding and research on new fruit types, necessitating a deeper understanding of the genetic background of available germplasm.
Microsatellites, or SSRs, have seen widespread application in recent years due to their informativeness based on their high mutation rates at individual loci per generation, significant intraspecific polymorphism, excellent reproducibility, clear scoring, multiallelic nature, and frequent cross-species transferability among related taxa [22,23]. Moreover, the codominant inheritance of SSR markers permits the accurate assessment of heterozygosity for reliable genotyping. Altogether, these features have made SSRs an essential tool in a variety of Prunus genetic and genomic studies [24,25,26,27,28,29,30,31].
Most Prunus exhibit gametophytic self-incompatibility (SI) [32], and the molecular recognition of the matching pollen genotype depends on proteins with allele specificity. The S-RNase enzyme plays a key role in self-pollen rejection by breaking down pollen RNA, thereby preventing the elongation of the self-pollen tubes [33]. Its allele-specific function is based on highly variable domains [34,35]. Since a functional SI system does not allow for self-fertilization, heterozygosity in the S-locus is evident. Studies have shown high fruit set rates in cross-pollinated combinations, whereas self-pollination often results in severe fruit drop, further confirming self-incompatibility [36,37], and Halász et al. [35] identified 23 putative S-RNase alleles (S1–S20, S5m, S13m, and S18m). Due to the codominant nature of S-RNase alleles, their analysis can be effectively combined with other codominant markers—commonly as a complement to SSR analyses—thus proving this assay particularly useful in genetic studies [38,39,40]. It can be reliably applied to resolve synonyms and homonyms in germplasm collections, as well as to confirm or exclude parent–offspring relationships [41,42,43,44]. Furthermore, it offers a useful approach for determining ploidy levels, as homozygosity is not expected in diploid self-incompatible Prunus, and polyploids typically carry a diverse set of alleles [45].
Following pest-related losses in Thuja species, P. laurocerasus gained popularity in landscaping due to its fast propagation and adaptability to a wide range of ecological conditions. However, these same characteristics confer invasive potential [46], highlighting the importance of genetic research. The present study aims to evaluate the effectiveness of SSR and S-locus-based DNA markers for distinguishing genotypes in the highly polyploid P. laurocerasus. Our objective was to characterize the genetic diversity of both ornamental cultivars and fruit-bearing selections. This is the first study to focus on the genetic assessment of ornamental cultivars, offering valuable insights for breeding programs of this economically important, dual-purpose species.

2. Materials and Methods

2.1. Plant Material

A total of 43 cultivars and genotypes were analyzed: five cultivars were sampled in the collection of the Budai Arborétum (Hungarian University of Agriculture and Life Sciences, Buda Campus), 26 cultivars in the collection of PRENOR® Horticulture and Landscaping Ltd. (Szombathely, Hungary); two genotypes in the garden of the Royal Observatory in Greenwich (England); and 10 fruit-bearing selections in the experimental plantation of the Black Sea Agricultural Research Institute (GFAR) in Türkiye (Table 1).

2.2. DNA Extraction and PCR Analysis

Genomic DNA was extracted with the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol, using healthy, young leaves as sampled tissues. To amplify microsatellite regions, 10 primer pairs, designed on the genomes of various Prunus species, were utilized (Table 2): ASSR63 [24]; BPTCT 007, BPPCT 025, BPPCT 037, BPPCT 039, BPPCT 040 [25]; CPSCT 018, CPSCT 021 [26]; CPDCT 044, CPDCT 045 [27]. The PCR cycles were as follows: an initial denaturation for 1 min at 94 °C followed by 35 cycles of 45 s at 94 °C; 45 s at the primer-annealing temperature described in the corresponding papers [24,25,26,27]; 2 min at 72 °C; and a final extension of 4 min at 72 °C. The first intron region of the S-RNase gene was amplified using PaConsI-F and PaConsI-R2 primers [53] with parameters as described by Halász et al. [35]. The PCR reaction was performed in a total volume of 20 µL, containing 50–80 ng of DNA sample; 10× DreamTaq™ Green buffer; 1.2 mM of MgCl2; 0.15 mM of dNTP; 0.4 μM of forward and reverse primers; 0.65 U DreamTaq™ DNA polymerase; 3% DMSO; and 0.01 μg/μL BSA (Thermo Fisher Scientific, Waltham, MA, USA). The reactions were carried out in a Swift MaxPro thermocycler (ESCO Healthcare, Singapore).

2.3. Fragment Length Determination

PCR products were first checked on a 1% TBE agarose gel (15–20 min at 80 V) and documented under UV light after staining with ethidium bromide. For accurate size determination, forward primers were labelled with FAM fluorescent dye for the ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) automated DNA sequencer. The obtained results were analyzed using Peak Scanner 3.0 software (Applied Biosystems Sizing Analysis Module) with a GeneScan™ 500 LIZ™ Size Standard (Thermo Fisher Scientific (https://assets.fishersci.com/TFS-Assets/LSG/manuals/cms_042491.pdf, accessed on 19 July 2025)) size standard.

2.4. Data Evaluation

Fragment sizes were converted into binary form, where the presence of a fragment was coded as 1 and its absence as 0. The total number of alleles, the number of unique alleles and genotypes, and the proportion of polymorphic alleles were determined and the analysis of molecular variance (AMOVA) was carried out using the GenALEx 6.5 program [54] with the frequency-based option. The polymorphism information content (PIC), resolving power (Rp) and discriminating power (Dp) were determined using the iMEC [55] and Popgene 1.32 [56] programs.
We performed a Principal Coordinates Analysis (PCoA) using the Poppr 2.9.6 and Ade4 1.7–22 packages in R to assess the genetic differentiation among the studied accessions [57,58]. PCoA calculates a distance matrix, which is then transformed into an eigenvector matrix representing the main axes of genetic variation. After, the matrix is rotated into Euclidean space, reducing the data to the most informative dimensions while preserving the relative genetic distances between individuals [59,60]. The calculation of genetic distances was based on Nei’s FST [61]. Pairwise genetic distances were used to create an UPGMA dendrogram using the Poppr aboot function [57,62]. Bootstrap values were estimated through a permutation approach with 1000 replications.

3. Results and Discussion

3.1. Characterization of SSR Loci and the S-RNase Locus in Cherry Laurel Accessions

SSRs, a specific class of tandem repeats, are composed of short sequence motifs ranging from one to six nucleotides and are present across the genomes of all eukaryotic organisms. Variation in the number of repeat units among individuals arises from changes in the length of these tandemly repeated SSR motifs [23,63]. For a species with an extreme ploidy level, the number of alleles per locus detected in a single accession provides valuable insight. In contrast to diploid species, where up to two alleles can be carried, the highest number of alleles per individual in the analyzed cherry laurel genotypes was 18 (S-locus). The SSR loci amplified four (ASSR63) to 17 (BPPCT039) alleles/accession, and eight of the 11 primers produced more than 12 alleles/accession (Table 3). Until now, only two studies have focused on the SSR profile of cherry laurel [28,29], but none of those described the number of detected alleles per individual, so our study is the first to provide such results.
All loci analyzed were found to be polymorphic, with five to 89 alleles identified per locus. A total of 498 alleles were detected in the 11 evaluated loci. The average number of alleles per locus was 45.27. The most alleles were identified at the S-locus and the SSR loci CPDCT044, BPPCT039 and CPSCT021 (Table 2). The CPDCT044 locus produced many alleles in previous studies involving 2×, 4×, 5× and 6× Prunus species [30,31,64,65,66], while it was not that efficient in others [41]. In 2× almonds and 6× plums, 21 and 26 alleles were, respectively, shown [30,41], while our study detected 77 alleles in the 22× P. laurocerasus. This suggests an association between the allele numbers and ploidy levels. The CPSCT021 locus had the most alleles (26) in 4×, 5× and 6× Prunus species [66], whereas in European plum cultivars, the BPPCT039 locus had the largest allele number [31,67], which is consistent with our findings that these loci are also highly variable in P. laurocerasus.
In contrast, the smallest allele number was observed at the ASSR63 locus, where only five alleles were identified. The limited variability of this locus was also shown in 2×, 3× and 4× cherry species [45]; furthermore, it was found to be monomorphic in 4×, 5× and 6× plum species [31]. Among the 10 SSR loci analyzed, nine contained genomic dinucleotide repeats, while the ASSR63 was the only expressed sequence tag derived marker with trinucleotide repeats [24], which explains its smaller allele number. The non-neutral selection of expressed genes resulted in fewer allelic variants for EST-SSRs in Prunus species [24,68], and trinucleotide repeat loci were reported to be less prone to mutations that increase or decrease repeat numbers [69,70]. However, they enable more reliable allele identification due to the reduced number of stutter peaks, making them valuable candidates for inclusion in genetic studies.
Field studies and observations by growers in Türkiye suggest that P. laurocerasus is self-incompatible (SI) [36]. The presence of 12–18 alleles per locus in a single individual also supports the SI phenotype, as self-fertilization would lead to the accumulation of identical alleles, resulting in a smaller number of detected alleles. Halász et al. [35] determined the size of the S-RNase first intron region in 23 fruit-bearing Turkish genotypes, identifying 32 fragments of varying sizes. In some cases, only single-nucleotide indels were observed. Allele sizes differing by a single nucleotide were also detected in ornamental genotypes in this study, although a 343 bp difference was measured between the smallest and largest alleles (Table 3). Besides characterizing mating compatibility, this high degree of polymorphism in the S-RNase gene intron length [33] provides a robust foundation for its use as a marker for assessing genetic variability [38,39,40,41]. The large number of alleles in 22× P. laurocerasus requires highly accurate methods to ensure all variants are resolved [35].
Allele sizes at the 10 analyzed SSR loci ranged from 99 to 283 bp, while for the S-RNase first intron region, the size variation was between 193 and 536 bp. The CPDCT044 locus exhibited the largest size range. In contrast, the smallest size range was observed at the ASSR63 locus. CPDCT044 also showed the greatest size variation among 4×, 5×, and 6× Prunus species [66], with a difference of 90 bp, which was even greater in the cherry laurel, reaching 178 bp. In the same study, the BPPCT037 locus exhibited the smallest size range—20 bp across five alleles—whereas in our analysis of the high-ploidy cherry laurel, this range was significantly larger, reaching 125 bp among 46 alleles. This is not unexpected, as the formation of the racemose group of Prunus has been described as involving multiple allopolyploidization events [5], and thus alleles originating from different species may be present in the P. laurocerasus genome.
Since the number of alleles was high at nearly all loci, this level of polymorphism enabled the differentiation of all genotypes. Each of the two markers, BPPCT040 and CPSCT021, distinguished all tested accessions, producing a unique profile for each (Table 2; Table S1). Previously, no information was available on the marker-based genotyping of cherry laurel cultivars; therefore, this study is the first to establish unique SSR fingerprints for ornamental cultivars and several fruit-bearing selections or cultivar candidates. SSR databases for cultivar identification have already been established for several fruit species, including the grapevine [71], the pear [72], and citrus [73]. Accurate cultivar identification is a critical aspect of managing economically important crops, and DNA-based analyses play a key role in official cultivar recognition. These methods are also essential for clarifying cases of synonymy and homonymy that may arise from accidental mixtures or the mislabelling of plant material.
The PIC values ranged from 0.19 to 0.28. Although SSRs are codominant markers, the high number of alleles present at a single locus in 22× P. laurocerasus necessitates their evaluation as dominant markers. The maximum PIC value for a dominant marker is 0.5 [74], and the values obtained in this study were comparable to those reported for 6× P. domestica by Antanyniené et al. [75]. It is important to note that the PIC values represented averages calculated across all alleles at each locus. However, the average number of alleles per locus ranged from 3.44 to 12.21, contributing to a considerably higher overall level of polymorphic information content. This was also reflected in the cumulative values of resolving power (Rp) and discriminating power (Dp). The average resolving power of SSR and S-locus markers was 13.02, and nine of the eleven loci showed higher values than the most informative RAPD marker reported in a study on European plum [76]. Similarly, the discriminating power exceeded 0.90 for ten of the eleven loci, surpassing the values reported for SSR markers used to characterize sweet (2×) and sour (4×) cherry accessions [77]. The Dp values for the BPPCT037, BPPCT039, and BPPCT040 loci in 22× P. laurocerasus were slightly higher than those observed in 2× to 6× Prunus species [78,79]. Both BPPCT040 and CPSCT021 markers successfully distinguished all tested genotypes, including the two Greenwich trees, which were identical at five of the eleven loci. In addition, combining those five loci with any of the remaining six allows for the reliable discrimination of all tested accessions.

3.2. Genetic Distance of the Cherry Laurel Accessions

Based on their cultivation purpose, P. laurocerasus accessions can be classified into two main groups: most are used worldwide as ornamental plants, while some are cultivated for fruit production, particularly in Türkiye. Our analysis included 33 ornamental cultivars and 10 fruit-bearing selections, with 429 and 247 identified alleles, respectively. Although the sample sizes differed, a comparative evaluation of the average number of alleles provided insights into the genetic background of each group. Ornamental individuals carried an average of 13.0 alleles per accession, while fruit-bearing selections had an average of 24.7 alleles per accession. Only 178 alleles (36%) were shared between the two groups, indicating substantial genetic differentiation between ornamental and fruit-bearing accessions.
While several plant species are cultivated for both ornamental and fruit production purposes, studies directly comparing the genetic diversity of these two types remain limited. In Japanese apricot (P. mume L.), SSR markers did not reveal significant differences between fruit-bearing and ornamental genotypes, suggesting that fruit-bearing cultivars were likely selected recently from ornamental types [80]. In contrast, SSR markers clearly differentiated ornamental and fruit-bearing accessions in pomegranate (Punica granatum L.) and lime species [81,82].
A cluster analysis was conducted using data from 10 SSR markers and one intron-length polymorphism (ILP) marker, along with a genetic distance matrix based on Nei’s FST. The resulting UPGMA dendrogram (Figure 1) revealed that the fruit-bearing Turkish accessions formed a distinct cluster, supported by a 100% bootstrap value, which was sister to the cluster containing all ornamental accessions. Nearly all sub-clusters within the Turkish group received statistical support, with bootstrap values ranging from 54 to 97. Genotype T2 exhibited the most distant genetic relationship within this group. A previous SSR analysis of 43 Turkish P. laurocerasus accessions also revealed two genetic groups, though no clear correlation was found between clustering patterns and the six geographic regions from which samples were collected [29].
Within the ornamental clade, only a few smaller sub-clusters were statistically supported. These included the following cultivar pairs, listed in increasing order of bootstrap values: ‘Schipkaensis Macrophylla’ and ‘Copperbell’; ‘Reynvaanii’ and ‘Genolia’; ‘Elly’ and ‘Marbled White’; ‘Otto Luyken’ and ‘Gajo’; and the two samples from Greenwich, which formed a supported group with two additional cultivars. Hungarian-bred ornamental cultivars were distributed among accessions of diverse origin, although some formed distinct, albeit statistically unsupported, clades. The cultivars ‘Baumgartner’, ‘Kleopátra’, ‘Mari’, and ‘Piri’, developed by Miklós Józsa, along with his selected Clone 11, grouped together, confirming the close genetic relationship. Similarly, the cultivars ‘Zöldszőnyeg’ and ‘Miki’, bred by Elemér Barabits and his son, formed a clade with the Bulgarian cultivar ‘Schipkaensis’. This supports the notion that ‘Schipkaensis’, a compact, winter-hardy, and decorative cultivar [46,78], was extensively used as a donor parent in this breeding program. No pedigree data are available for these cultivars (Table 1), as breeding often involves selection from wild populations or chance seedlings with unknown parentage [28,83].
Two particularly large, round-leaved samples collected from trees at the Royal Greenwich Observatory in England were located on the phylogenetic tree near the cultivars ‘Rotundifolia’ and ‘Magnoliifolia’. This suggests their likely involvement in the pedigree of the Greenwich trees, which is consistent with their known traits and historical usage, given that ‘Rotundifolia’ and ‘Magnoliifolia’ are among the oldest French-origin cultivars, known for their large leaves and widely regarded as superior ornamental plants [84]. Interestingly, the cultivar ‘Gabi’, characterized by large leaves and vigorous growth, was grouped separately from other Hungarian cultivars but relatively close to ‘Rotundifolia’ and ‘Magnoliifolia’, suggesting that one or both of these old cultivars may have contributed to its pedigree.
Principal coordinate analysis (PCoA) clearly illustrated genetic relationships and confirmed the presence of three distinct groups within the analyzed germplasm (Figure 2). The first three coordinates accounted for 42.58% of the total variation (PC1: 19.15%; PC2: 15.75%; PC3: 7.68%). Fruit-bearing cherry laurel accessions were genetically distinct from both ornamental groups, with separation primarily occurring along the second axis. Notably, the cultivar ‘Copperbell’ was positioned in a different ornamental group in the PCoA than in the UPGMA dendrogram. Although its pedigree is unknown (Table 1), this discrepancy suggests that ‘Copperbell’ may have genetic contributions from both ornamental lineages.
An analysis of molecular variance (AMOVA), based on SSR and S-locus allele patterns, confirmed that the variation within groups (80%) was significantly greater (p ≤ 0.001) than the variation among the three identified groups (20%). Table 4 summarizes the variability parameters characterizing the three groups identified by the PCoA.
The largest number of alleles was identified in Group 1, which includes ornamental cultivars of both Hungarian and foreign origins. The proportion of polymorphic alleles varied accordingly, as this group contained nearly twice as many individuals as the other two groups. Groups 2 and 3 showed higher average allele numbers, indicating greater genetic diversity among the Western European cultivars (from English, French, and Dutch origins) and the Turkish selections. However, despite similar sample sizes in Groups 2 and 3, notable differences were observed. While Group 2 exhibited a higher total allele count, Group 3 contained a significantly larger number of unique alleles. This pattern is closely linked to the fact that Group 3 individuals were selected from wild populations in the species’ natural habitat, which is considered the center of genetic diversity for the species [1,2]. Although previous work by Islam et al. [29] found no correlation between geographic and genetic distances, our results confirm that sharply contrasting long-term selection pressures have led to the differentiation of ornamental (where aesthetic and horticultural traits were prioritized) and fruit-bearing accessions (where desirable fruit traits such as size and flavor were emphasized). Our findings suggest that cultivated cherry laurels originated from a broad genetic background and exhibit a clear genetic divergence between ornamental and fruit-bearing selections.

4. Conclusions

Our study identified at least nine robust markers that can be efficiently used for the genetic analysis of P. laurocerasus, a species with 22× ploidy level. Among these, microsatellites such as BPPCT040 and CPSCT021 provided unique genotypes for all 43 accessions. Its high allele count justified the inclusion of the S-RNase first intron region in the marker system. The allelic patterns revealed three distinct groups, with fruit-bearing selections clearly separated from all ornamental cultivars. Our results contribute to narrowing down the potential progenitors of cultivars with unknown pedigrees. Additionally, the findings highlight the divergent selection forces shaping ornamental versus fruit-bearing genotypes. The genetic variability observed aligns with the polyploid nature of the species and supports the hypothesized self-incompatible phenotype. These findings offer practical tools for germplasm management, breeding program design, cultivar identification, and the targeted conservation of genetically distinct accessions. The marker set used in this study can streamline breeding strategies by improving parental selection and enabling more efficient genetic tracking in P. laurocerasus offspring generations. This research deepens our understanding of the species’ genetic complexity and provides essential tools for practical horticultural and breeding applications.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae11070854/s1, Table S1. The unique genotypes for all 43 accessions in the BPPCT040 and CPSCT021 simple sequence repeat loci.

Author Contributions

A.H. Writing—review and editing, Investigation, Data curation, Visualization, Validation, Supervision, Methodology, Formal analysis, Conceptualization. P.H. Writing—review and editing, Resources. S.E. Writing—review and editing, Resources. G.I. Writing—review and editing, Resources. E.G.T. Writing—review and editing, Formal analysis, Visualization, Software, Validation. J.H. Writing—original draft, Writing—review and editing, Investigation, Validation, Data curation, Visualization, Conceptualization, Supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Flagship Research Groups Program of the Hungarian University of Agriculture and Life Sciences and by the National Research, Development and Innovation Office, NKFI K_128874 project.

Data Availability Statement

Data will be made available on request. The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

The authors acknowledge Jázmin Rieth for her assistance with the manual work and Magdolna Sütöri-Diószegi and Zsolt Szafián for providing plant material.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ercisli, S. A short review of the fruit germplasm resources of Turkey. Genet. Resour. Crop Evol. 2004, 51, 419–435. [Google Scholar] [CrossRef]
  2. Sulusoglu, M. The cherry laurel (Prunus laurocerasus L.) tree selection. Afr. J. Agric. Res. 2011, 6, 3574–3582. Available online: https://academicjournals.org/journal/AJAR/article-full-text-pdf/4AC6DB933771 (accessed on 8 June 2025).
  3. Akbulut, M.; Macit, I.; Ercisli, S.; Koc, A. Evaluation of 28 cherry laurel (Laurocerasus officinalis) genotypes in the Black Sea region, Turkey. N. Z. J. Crop Hortic. Sci. 2007, 35, 463–465. [Google Scholar] [CrossRef]
  4. Meurman, O. Prunus laurocerasus L., a species showing high polyploidy. J. Genet. 1929, 21, 85–94. [Google Scholar] [CrossRef]
  5. Zhao, L.; Jiang, X.W.; Zuo, Y.J.; Liu, X.L.; Chin, S.W.; Haberle, R.; Potter, D.; Chang, Z.Y.; Wen, J. Multiple events of allopolyploidy in the evolution of the racemose lineages in Prunus (Rosaceae) based on integrated evidence from nuclear and plastid data. PLoS ONE 2016, 11, e0157123. [Google Scholar] [CrossRef] [PubMed]
  6. Ivanova, V.; Panchev, V. Effect of presowing treatment with ultrasound and stratification of Laurocerasus officinalis L. seeds on some growth behaviour of seedlings. Agro-Knowl. J. 2016, 17, 173–181. [Google Scholar] [CrossRef]
  7. Schmidt, G. Növények a Kertépítészetben; Mezőgazda Kiadó: Budapest, Hungary, 2003. [Google Scholar]
  8. Kolayli, S.; Kucuk, M.; Duran, C.; Candan, F.; Dincer, B. Chemical and antioxidant properties of Laurocerasus officinalis Roem. (cherry laurel) fruit grown in the Black Sea Region. J. Agric. Food Chem. 2003, 51, 7489–7494. [Google Scholar] [CrossRef] [PubMed]
  9. Flint, H.L. Landscape Plants for Eastern North America: Exclusive of Florida and the Immediate Gulf Coast; John Wiley & Sons Inc.: New York, NY, USA, 1997; pp. 483–484. [Google Scholar]
  10. Schmidt, G. Növényházi Dísznövények Termesztése; Mezőgazda Kiadó: Budapest, Hungary, 2002. [Google Scholar]
  11. Chwil, M.; Kostryco, M.; Matraszek-Gawron, R. Comparative studies on structure of the floral nectaries and the abundance of nectar production of Prunus laurocerasus L. Protoplasma 2019, 256, 1705–1726. [Google Scholar] [CrossRef] [PubMed]
  12. Abrahamczyk, S.; Otto, J.; Weigend, M. The reproductive biology of the neophyte Prunus laurocerasus in Central Europe. Plant Species Biol. 2024, 40, 164–174. [Google Scholar] [CrossRef]
  13. Ustun, N.S.; Tosun, I. A research on composition of wild cherry laurel (Laurocerasus officinalis Roem). J. Food Technol. 2003, 1, 80–82. Available online: https://makhillpublications.co/view-article/1684-8462/jftech.2003.80.82 (accessed on 8 June 2025).
  14. Alasalvar, C. Cherry laurel syrup (Pekmez). In Handbook of Functional Beverages and Human Health; Watson, R.R., Preedy, V.R., Zibadi, S., Eds.; CRC Press, Taylor & Francis Group: Boca Raton, FL, USA, 2016; pp. 187–192. [Google Scholar]
  15. Alasalvar, C.; Al-Farsi, M.; Shahidi, F. Compositional characteristics and antioxidant components of cherry laurel varieties and pekmez. J. Food Sci. 2005, 70, S47–S52. [Google Scholar] [CrossRef]
  16. Celik, F.; Ercisli, S.; Yilmaz, S.O.; Hegedus, A. Estimation of certain physical and chemical fruit characteristics of various cherry laurel (Laurocerasus officinalis Roem.) genotypes. HortScience 2011, 46, 924–927. [Google Scholar] [CrossRef]
  17. Sütöriné Diószegi, M.; Schmidt, G. Prunus laurocerasus fajták télállóságának összehasonlító vizsgálata. In Növénynemesítés a Megújuló Mezőgazdaságban; Veisz, O., Ed.; A Magyar Tudományos Akadémia Agrártudományok Osztályának Növénynemesítési Tudományos Bizottsága: Budapest, Hungary, 2014; pp. 409–413. [Google Scholar]
  18. Van Laere, K.; Hokanson, S.C.; Contreras, R.; Van Huylenbroeck, J. Woody ornamentals of the temperate zone. In Ornamental Crops; Van Huylenbroeck, J., Ed.; Springer: Cham, Switzerland, 2018; Volume 11, pp. 803–887. [Google Scholar] [CrossRef]
  19. Ruter, J.M. Inducing sterility in Carolina laurel cherry using gamma irradiation. HortTechnology 2019, 29, 535–538. [Google Scholar] [CrossRef]
  20. Islam, A. ‘Kiraz’ cherry laurel (Prunus laurocerasus). N. Z. J. Crop Hortic. Sci. 2002, 30, 301–302. [Google Scholar] [CrossRef]
  21. Islam, A. A new cherry laurel cultivar: ‘Odü’. Akad. Ziraat Derg. 2024, 13, 219–226. [Google Scholar] [CrossRef]
  22. Gupta, P.K.; Balyan, I.S.; Sharma, P.C.; Ramesh, B. Microsatellites in plants: A new class of molecular markers. Curr. Sci. India 1996, 70, 45–54. [Google Scholar]
  23. Kalia, R.K.; Rai, M.K.; Kalia, S.; Singh, R.; Dhawan, A.K. Microsatellite markers: An overview of the recent progress in plants. Euphytica 2011, 177, 309–334. [Google Scholar] [CrossRef]
  24. Xu, Y.; Ma, R.C.; Xie, H.; Liu, J.T.; Cao, M.Q. Development of SSR markers for the phylogenetic analysis of almond trees from China and the Mediterranean region. Genome 2004, 47, 1091–1104. [Google Scholar] [CrossRef] [PubMed]
  25. Dirlewanger, E.; Cosson, P.; Tavaud, M.; Aranzana, M.; Poizat, C.; Zanetto, A.; Arús, P.; Laigret, F. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theor. Appl. Genet. 2002, 105, 127–138. [Google Scholar] [CrossRef] [PubMed]
  26. Mnejja, M.; Garcia-Mas, J.; Howad, W.; Badenes, M.L.; Arús, P. Simple-sequence repeat (SSR) markers of Japanese plum (Prunus salicina Lindl.) are highly polymorphic and transferable to peach and almond. Mol. Ecol. Notes 2004, 4, 163–166. [Google Scholar] [CrossRef]
  27. Mnejja, M.; Garcias, J.; Howad, W.; Arús, P. Development and transportability across Prunus species of 42 polymorphic almond microsatellites. Mol. Ecol. Notes 2005, 5, 531–535. [Google Scholar] [CrossRef]
  28. Hajyzadeh, M.; Cavusoglu, A.; Sulusoglu, M.; Unver, T. DNA SSR fingerprinting analysis among cherry laurel (Prunus laurocerasus L.) types. J. Food Agric. Environ. 2013, 11, 630–638. [Google Scholar]
  29. Islam, A.; Orta, H.; Kaçar, Y.A.; Dönmez, D. Genetic diversity of cherry laurel (Laurocerasus officinalis Roemer) by SSR markers. J. Agric. Sci. 2023, 29, 239–248. [Google Scholar] [CrossRef]
  30. Gouta, H.; Ksia, E.; Buhner, T.; Moreno, M.A.; Zarrouk, M.; Mliki, A.; Gogorcena, Y. Assessment of genetic diversity and relatedness among Tunisian almond germplasm using SSR markers. Hereditas 2010, 147, 283–292. [Google Scholar] [CrossRef] [PubMed]
  31. Makovics-Zsohár, N.; Tóth, M.; Surányi, D.; Kovács, S.; Hegedűs, A.; Halász, J. Simple sequence repeat markers reveal Hungarian plum (Prunus domestica L.) germplasm as a valuable gene resource. HortScience 2017, 52, 1655–1660. [Google Scholar] [CrossRef]
  32. Matsumoto, D.; Tao, R. Distinct self-recognition in the Prunus S-RNase-based gametophytic self-incompatibility system. Hortic. J. 2016, 85, 289–305. [Google Scholar] [CrossRef]
  33. McClure, B. S-RNase and SLF determine S-haplotype–specific pollen recognition and rejection. Plant Cell 2004, 16, 2840–2847. [Google Scholar] [CrossRef] [PubMed]
  34. Tao, R.; Iezzoni, A.F. The S-RNase-based gametophytic self-incompatibility system in Prunus exhibits distinct genetic and molecular features. Sci. Hortic. 2010, 124, 423–433. [Google Scholar] [CrossRef]
  35. Halász, J.; Molnár, A.B.; Ilhan, G.; Ercisli, S.; Hegedűs, A. Identification and molecular analysis of putative self-incompatibility ribonuclease alleles in an extreme polyploid species, Prunus laurocerasus L. Front. Plant Sci. 2021, 12, 715414. [Google Scholar] [CrossRef] [PubMed]
  36. Sulusoglu, M.; Cavusoglu, A. Pollination biology of cherry laurel and pollinizer effects on fruit characteristics. Yuzuncu Yıl Univ. J. Agric. Sci. 2014, 24, 280–289. [Google Scholar] [CrossRef]
  37. Durul, M.S.; Unver, H. Cherry Laurel (P. laurocerasus L.) Flowering, Pollination and Fruit Set. In Proceedings of the IIIrd Balkan Agriculture Congress, Edirne, Turkey, 29 August–1 September 2021; pp. 1052–1056. [Google Scholar]
  38. Garkava-Gustavsson, L.; Kolodinska Brantestam, A.; Sehic, J.; Nybom, H. Molecular characterisation of indigenous Swedish apple cultivars based on SSR and S-allele analysis. Hereditas 2008, 145, 99–112. [Google Scholar] [CrossRef] [PubMed]
  39. Gisbert, A.D.; Romero, C.; Martínez-Calvo, J.; Leida, C.; Llácer, G.; Badenes, M.L. Genetic diversity evaluation of a loquat (Eriobotrya japonica (Thunb) Lindl) germplasm collection by SSRs and S-allele fragments. Euphytica 2009, 168, 121–134. [Google Scholar] [CrossRef]
  40. Liu, C.; Qi, X.; Song, L.; Li, Y.; Li, M. Species identification, genetic diversity and population structure of sweet cherry commercial cultivars assessed by SSRs and the gametophytic self-incompatibility locus. Sci. Hortic. 2018, 237, 28–35. [Google Scholar] [CrossRef]
  41. Baraket, G.; Abdallah, D.; Ben Mustapha, S.; Ben Tamarzizt, H.; Salhi-Hannachi, A. Combination of simple sequence repeat, S-locus polymorphism and phenotypic data for identification of Tunisian plum species (Prunus spp.). Biochem. Genet. 2019, 57, 673–694. [Google Scholar] [CrossRef] [PubMed]
  42. Matsumoto, S.; Kitahara, K.; Maejima, T.; Komatsu, H. Parent-offspring relationships of apple cultivars’ Shinano Piccoro’ and ‘Komitsu’ by S-RNase and SSR markers. Acta Hort. 2007, 763, 303–308. [Google Scholar] [CrossRef]
  43. Sawamura, Y.; Takada, N.; Yamamoto, T.; Saito, T.; Kimura, T.; Kotobuki, K. Identification of parent-offspring relationships in 55 Japanese pear cultivars using S-RNase allele and SSR markers. Hort. J. 2008, 77, 364–373. [Google Scholar] [CrossRef]
  44. Kim, H.T.; Robin, A.H.K.; Nou, I.S. Parentage confirmation of Korean bred pear cultivars by simple sequence repeat SSR genotyping and S-genotypes analysis. Plant Breed. Biotech. 2016, 4, 198–211. [Google Scholar] [CrossRef]
  45. Hrotkó, K.; Feng, Y.; Halász, J. Spontaneous hybrids of Prunus fruticosa Pall. in Hungary. Genet. Resour. Crop Evol. 2020, 67, 489–502. [Google Scholar] [CrossRef]
  46. Abrahamczyk, S.; Otto, J.; Böhnert, T.; Weigend, M. Naturalization of Prunus laurocerasus in a forest in Germany. Biol. Invasions 2024, 26, 2379–2386. [Google Scholar] [CrossRef]
  47. Foley, T.; Raulston, J.C. Prunus laurocerasus evaluations in the NCSU arboretum. Proc. South. Nursery Assoc. Res. Conf. 1994, 39, 364–368. [Google Scholar]
  48. Tóth, I. Lomblevelű Díszfák Díszcserjék Kézikönyve; Tarkavirág Kereskedelmi és Szolgáltató Kft.: Dunaharaszti, Hungary, 2012; 789p. [Google Scholar]
  49. Innoflora: Dr Józsa Miklós Fajtái. Available online: https://www.innoflora.hu/dr-jozsa-miklos-fajtai (accessed on 21 October 2024).
  50. Plantipp. Available online: https://plantipp.eu/uk/varieties (accessed on 21 October 2024).
  51. Safro Milan Havlis. Available online: https://www.havlis.cz (accessed on 21 October 2024).
  52. Pap, E. Magyar Siker a Zunderti Groot Groen Plus Kiállításon. Magyarmezőgazdaság.hu. 2019. Available online: https://magyarmezogazdasag.hu/2019/10/03/magyar-siker-zunderti-groot-groen-plus-kiallitason/ (accessed on 21 October 2024).
  53. Sonneveld, T.; Robbins, T.P.; Tobutt, K.R. Improved discrimination of self-incompatibility S-RNase alleles in cherry and high throughput genotyping by automated sizing of first intron polymerase chain reaction products. Plant Breed. 2006, 125, 305–307. [Google Scholar] [CrossRef]
  54. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
  55. Amiryousefi, A.; Hyvönen, J.; Poczai, P. iMEC: Online marker efficiency calculator. Appl. Plant Sci. 2018, 6, e01159. [Google Scholar] [CrossRef] [PubMed]
  56. Yeh, F.C.; Boyle, T.J.B. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belg. J. Bot. 1997, 129, 157–163. [Google Scholar]
  57. Kamvar, Z.N.; Tabima, J.F.; Grünwald, N.J. Poppr: An R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ 2014, 2, e281. [Google Scholar] [CrossRef] [PubMed]
  58. Dray, S.; Dufour, A.B. The ade4 package: Implementing the duality diagram for ecologists. J. Stat. Softw. 2007, 22, 1–20. [Google Scholar] [CrossRef]
  59. Gower, J.C. Some distance properties of latent root and vector methods used in multivariate analysis. Biometrika 1966, 53, 325–338. [Google Scholar] [CrossRef]
  60. Cooke, R.S.; Eigenbrod, F.; Bates, A.E. Projected losses of global mammal and bird ecological strategies. Nat. Commun. 2019, 10, 2279. [Google Scholar] [CrossRef] [PubMed]
  61. Nei, M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 1978, 89, 583–590. [Google Scholar] [CrossRef] [PubMed]
  62. Schliep, K.P. phangorn: Phylogenetic analysis in R. Bioinformatics 2011, 27, 592–593. [Google Scholar] [CrossRef] [PubMed]
  63. Zhao, M.; Shu, G.; Hu, Y.; Cao, G.; Wang, Y. Pattern and variation in simple sequence repeat (SSR) at different genomic regions and its implications to maize evolution and breeding. BMC Genom. 2023, 24, 136. [Google Scholar] [CrossRef] [PubMed]
  64. Gouta, H.; Ksia, E.; Buhner-Zaharieva, T.; Mliki, A.; Gogorcena, Y. Development of an SSR-based identification key for Tunisian local almonds. Sci. Agric. 2012, 69, 108–113. [Google Scholar] [CrossRef]
  65. Jalili, S.; Arzani, K.; Prudencio, A.S.; Salazar, J.A.; Martínez-García, P.J.; Bouzari, N.; Martínez-Gómez, P. Integrated morphological, physiological and molecular analysis of the drought response in cultivated and wild Prunus L. subgenera cerasus species. Plant Mol. Biol. Rep. 2023, 41, 440–453. [Google Scholar] [CrossRef]
  66. Halász, J.; Makovics-Zsohár, N.; Szőke, F.; Ercisli, S.; Hegedűs, A. Simple sequence repeat and S-locus genotyping to assist the genetic characterization and breeding of polyploid Prunus species, P. spinosa and P. domestica subsp. insititia. Biochem. Genet. 2021, 59, 1065–1087. [Google Scholar] [CrossRef] [PubMed]
  67. Urrestarazu, J.; Errea, P.; Miranda, C.; Santesteban, L.G.; Pina, A. Genetic diversity of Spanish Prunus domestica L. germplasm reveals a complex genetic structure underlying. PLoS ONE 2018, 13, e0195591. [Google Scholar] [CrossRef] [PubMed]
  68. Manco, R.; Chiaiese, P.; Basile, B.; Corrado, G. Comparative analysis of genomic- and EST-SSRs in European plum (Prunus domestica L.): Implications for the diversity analysis of polyploids. Biotech 2020, 10, 543. [Google Scholar] [CrossRef] [PubMed]
  69. Song, Q.; Fickus, E.; Cregan, P. Characterization of trinucleotide SSR motifs in wheat. Theor. Appl. Genet. 2002, 104, 286–293. [Google Scholar] [CrossRef] [PubMed]
  70. Yuan, M.; Gong, L.; Meng, R.; Li, S.; Dang, P.; Guo, B.; He, G. Development of trinucleotide (GGC)n SSR markers in peanut (Arachis hypogaea L.). Electron. J. Biotechnol. 2010, 13, 5–6. [Google Scholar] [CrossRef]
  71. Cipriani, G.; Spadotto, A.; Jurman, I.; Di Gaspero, G.; Crespan, M.; Meneghetti, S.; Testolin, R. The SSR-based molecular profile of 1005 grapevine (Vitis vinifera L.) accessions uncovers new synonymy and parentages, and reveals a large admixture amongst varieties of different geographic origin. Theor. Appl. Genet. 2010, 121, 1569–1585. [Google Scholar] [CrossRef] [PubMed]
  72. Sehic, J.; Garkava-Gustavsson, L.; Fernández-Fernández, F.; Nybom, H. Genetic diversity in a collection of European pear (Pyrus communis) cultivars determined with SSR markers chosen by ECPGR. Sci. Hortic. 2012, 145, 39–45. [Google Scholar] [CrossRef]
  73. Hong, J.H.; Chae, C.W.; Choi, K.J.; Kwon, Y.S. A database of simple sequence repeat (SSR) marker-based DNA profiles of citrus and related cultivars and germplasm. Hortic. Sci. Technol. 2016, 34, 142–153. [Google Scholar] [CrossRef]
  74. Serrote, C.M.L.; Reiniger, L.R.S.; Silva, K.B.; dos Santos Rabaiolli, S.M.; Stefanel, C.M. Determining the polymorphism information content of a molecular marker. Gene 2020, 726, 144175. [Google Scholar] [CrossRef] [PubMed]
  75. Antanyniené, R.; Šikšnianienė, J.B.; Stanys, V.; Frercks, B. Fingerprinting of plum (Prunus domestica) genotypes in Lithuania using SSR markers. Plants 2023, 12, 1538. [Google Scholar] [CrossRef] [PubMed]
  76. Tamarzizt, H.B.; Walker, D.; Mustapha, S.B.; Abdallah, D.; Baraket, G.; Hannachi, A.S.; Azzouzi, S.Z. DNA variation and polymorphism in Tunisian plum species (Prunus spp.): Contribution of flow cytometry and molecular markers. Genet. Mol. Res. 2015, 14, 18034–18046. [Google Scholar] [CrossRef] [PubMed]
  77. Pedersen, B.H. DNA fingerprints of 51 sweet and sour Prunus accessions using simple sequence repeats. J. Hortic. Sci. Biotechnol. 2006, 81, 118–124. [Google Scholar] [CrossRef]
  78. Arismendi, M.J.; Hinrichsen, P.; Almada, R.; Pimentel, P.; Pinto, M.; Sagredo, B. Characterization of genetic diversity of stone fruit rootstocks used in Chile by means of microsatellite markers. J. Am. Soc. Hortic. Sci. 2012, 137, 302–310. [Google Scholar] [CrossRef]
  79. Urbanovich, O.Y.; Kuzmitskaya, P.V.; Kilchevsky, A.V. Identification and genetic diversity of plum cultivars grown in Belarus. Russ. J. Genet. 2017, 53, 775–784. [Google Scholar] [CrossRef]
  80. Hayashi, K.; Shimazu, K.; Yaegaki, H.; Yamaguchi, M.; Iketani, H.; Yamamoto, T. Genetic diversity in fruiting and flower-ornamental Japanese apricot (Prunus mume) germplasms assessed by SSR markers. Breed. Sci. 2008, 58, 401–410. [Google Scholar] [CrossRef]
  81. Hasnaoui, N.; Buonamici, A.; Sebastiani, F.; Mars, M.; Zhang, D.; Vendramin, G.G. Molecular genetic diversity of Punica granatum L. (pomegranate) as revealed by microsatellite DNA markers (SSR). Gene 2012, 493, 105–112. [Google Scholar] [CrossRef] [PubMed]
  82. Gill, K.; Kumar, P.; Sharma, V.; Negi, S.; Sharma, M.; Sharma, R.; Joshi, A.K. Unraveling phenotypic ambiguities of kagzi and ornamental lime accessions: A comprehensive exploration through morpho-biochemical and DNA marker profiling. Genet. Resour. Crop Evol. 2024, 71, 3765–3790. [Google Scholar] [CrossRef]
  83. Schulze, J.A.; Contreras, R.N.; Scagel, C.F. Comparing vegetative propagation of two ‘Schipkaensis’ common cherry laurel ploidy levels. HortTechnology 2017, 27, 69–72. [Google Scholar] [CrossRef]
  84. Dirr, M.A. Manual of Woody Landscape Plants: Their Identification, Ornamental Characteristics, Culture, Propagation and Uses; Stipes Pub. Co.: Champaign, IL, USA, 1990; pp. 654–656. [Google Scholar]
Horticulturae 11 00854 g001
Figure 1. UPGMA dendrogram of Prunus laurocerasus accessions based on pairwise genetic distance. Bootstrap values (≥50%) from 1000 replicates are shown at the nodes. Country codes indicate accession origin: B—Bulgaria; E—England; F—France; G—Germany; H—Hungary (Józsa breeding program); H1—Hungary (Barabits breeding program); H2—Hungary (Németh breeding program); I—Ireland; N—The Netherlands; Sw—Sweden; U—USA.
Figure 1. UPGMA dendrogram of Prunus laurocerasus accessions based on pairwise genetic distance. Bootstrap values (≥50%) from 1000 replicates are shown at the nodes. Country codes indicate accession origin: B—Bulgaria; E—England; F—France; G—Germany; H—Hungary (Józsa breeding program); H1—Hungary (Barabits breeding program); H2—Hungary (Németh breeding program); I—Ireland; N—The Netherlands; Sw—Sweden; U—USA.
Horticulturae 11 00854 g001
Horticulturae 11 00854 g002
Figure 2. Principal Coordinate Analysis (PCoA) of 43 Prunus laurocerasus accessions based on 10 SSR markers and one S-RNase intron length polymorphism marker. Group 1 (blue) and Group 2 (green) comprise ornamental cultivars; Group 3 (red) includes fruit-bearing selections.
Figure 2. Principal Coordinate Analysis (PCoA) of 43 Prunus laurocerasus accessions based on 10 SSR markers and one S-RNase intron length polymorphism marker. Group 1 (blue) and Group 2 (green) comprise ornamental cultivars; Group 3 (red) includes fruit-bearing selections.
Horticulturae 11 00854 g002
Table 1. Origin of the ornamental cultivars and fruit-bearing selections used in the study.
Table 1. Origin of the ornamental cultivars and fruit-bearing selections used in the study.
NameType aSample
Collection Site b		OriginBreeder (Release Year)
Clone 11OSzHungaryMiklós Józsa
‘Baumgartner’OSzHungaryGéza Baumgartner and Miklós Józsa (1990)
‘Caucasica’OSzFrancen.d. (1852)
‘Copperbell’OSzThe NetherlandsFrans Muysers Boomkwekerijen vof
‘Elly’OSzGermanyAdrian Straver, Straver Gbr
‘Etna’OSzGermanyAdrian Straver, Straver Gbr
‘Gabi’OSzHungaryMiklós Józsa (2007)
‘Gajo’OSzThe NetherlandsWilhelmus P.C. Nouws (1996)
‘Genolia’OSzSwitzerlandPépinières de Genolier (2002)
‘Greentorch’OSzFrancePépinières Minier (2009)
Greenwich 1OROGEnglandn.d.
Greenwich 2OROGEnglandn.d.
‘Herbergii’OSzGermanyHerberg (1930)
‘Klári’OSzHungaryMiklós Józsa (1998)
‘Kleopátra’OSzHungaryMiklós Józsa (2007)
‘Legend’OSzThe NetherlandsGuido Rouwette
‘Magnoliifolia’OBAFrancen.d. (1869)
‘Mano’OSzHungaryElemér Barabits (2004)
‘Marbled White’OBAIrelandn.d. (1811)
‘Mari’OSzHungaryMiklós Józsa (1989)
‘Miki’OBAHungaryElemér Barabits (2004)
‘Mount Vernon’OSzUSAWells Nursery (1967)
‘Novita’OSzThe Netherlandsn.d.
‘Otto Luyken’OSzGermanyHermann Albrecht Hesse (1940)
‘Piri’OSzHungaryMiklós Józsa (1989)
‘Reynvaanii’OSzThe NetherlandsA.J. Reynvaan (1913)
‘Rotundifolia’OSzFranceL.C.B.Billard, Barre (1865)
‘Schipkaensis’OBABulgariaFranz Ludwig Späth (1889)
‘Schipkaensis Macrophylla’OSzGermanyG. D. Böhlje (1940)
‘Sofia’OSzHungaryGábor Németh
‘Van Nes’OSzThe NetherlandsP. van Nes (1935)
‘Zabeliana’OSzGermanyFranz Ludwig Späth (1898)
‘Zöldszőnyeg’OBAHungaryElemér Barabits Jr. (2004)
T2FBSRTürkiyeselection
T4FBSRTürkiyeselection
T6FBSRTürkiyeselection
T8FBSRTürkiyeselection
T10FBSRTürkiyeselection
T13FBSRTürkiyeselection
T16FBSRTürkiyeselection
T18FBSRTürkiyeselection
T20FBSRTürkiyeselection
T22FBSRTürkiyeselection
Note: References: [17,47,48,49,50,51,52], n.d. no data available. a O: ornamental; F: fruit-bearing. b BA: Budai Arborétum (Hungary), BSR: Black Sea Region (Türkiye), ROG: Royal Observatory Greenwich, London (England), Sz: Szombathely (Hungary).
Table 2. List of the primers used in the study.
Table 2. List of the primers used in the study.
Primer NameSequence (5′→3′)Amplicon Size in the Original Study (bp)Linkage GroupRepeat MotifReference
ASSR63F: CACCAATTTATGTTGCAAGATTATATG
R: GTTTTAGATTTCACAGTACTATG		154G8(GAT) 5[24]
BPTCT 007F: TCATTGCTCGTCATCAGC
R: CAGATTTCTGAAGTTAGCGGTA		149G3(AG) 22(CG) 2(AG) 4[25]
BPPCT 025F: TCCTGCGTAGAAGAAGGTAGC
R: CGACATAAAGTCCAAATGGC		197G6(GA) 29[25]
BPPCT 037F: CATGGAAGAGGATCAAGTGC
R: CTTGAAGGTAGTGCCAAAGC		155G5(GA) 25[25]
BPPCT 039F: ATTACGTACCCTAAAGCTTCTGC
R: GATGTCATGAAGATTGGAGAGG		154G3(GA) 20[25]
BPPCT 040F: ATGAGGACGTGTCTGAATGG
R: AGCCAAACCCCTCTTATACG		135G4(GA) 14[25]
CPSCT018F: AGGACATGTGGTCCAACCTC
R: GGGTTCCCCGTTACTTTCAT		162G8(CA) 5 (CT) 20[26]
CPSCT 021F: GCCACTTCGGCTAAAAGAGA
R: TCCATATCTCCTCCTGCTTGA		139G2(GA) 15[26]
CPDCT 044F: ACATGCCGGGTAATTAGCAA
R: AAAATGCACGTTTCGTCTCC		175G2(GA) 15[27]
CPDCT 045F: TGTGGATCAAGAAAGAGAACCA
R: AGGTGTGCTTGCACATGTTT		142G4(GA) 16[27]
PaConsIF: MCTTGTTCTTGSTTTYGCTTTCTTC
R2: GCCATTGTTGCACAAATTGA		234–458G6-[53]
Table 3. Marker efficiency parameters of the 11 primer pairs used to analyze 43 Prunus laurocerasus accessions.
Table 3. Marker efficiency parameters of the 11 primer pairs used to analyze 43 Prunus laurocerasus accessions.
NaANaNa/AccessionSize Range (bp)GuPICRpDp
ASSR 6353.442–4156–16790.191.950.53
BPPCT007277.584–1299–192410.209.770.92
BPPCT025529.675–13147–268420.2418.840.96
BPPCT037469.497–14106–231410.2312.930.96
BPPCT0396512.217–17100–242420.2421.070,97
BPPCT040388.025–12113–170430.2313.070.96
CPDCT044776.881–15105–283410.2813.400.99
CPDCT045236.073–9117–159370.216.840.93
CPSCT018182.331–5101–162290.264.330.86
CPSCT0215811.028–15117–185430.2419.630.96
S-RN-ase
1st intron		8911.492–18193–536420.2621.350.98
Mean45.278.30 370.2313.020.91
Note: Na, allele number; ANa, average allele number; allele number/accession; size range of amplified bands; Gu, number of unique genotypes; PIC, polymorphism information content; Rp, resolving power; Dp, discriminating power.
Table 4. Parameters describing genetic variability within and among the three groups of Prunus laurocerasus accessions, as revealed by principal coordinate analysis.
Table 4. Parameters describing genetic variability within and among the three groups of Prunus laurocerasus accessions, as revealed by principal coordinate analysis.
Number of AccessionsTotal Allele NumberAverage Allele NumberNumber of Unique AllelesAverage Number of Unique AllelesPolymorphic Alleles (%)
Group 12137118924.473.5
Group 21230225413.459.2
Group 31024324686.848.0
Note: Group 1 and 2 contain ornamental, and Group 3 contains fruit-bearing cultivars.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hegedűs, A.; Honfi, P.; Ercisli, S.; Ilhan, G.; Tóth, E.G.; Halász, J. Genetic Differentiation of Ornamental and Fruit-Bearing Prunus laurocerasus Revealed by SSR and S-Locus Markers. Horticulturae 2025, 11, 854. https://doi.org/10.3390/horticulturae11070854

AMA Style

Hegedűs A, Honfi P, Ercisli S, Ilhan G, Tóth EG, Halász J. Genetic Differentiation of Ornamental and Fruit-Bearing Prunus laurocerasus Revealed by SSR and S-Locus Markers. Horticulturae. 2025; 11(7):854. https://doi.org/10.3390/horticulturae11070854

Chicago/Turabian Style

Hegedűs, Attila, Péter Honfi, Sezai Ercisli, Gulce Ilhan, Endre György Tóth, and Júlia Halász. 2025. "Genetic Differentiation of Ornamental and Fruit-Bearing Prunus laurocerasus Revealed by SSR and S-Locus Markers" Horticulturae 11, no. 7: 854. https://doi.org/10.3390/horticulturae11070854

APA Style

Hegedűs, A., Honfi, P., Ercisli, S., Ilhan, G., Tóth, E. G., & Halász, J. (2025). Genetic Differentiation of Ornamental and Fruit-Bearing Prunus laurocerasus Revealed by SSR and S-Locus Markers. Horticulturae, 11(7), 854. https://doi.org/10.3390/horticulturae11070854

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop