Next Article in Journal
Perfluoroalkyl Substances Accumulation in Lettuce: Effects of Cultivar, Growth Stage, and Cultivation Conditions on Food Safety
Previous Article in Journal
High Tunnels as a Unique Theatre for Investigating the Complex Causes of Yellow Shoulder Disorder in Tomatoes
Previous Article in Special Issue
Synergistic Effects of Elevated CO2 and Enhanced Light Intensity on Growth Dynamics, Stomatal Phenomics, Leaf Anatomy, and Photosynthetic Performance in Tomato Seedlings
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 11
Issue 7
10.3390/horticulturae11070774
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Impact of Light Quality on the Growth and Quality of Celery

by
Li Tang
1,†,
Qianwen Chu
1,†,
Kaiyue Liu
1,
Yingyi Lu
1,
Shaobo Cheng
1,
Tonghua Pan
2,
Xiaoting Zhou
1 and
Zhongqun He
1,*
1
College of Horticulture, Sichuan Agricultural University, Chengdu 611130, China
2
School of Agricultural Engineering, Jiangsu University, Zhenjiang 212013, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2025, 11(7), 774; https://doi.org/10.3390/horticulturae11070774
Submission received: 29 May 2025 / Revised: 14 June 2025 / Accepted: 30 June 2025 / Published: 2 July 2025
(This article belongs to the Special Issue Latest Advances in Horticulture Production Equipment and Technology)
Browse Figures
Versions Notes

Abstract

Farming is an important development direction of agriculture in the future, which is affected by various environmental factors, among which light plays an important role, and it is essential for the growth of organisms in nature. LED technology can regulate the growth and development of vegetables by adjusting the spectral composition of light. In order to explore light quality formulation with the aim of improving the quality and yield of celery, we set up six experimental treatments: W (white light), R (red light), B (blue light), 3R1B (red light/blue light = 3:1), 4R1B (red light/blue light = 4:1), and 5R1B (red light/blue light = 5:1). The results indicated that the 3R1B and 4R1B illumination treatments were conducive to promoting the growth of celery, enhancing plant height and root length. Specifically, the 3R1B treatment optimized the nutritional quality of celery by increasing the levels of soluble protein, soluble sugar, and total flavonoids while reducing nitrate and cellulose contents and elevating the anthocyanin content in petioles. Additionally, both treatments enhanced the contents of Ca and Mg in celery leaves and petioles. Furthermore, the 3R1B treatment promoted the accumulation of photosynthetic pigments, upregulated the activities of ANS and FNS enzymes, and induced the upregulation of gene expression levels of FNS and ANS, thereby enhancing the nutritional value of celery.

1. Introduction

Plant morphogenesis is closely related to environmental factors such as light, temperature, and humidity. Among them, light is an important environmental factor that promotes plant growth [1,2,3]. Light quality is important for plant morphogenesis and material accumulation, which affects the accumulation of biomass and thus the morphological structure of plants [4,5,6]. In the field of vegetable cultivation, light quality regulation has become a key technology that can promote vegetable growth and improve quality [7]. In Brussels sprouts [8], blue light was more favorable for increasing chlorophyll and carotenoid contents. Some studies have shown that compared with blue light, the plant height, stem thickness, fresh weight, and strong seedling index of cucumber and Brussels sprouts under red and blue light treatment were significantly increased, and when the red-to-blue light ratio was 2:1, the fresh weight of the shoots of tomato was significantly increased, and the fresh weight of the roots was the highest [9]. In addition, key photochemical processes in fruits and vegetables are affected by different light qualities [10], with cherry tomato having higher Pn values under monochromatic blue light treatments and lower under combined red and blue light treatments, and the results under the monochromatic blue light treatment were about two times higher than under the red–blue combined light treatment [11]. Differences between red and blue light in regulating stomatal opening are mainly the result of the combined effect of chloroplasts and the reduction in the CO2 concentration between guard cells [12]. The same light quality treatments affected stomatal conductance differently in different plants, with blue, red, and yellow light regulating stomatal opening in greenhouse bell pepper leaves whilst red and blue light inhibited stomatal conductance in sugar beet [13]. Vegetables are rich in primary and secondary metabolites that are potentially beneficial to the human body, and improved light quality can significantly improve the nutritional quality of vegetables [14]. Staggered light duration with red light has been reported to promote the effects of blue light on protein and ascorbic acid synthesis [15]. Some studies have also pointed out that short-term blue light treatment can induce the nutritional content of Chinese cabbage. After blue light treatment, the proportion of flavonoids in metabolites was increased by more than 10%, and the proportion of phenolic acids was increased by more than 15% [16]. Therefore, only under appropriate light quality conditions can the quality of vegetables be improved.
Flavonoids are a class of natural polyphenols abundant in vegetables, and as secondary metabolites of plants, they have certain benefits for human health [17,18,19]; they belong to the class of plant secondary metabolites, including anthocyanins, apigenin, kaempferol, and chlorogenic acid. In recent years, there has been an increasing number of studies related to light regulation of secondary metabolites, and many reports have indicated that light quality plays an important role in regulating the synthesis of secondary metabolites in crops. It has been found that short-wavelength light (e.g., blue light) contributes to the accumulation of flavonoids, while long-wavelength light (e.g., red light) produces an inhibitory effect [20]. For example, enhanced blue light significantly promoted the production of flavonoids in pepper epidermis [21]. Among treatments using red light, yellow light, and blue light, the accumulation of 12 flavonoids in tobacco reached the highest level under blue light [22]. Light serves as a pivotal environmental factor regulating the synthesis of flavonoids within plants, where it not only influences plant morphogenesis and metabolic processes but is also directly involved in the biological basis of flavonoid synthesis, providing indispensable metabolic precursor substances for this complex chemical process [23].
Celery is a vegetable that is commonly cultivated around the world, and it is rich in a variety of nutrients and biologically active substances, including phenols, proteins, vitamins, apigenin, carotenoids, and anthocyanins, etc. It provides numerous beneficial effects on human health [24]. As a kind of vegetable with high nutritional value, celery is increasingly loved by people because of its outstanding pharmacological effects, its related processed products also bring great economic benefits, and its development and utilization have broad prospects.
In recent years, artificial light sources have widely been used in vegetable cultivation facilities, according to the different light demands of vegetables, to provide an optimal light environment, and the production environment can be controlled in order to deliver a stable and efficient output of safe and reliable products. LED technology can be used to adjust the spectral control in vegetable growth [25,26]. Celery is rich in nutrients such as cellulose, vitamins, and apigenin. It is low in calories and possesses health-promoting effects. Moreover, celery exhibits strong disease resistance during hydroponic cultivation, eliminating the need for pesticide application, which aligns with the requirements for non-polluting and environmentally friendly green cultivation practices. This study used Hongcheng red celery as the experimental material, and LED was used as the illumination light source to treat celery with different light qualities. Research was carried out on different parts of celery (roots, leaves, and petioles), with a primary emphasis on the leaves and petioles, aiming to explore the light quality recipe that can improve the quality and yield of celery, and aiming to ultimately screen out the optimal light quality ratio that is most suitable for celery growth and quality enhancement, thereby providing a theoretical basis for high-quality and efficient production of celery.

2. Materials and Methods

2.1. Experimental Materials

In this experiment, the high-quality celery variety ‘Hongcheng red celery’ (Apium graveolens L.), screened by a previous group, was selected as the test material; it is of high quality and is suitable for hydroponic cultivation, and the seeds used in the experiment came from Tianjin Hongcheng Celery Research Institute. Full and healthy celery seeds were placed in warm water (50 °C) for 30 min, soaked in cool water for 24 h, then treated in a refrigerator at 4 °C for 6 h and were subsequently placed in an incubator for germination (18 °C, 80% humidity.). The whitened seeds were sown in black round hole cross-seedling sponges (250 × 250 × 20 mm) for hydroponic seedling cultivation.

2.2. Experimental Design

At the five-leaf-one-heart stage, healthy, pest-free celery seedlings were selected for transplantation into hydroponic systems. Six lighting treatments were set up: white (CK), red (R), blue (B), and 3R1B, 4R1B, and 5R1B ratios, using 18 W LED lamps (661 nm red, 442 nm blue). Each treatment maintained PPFD = 200 ± 10 μmol·m−2·s−1. Each treatment had 24 plants in 3 replicates, which were harvested after 45 days. Environmental conditions were as follows: 24 °C day, 18 °C night, 12 h light/dark cycle, 50% humidity, 1/2 Hoagland’s nutrient solution (pH 6.5 ± 0.5, EC 2 ± 0.5 mS·cm−1), replaced every 15 days, with continuous oxygen supply. Figure 1 shows the spectral distributions.

2.3. Determination of Biomass

Following 45 days of exposure to the various light qualities, the celery plants were harvested and randomly sampled. We used a ruler to measure the plant height and root length and used a vernier caliper to measure the stem diameter, and the dry and fresh weights of the aboveground parts and roots were measured with an electronic balance.

2.4. Determination of Photosynthetic Parameters

We used an Li-6400XT (Li-6400, Lincoln, NE, USA) photosynthesizer to measure the light and gas parameters. A total of 0.2 g of celery leaves was weighed and immersed in a centrifuge tube with 80% acetone solution until the leaves turned completely white, and the absorbance values were measured at wavelengths of 470, 645, and 663 nm, and the contents of various photosynthetic pigments were calculated [27,28].

2.5. Determination of Quality Indicators

Quality indexes of celery were determined after 45 days of different red and blue light treatments. The anthrone colorimetric method was used to determine soluble sugars [29]. Soluble proteins were determined by the G-250 method using Coomassie Blue [30]. The nitrate content was measured using the salicylic acid–sulfuric acid colorimetric method [31]. The determination of vitamin C was referenced from the method of Chen et al. [32]. The fiber content was determined by the digestion and gravimetric method [33]. The total flavonoid content was determined by the AlCl3 colorimetric method [34]. We used the Folin–Ciocalteu method to determine the total phenol content [35] and used the pH differential method to determine the content of total anthocyanin [36]. The content of apigenin was determined by liquid chromatography [37].

2.6. Determination of Mineral Elements

The content of mineral elements was determined according to GB/T 23375-2009 [38]. A total of 0.5 g of finely powdered dried samples was weighed and subjected to overnight digestion with 5 mL of nitric acid. Subsequently, the mixture was placed in a microwave digestion system for 90 min of digestion. The acid was then driven off until the liquid became transparent and reduced to approximately 1 mL. The resulting solution was transferred to a 25 mL centrifuge tube, where it was volume-adjusted and filtered. Calcium (Ca), magnesium (Mg), iron (Fe), and zinc (Zn) concentrations were determined using an atomic absorption spectrophotometer. Before measuring the Ca content, we added a specific volume of lanthanum chloride to the diluent.

2.7. Determination of Enzyme Activities Associated with Major Flavonoid Compounds

Enzymes related to the synthesis of major flavonoids, including chalcone synthase (CHS), flavonoid synthase (FNS), phenylalanine deaminase (PAL), chalcone isomerase (CHI), and anthocyanin synthase (ANS), were determined using ELISA kits, which were produced by Jiangsu Enzyme Immunity Industry Co. in Yancheng, China.

2.8. Determination of Expression Analysis of Key Flavonoid-Related Genes

RNA extraction in celery was performed by a modified CTAB method. A TaKaRa’s PrimeScript™ RT Kit (Takara Biomedical Technology (Beijing) Co., Ltd., Beijing, China) was used to perform the reverse transcription. The reverse transcription products were stored at −20 °C and were used for quantitative fluorescence detection. The amplification procedure was as follows: 95 °C for 30 s, 40 cycles, 95 °C for 5 s, and 5 °C for 15 s. The results were analyzed using the 2−ΔΔCt formula. We used actin (AF111812) as an internal control. The primer sequences are shown in Table 1 below.

2.9. Statistical Analysis

Experimental data were analyzed using IBM SPSS Statistics 23.0. At a significance level of p ≤ 0.05, an LSD multiplex range test was used to determine differences between treatments. The data are shown as mean ± standard error (SE). Origin 2023 was used for graphing, respectively.

3. Results and Analysis

3.1. Effects of Different Light Quality Treatments on Biological Parameters of Celery

The biomass accumulation of celery was affected by the different light qualities. As shown in Figure 2 and Figure 3, under the 3R1B light treatment, the root length of celery was significantly different from that under the W light treatment, with it being 66.67% higher. However, when the proportion of red light was further increased based on the 3R1B light treatment, the plant height and root length began to decrease. Additionally, the plant height of celery under the separate R and B light treatments was significantly lower than that of the control. As shown in Table 1, the dry and fresh weights of the aboveground parts and root system were significantly higher than those under the other treatments. The stem diameter of celery under the 3R1B light treatment was over 13 mm, with it being significantly higher than that of other treatments. The fresh weight of the aboveground part of celery under the R and B light treatments was significantly reduced (Table 2). This indicates that treatment with an appropriate ratio of red and blue light has a positive effect on the growth of celery.

3.2. Effects of Different Light Quality Treatments on Photosynthetic and Fluorescence Characteristics of Celery

The different light treatments had significant impacts on the photosynthetic indices of celery. In this experiment, the photosynthetic pigment content of celery under the 3R1B light treatment was increased. As the cornerstone of plant life activities, photosynthesis has an irreplaceable role in promoting plant growth and development. In this study, the contents of Pn, Gs, Ci, and Tr in the celery leaves under the 3R1B light treatment were higher than those in the other treatments, and they increased by 26.52%, 10.53%, 52.90%, and 27.83% compared to the W light treatment. There were different decreases under the 4R1B and 5R1B light treatments (Figure 4).

3.3. Effects of Different Light Quality Treatments on Quality of Celery

Figure 5 illustrates the effects of the different light quality treatments on the quality of the celery leaves and petioles. Compared to the W light treatment, the nitrate content in the celery leaves and petioles under the 3R1B light treatment was significantly reduced, with a 38.79% decrease in nitrate content in petioles compared to the W light treatment and reductions of more than 22% compared to the other treatments. Additionally, the contents of soluble sugars, soluble proteins, and total phenols increased significantly, surpassing those under the other treatments. Furthermore, under the 3R1B light condition, the vitamin C content in the celery leaves reached the highest level, exhibiting significant differences compared to the other treatments.
Crude fiber is a crucial indicator in evaluating the quality of celery, as an excessive content may compromise its taste. Under the sole R light irradiation treatment, the highest cellulose content was observed in celery petioles, whereas the lowest content was recorded under the 3R1B (red and blue light combination) treatment, with a significant difference between the two. Furthermore, as the proportion of red light increased, the cellulose content in celery petioles also rose.
Flavonoids have an important impact on plant oxidative stress. Under the R light treatment, the anthocyanin content in celery petioles increased significantly, reaching the highest level under the 3R1B light treatment, with an increase of 473.20% compared to the R light treatment. In addition, with the increase in the proportion of red light, the anthocyanin content showed a decreasing trend. Apigenin and total flavonoids in the celery leaves and petioles were significantly increased with the 3R1B light treatment compared to the W light treatment (Figure 6). In particular, the apigenin content in petioles increased by more than 43% compared to the other treatments. Overall, the total flavonoid content in celery petioles with the combined light treatments (3R1B, 4R1B, and 5R1B) was higher than that with the single light treatments (R, B).

3.4. Effects of Different Light Quality Treatments on the Content of Mineral Elements in Celery

Mineral elements are crucial factors influencing plant growth. Their content is higher in the celery leaves. In terms of macronutrients (Ca, Mg), the 3R1B light treatment significantly increased their content in both the celery leaves and petioles compared with the W light treatment and reached the highest level among all the treatments, while the individual R and B light treatments reduced their content in celery petioles. In terms of trace elements (Fe, Zn), the 3R1B light treatment increased their content in both the celery leaves and petioles compared to the W light treatment, whereas their content significantly decreased under R or B light alone. Furthermore, as the ratio of R light increased, the mineral elements (Ca, Mg, Fe, Zn) in the celery petioles and leaves exhibited a downward trend (Figure 7). In summary, compared to the other treatments, the 3R1B light treatment enhanced the mineral element content in both the celery leaves and petioles.

3.5. Effects of Light Quality on Enzyme Activity Related to Flavonoid Synthesis of Celery

The activities of enzymes related to apigenin and anthocyanin synthesis in celery were different under the different light treatments. The phenylalanine ammonia-lyase (PAL) activity in celery petioles under the 3R1B, 4R1B, and 5R1B light treatments was essentially the same as that under the white light (W) treatment, showing no significant difference. However, under the red (R) and blue (B) light treatments, the PAL activity in celery petioles was significantly lower by 10.29% and 4.60%, respectively, compared to the W light treatment. The chalcone synthase (CHS) activity in celery petioles under the R, B, and 3R1B light treatments was lower by 11.90%, 8.37%, and 2.51%, respectively, than under the W light treatment. Additionally, compared to the W light treatment, the activities of chalcone isomerase (CHI), flavone synthase (FNS), and anthocyanidin synthase (ANS) in celery petioles increased under the 3R1B light treatment. In summary, except for CHS activity in celery petioles, the activities of CHS, PAL, FNS, CHI, and ANS in the celery leaves and petioles reached their highest levels under the 3R1B light treatment and began to decline as the red light ratio increased (Figure 8).

3.6. Effects of Light Quality on Genes Related to Celery Flavonoid Synthesis

Compared with the W light treatment, the activities of CHS, PAL, FNS, CHI, and ANS in the celery leaves were upregulated under the 3R1B light treatment, reaching the highest level, in which FNS and ANS had a high fold increase in expression. However, the activities of PAL, CHI, and ANS in celery petioles were downregulated under the R and B light treatments. The expression level of the apigenin synthesis gene FNS decreased with the increase in the red light ratio, which was lower than that of the control under the 5R1B light treatment (Figure 9).

3.7. Correlation Analysis of Celery Leaves and Petioles

In order to gain insight into the relationship between the different light quality treatments of celery leaves and petioles and the photosynthetic characteristics and nutritional quality variables of celery, a correlation analysis was performed. The results (Figure 10) indicated that plant height and aboveground fresh weight of the celery leaves showed a significant positive correlation with aboveground dry weight, intercellular CO2 concentration, transpiration rate, total flavonoids, Ca, Mg, and ANS. Apigenin showed a significant positive correlation with soluble sugar, soluble protein, chlorophyll a, belowground fresh weight, belowground dry weight, PAL, CHS, and ANS. Total flavonoid content showed a positive correlation with soluble protein, soluble sugar, PAL, CHS, CHI, ANS, and FNS. Apigenin in celery petioles showed a positive correlation with soluble sugars, soluble proteins, vitamin C, total phenols, and anthocyanins, and anthocyanins were significantly and positively correlated with apigenin, nitrate, and PAL. In addition, there were also correlations among many other indicators; for example, apigenin was positively correlated with total flavonoids and negatively correlated with cellulose.

4. Discussion

Light serves as a pivotal regulatory factor during the plant growth, with its varying spectral components (light quality) exerting significant and profound impacts on plant growth rate, developmental stages, and morphological architecture. It has been reported that exposure to red and blue light can promote the growth of lettuce [39]. When the light intensity was 240 and 300 μmol·m−2·s−1, compared to the 1R:1B treatment, the 2R:1B treatment increased the biomass of shoots and roots [40]. Red light conditions have a positive effect on the plant response of seedlings [41]. In this study, the plant height, root length, and aboveground and root fresh weight of celery were highest under the 3R1B treatment. They were reduced under the separate red or blue light treatments. This indicates that an appropriate proportion of red and blue light has a positive effect on the growth and development of plants, increasing the biomass of both aboveground and belowground parts and promoting the morphogenesis of the plants.
The study of the effect of light on plant photosynthesis has always been a hot research topic [42]. The growth and physiology of plants were strongly affected by red and blue light, and blue light was shown to be more effective in maintaining the chloroplast ultrastructure and induced a higher photosynthetic capacity than red light. Combined light irradiation with a ratio of 2R:1B can significantly enhance the fresh weight and net photosynthetic rate of Taxus yunnanensis, and a ratio of 3R:1B attenuated damage due to plant membrane lipid peroxidation, suggesting that an appropriate ratio of red and blue light has a promotional impact on the growth and development of plants [43]. In addition, the species-specificity of plant responses to red and blue light are emphasized [44]. In this study, the photosynthetic pigments of celery under the R light treatment were higher than under the B light treatment, but the Pn, Gs, and Tr contents were lower than under the B light treatment. Under the 3R1B light treatment, celery had the highest gas exchange parameters and photosynthetic pigments. In conclusion, the content of photosynthetic pigments in celery was increased and photosynthesis was enhanced under the 3R1B light treatment.
The primary and secondary metabolites in vegetables are potentially beneficial to the human body, and the nutritional quality of vegetables is enhanced when the light quality is improved [45]. Light plays a dominant role in the nitrate metabolism of plants [46]. In our study, the 3R1B light treatment reduced the nitrate content in celery significantly, and the R light treatment alone increased the nitrate content in the celery leaves significantly. The study showed that the vitamin C content varied under the different light qualities, possibly because different light qualities regulate vitamin C synthesis in plants by modulating different active enzymes or sugar interactions in plants [47]. Flavonoids, such as kaempferol, trichoderma flavonoids, chlorogenic acid, p-coumaric acid, anthocyanins, and apigenin, have antimicrobial and antioxidant effects, and these secondary metabolites also have medicinal value and biological significance [48]. Some researchers exposed cherry tomato seedlings to blue light, and the results indicated that under red light irradiation, the total phenolic compounds and total flavonoids significantly increased, whereas they significantly decreased under blue light [49]. In this experiment, the 3R1B light treatment increased the soluble sugars, soluble proteins, total phenols, and apigenin content and decreased the cellulose content in the celery leaves and petioles; furthermore, the highest anthocyanin contents were found in celery petioles. The cellulose content is an important quality index of celery. Compared with the W light treatment, the cellulose content in celery petioles was increased significantly under the R light treatment. In addition, in the 3R1B, 4R1B, and 5R1B treatments, the cellulose content in celery petioles exhibited an upward trend, indicating that red light promotes the cellulose content in celery petioles. During the cultivation of celery, an appropriate proportion of red and blue light is favorable for enhancing the quality of celery.
The quality of light has a major impact on the mineral element content in plants. Mineral elements play a key role in the composition and physiological activities of plants [50]. There have been studies that indicate that supplementation using red LED light can strongly promote the absorption and accumulation of trace elements such as iron and manganese in onions [51]. In our experiment, the contents of calcium, magnesium, iron, and zinc in the celery leaves and petioles under the 3R1B light treatment increased significantly. Furthermore, compared with the R light or B light treatments alone, the mineral content in celery petioles was higher under the red–blue combined light treatments, indicating that although the plants were effective in the uptake and accumulation of mineral elements under the red light treatment, the effect of red and blue light in an appropriate ratio was better. Therefore, different light qualities can be utilized to enhance the quality of celery.
It is well known that the synthesis of anthocyanins is induced by light. Light-mediated anthocyanin synthesis is influenced by the wavelength of the light irradiation [52]. Studies have indicated that peculiar RB light combinations are important for the accumulation of carotenoids and anthocyanins in Batavian lettuce [53]. In this study, the anthocyanin content in the celery petioles under the R light treatment was higher than that under the W light and B light treatments. Under the 3R1B light conditions, the anthocyanin content reached its maximum and began to decline with the increase in the ratio of red light. This indicates that red light promotes the synthesis of anthocyanins in celery. The decreasing trend of the anthocyanin content in the celery petioles under the 3R1B, 4R1B, and 5R1B treatments may be related to the reduction in short-wave light. Meanwhile, the anthocyanin content in the celery leaves was negligible, which may be associated with the color of the celery leaves.
Anthocyanins and apigenin, as antioxidant components, have important effects on oxidative stress in plants. Different light qualities possibly alter the flavonoid content by affecting the expression of flavonoid-synthesizing enzymes and related genes. The PAL, CHS, CHI, FNS, and ANS enzymes serve as key enzymes during the synthesis of apigenin and anthocyanins in plants [54]. It has been found that the contents of kaempferol, isoquercitrin, and quercetin in the leaves of Cymbopogon flexuosus were highest under blue light irradiation, and the content of flavonoids was significantly and positively correlated with the expression of genes related to upstream key enzymes [55]. In this study, the 3R1B light treatment increased the activities of flavonoid-synthesizing enzymes in the celery leaves and petioles, such as flavonoid synthase (FNS), chalcone isomerase (CHI), and anthocyanin synthase (ANS), while simultaneously inducing an upregulation in the expression of the FNS and ANS genes. The expression of these genes was both upregulated and downregulated by the R and B light treatments. This indicates that the application of an appropriate ratio of red and blue light can increase the activity and gene expression of flavonoid-synthesis-related enzymes in celery and thus increase the content of flavonoid compounds and improve the quality of celery.
The present study aimed to explore the optimal light recipe for celery by evaluating the growth parameters, photosynthetic pigment accumulation, and nutritional quality of mature celery plants. However, there remains a notable lack of in-depth research into the specific mechanisms underlying the effects of light recipes. In the future, by delving deeper into these mechanisms, we can further refine and optimize the optimal lighting conditions required for celery growth. Additionally, while this investigation solely discusses the effects of light quality on celery growth and quality, subsequent studies should also explore the effects of other environmental factors such as light intensity, photoperiod, temperature, relative humidity, CO2 concentration, and nutrient solution concentration on its growth. Such comprehensive research holds significant importance for the development of plant factories.

5. Conclusions

Red and blue light treatments alone decreased the biomass of celery and negatively affected its photosynthesis. However, exposure to red light alone improved the content of flavonoids in the petioles and improved their nutritional quality. Under the 3R1B light treatment, the biomass, photosynthetic indices, and quality indicators of the celery leaves and petioles were all improved, and the effects of the 4R1B and 5R1B light treatments were not as effective as that of the 3R1B light treatment. Taking into consideration the results of the correlation analyses, we concluded that the 3R1B light treatment was the optimal for celery growth. The results of the correlation analysis indicate that the 3R1B light treatment represents the optimal ratio for promoting celery growth.

Author Contributions

L.T.: formal analysis, writing—original draft, writing—review and editing; K.L.: formal analysis, writing—original draft, writing—review and editing; Q.C.: writing—review and editing; Y.L.: writing—review and editing; S.C.: writing—review and editing; T.P.: investigation, writing—review and editing; X.Z.: writing—review and editing; Z.H.: conceptualization, methodology, project administration, writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Second Tibetan Plateau Scientific Expedition and Research (2019QZKK0303) and Sichuan Luzhou expert workstation (2322339013).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data will be made available on reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Frede, K.; Schreiner, M.; Baldermann, S. Light quality-induced changes of carotenoid composition in pak choi. J. Photochem. Photobiol. B-Biol. 2019, 193, 18–30. [Google Scholar] [CrossRef] [PubMed]
  2. Mao, H.; Hang, T.; Zhang, X.; Lu, N. Both Multi-Segment Light Intensity and Extended Photoperiod Lighting Strategies, with the Same Daily Light Integral, Promoted Lactuca sativa L. Growth and Photosynthesis. Agronomy 2019, 9, 857. [Google Scholar] [CrossRef]
  3. Zhou, J.; Li, P.; Wang, J. Effects of Light Intensity and Temperature on the Photosynthesis Characteristics and Yield of Lettuce. Horticulturae 2022, 8, 178. [Google Scholar] [CrossRef]
  4. Nguyen, T.K.L.; Cho, K.M.; Lee, H.Y.; Cho, D.Y.; Lee, G.O.; Jang, S.N.; Lee, Y.; Kim, D.; Song, K.H. Effects of White LED Lighting with Specific Shorter Blue and/or Green Wavelength on the Growth and Quality of Two Lettuce Cultivars in a Vertical Farming System. Agronomy 2021, 11, 2111. [Google Scholar] [CrossRef]
  5. Si, C.C.; Lin, Y.; Luo, S.M.; Yu, Y.H.; Liu, R.Q.; Naz, M.; Dai, Z.C. Effects of LED Light Quality Combinations on Growth and Leaf Colour of Tissue Culture-Generated Plantlets in Sedum rubrotinctum. Hortic. Sci. Technol. 2024, 42, 53–67. [Google Scholar] [CrossRef]
  6. Yan, Z.; Li, X.; Li, Z.; Qi, Y.; Song, J.; Cheng, F.; Dou, H.; Yang, Y. Partially Substituting Photosynthetic Photon Flux Density with Far-red Photons Differentially Alters Biomass Accumulation and Photochemical Efficiency of Greenhouse Lettuce. HortScience 2024, 59, 1691–1699. [Google Scholar] [CrossRef]
  7. Stamford, J.D.; Stevens, J.; Mullineaux, P.M.; Lawson, T. LED Lighting: A Grower’s Guide to Light Spectra. HortScience 2023, 58, 180–196. [Google Scholar] [CrossRef]
  8. Toscano, S.; Cavallaro, V.; Ferrante, A.; Romano, D.; Patane, C. Effects of Different Light Spectra on Final Biomass Production and Nutritional Quality of Two Microgreens. Plants 2021, 10, 1584. [Google Scholar] [CrossRef]
  9. Li, W.L.; Liang, Z.L. Effect of different LED light sources on growth characteristics of cucumber seedlings. Mod. Hortic. 2017, 3, 15–18. (In Chinese) [Google Scholar]
  10. Zhang, X.; Zhang, M.; Xu, B.; Mujumdar, A.S.; Guo, Z. Light-emitting diodes (below 700 nm): Improving the preservation of fresh foods during postharvest handling, storage, and transportation. Compr. Rev. Food Sci. Food Saf. 2022, 21, 106–126. [Google Scholar] [CrossRef]
  11. Kong, L.; Wen, Y.; Jiao, X.; Liu, X.; Xu, Z. Interactive regulation of light quality and temperature on cherry tomato growth and photosynthesis. Environ. Exp. Bot. 2021, 182, 104326. [Google Scholar] [CrossRef]
  12. Kinoshita, T.; Shimazaki, K. Blue light activates the plasma membrane H(+)-ATPase by phosphorylation of the C-terminus in stomatal guard cells. EMBO J. 1999, 18, 5548–5558. [Google Scholar] [CrossRef] [PubMed]
  13. D’Egidio, S.; Galieni, A.; Stagnari, F.; Pagnani, G.; Pisante, M. Yield, Quality and Physiological Traits of Red Beet Under Different Magnesium Nutrition and Light Intensity Levels. Agronomy 2019, 9, 379. [Google Scholar] [CrossRef]
  14. Braidot, E.; Petrussa, E.; Peresson, C.; Patui, S.; Bertolini, A.; Tubaro, F.; Wahlby, U.; Coan, M.; Vianello, A.; Zancain, M. Low-intensity light cycles improve the quality of lamb’s lettuce during storage at low temperature. Postharvest Biol. Technol. 2014, 90, 15–23. [Google Scholar] [CrossRef]
  15. Chen, X.; Yang, Q.; Song, W.; Wang, L.; Guo, W.; Xue, X. Growth and nutritional properties of lettuce affected by different alternating intervals of red and blue LED irradiation. Sci. Hortic. 2017, 223, 44–52. [Google Scholar] [CrossRef]
  16. Zhang, R.; Liu, Y.; Pan, Q.; Khan, A.; Bai, X.; Ali, M.; Yang, W.; Zhang, L.; Li, B. The effects of short term blue light treatment on promoting nutrition value in Chinese cabbage. Food Chem. 2013, 412, 135542. [Google Scholar] [CrossRef]
  17. Jain, K.; Desai, N.; Sharma, K.; Marwal, A. Development and screening of byproduct for its secondary metabolites, antioxidant and anti-diabetic potential from anthracnose-infected fruits of pomegranate: A sustainable approach. 3 Biotech 2021, 11, 74. [Google Scholar] [CrossRef]
  18. Zhang, D.Z.; Du, M.Z.; Wei, Y.; Wang, C.T.; Shen, L.Q. A review on the structure–activity relationship of dietary flavonoids for protecting vascular endothelial function: Current understanding and future issues. J. Food Biochem. 2018, 42, 0145–8884. [Google Scholar] [CrossRef]
  19. Danila, C.; Tamara, Y.; Forbes, H.; Lucia, R.; José, M.; Alvarez, S.; Maria, D.N.H.; Xiao, J.B.; José, L.; Quiles, M.B.; et al. The reciprocal interaction between polyphenols and other dietary compounds: Impact on bioavailability, antioxidant capacity and other physico-chemical and nutritional parameters. Food Chem. 2022, 375, 131904. [Google Scholar]
  20. Alokam, S. Red/Far-Red Light-Mediated Stem Elongation Response and Regulation of Anthocyanin Biosynthesis in Alpine and Prairie Ecotypes of Stellaria longipe. Master’s Thesis, University of Calgary, Calgary, AB, Canada, 2000. [Google Scholar]
  21. Liu, C.; Wan, H.; Yang, Y.; Ye, Q.; Zhou, G.; Wang, X.; Ahammed, G.J.; Cheng, Y. Post-Harvest LED Light Irradiation Affects Firmness, Bioactive Substances, and Amino Acid Compositions in Chili Pepper. Foods 2022, 11, 2712. [Google Scholar] [CrossRef]
  22. Fu, B.; Ji, X.; Zhao, M.; He, F.; Wang, X.; Wang, Y.; Liu, P.; Niu, L. The influence of light quality on the accumulation of flavonoids in tobacc leaves. J. Photochem. Photobiol. B-Biol. 2016, 162, 544–549. [Google Scholar] [CrossRef] [PubMed]
  23. Qin, Y.; Liu, X.; Li, C.; Chu, Q.; Cheng, S.; Su, L.; Shao, D.; Guo, X.; He, Z.; Zhou, X. Effect of light intensity on celery growth and flavonoid synthesis. Front. Plant Sci. 2024, 14, 1326218. [Google Scholar] [CrossRef] [PubMed]
  24. Yusni, Y.; Zufry, H.; Meutia, F.; Sucipto, K.W. The effects of celery leaf treatment on blood glucose and insulin levels in elderly pre-diabetics. Saudi Med. J. 2018, 39, 154–160. [Google Scholar] [CrossRef] [PubMed]
  25. Yu, H.; Yu, H.; Zhang, B.; Chen, M.; Liu, Y.; Sui, Y. Quantitative Perturbation Analysis of Plant Factory LED Heat Dissipation on Crop Microclimate. Horticulturae 2023, 9, 660. [Google Scholar] [CrossRef]
  26. Sun, J.; Tan, X.; Liu, B.; Battino, M.; Meng, X.; Zhang, F. Blue light inhibits gray mold infection by inducing disease resistance in cherry tomato. Postharvest Biol. Technol. 2024, 215, 113006. [Google Scholar] [CrossRef]
  27. Lichtenthaler, H.K.; Buschmann, C.J.J.W.; Sons, I. Chlorophylls and Carotenoids: Measurement and Characterization by UV-VIS Spectroscopy. Curr. Protoc. Food Anal. Chem. 2001, 1, F4.3.1-F4.3.8. [Google Scholar] [CrossRef]
  28. Shabbir, A.; Mao, H.; Ullah, I.; Buttar, N.A.; Ajmal, M.; Lakhiar, I.A. Effects of Drip Irrigation Emitter Density with Various Irrigation Levels on Physiological Parameters, Root, Yield, and Quality of Cherry Tomato. Agronomy 2020, 10, 1685. [Google Scholar] [CrossRef]
  29. Nejad, M.S.; Niroomand, A. Carbohydrate content and its roles in alternate bearing in olive. Pak. J. Biol. Sci. 2007, 10, 2744–2747. [Google Scholar]
  30. Blakesley, R.W.; Boezi, J.A. A new staining technique for proteins in polyacrylamide gels using coomassie brilliant blue G250. Anal. Biochem. 1977, 82, 580–582. [Google Scholar] [CrossRef]
  31. Cataldo, D.A.; Haroon, M.; Schrader, L.E.; Youngs, V.L. Communications in soil science and plant analysis rapid colorimetric determination of nitrate in plant tissue by nitration of salicylic acid. Commun. Soil Sci. Plant Anal. 1975, 6, 71–80. [Google Scholar] [CrossRef]
  32. Chen, G.; Mo, L.; Li, S.; Zhou, W.; Wang, H.; Liu, J.; Yang, C. Separation and determination of reduced vitamin C in polymerized hemoglobin-based oxygen carriers of the human placenta. Artif. Cells Nanomed. Biotechnol. 2015, 43, 152–156. [Google Scholar] [CrossRef] [PubMed]
  33. Antia, B.S.; Akpan, E.J.; Okon, P.A.; Umoren, I.U. Nutritive and Anti-Nutritive Evaluation of Sweet Potatoes (Ipomoea batatas) Leaves. Pak. J. Nutr. 2006, 5, 166–168. [Google Scholar] [CrossRef]
  34. Ghadage, D.M.; Kshirsagar, P.R.; Pai, S.R.; Chavan, J.J. Extraction efficiency, phytochemical profiles and antioxidative properties of different parts of Saptarangi (Salacia chinensis L.)—An important underutilized plant. Biochem. Biophys. Rep. 2017, 12, 79–90. [Google Scholar] [CrossRef] [PubMed]
  35. Singleton, V.L.; Orthofer, R.; Lamuela-Raventós, R.M. Analysis of total phenols and other oxidation substrates and antioxidants by means of Folin-Ciocalteu reagent. Methods Enzymol. 1999, 299, 152–178. [Google Scholar]
  36. Moldovan, B.; David, L.; Donca, R.; Chisbora, C. Degradation kinetics of anthocyanins from crude ethanolic extract from sour cherries. Stud. Univ. Babes-Bolyai Chem. 2011, 56, 189–194. [Google Scholar]
  37. Sandoval, L.; Ettiene, G.; Perez-Perez, E.; Fuenmayor, M.; Raga, J.; Silva, N. HPLC determination of flavonoids in fruits of soursop from different plants. Rev. Fac. Agron. Univ. Zulia 2014, 31, 785–800. [Google Scholar]
  38. GB/T 23375-2009; Determination of Copper, Iron, Zinc, Calcium, Magnesium And Phosphorus in Vegetables And Their Products. National Standard of the People’s Republic of China: Beijing, China, 2009.
  39. Ohtake, N.; Ishikura, M.; Suzuki, H.; Yamori, W.; Goto, E. Continuous Irradiation with Alternating Red and Blue Light Enhances Plant Growth While Keeping Nutritional Quality in Lettuce. HortScience 2018, 53, 1804. [Google Scholar] [CrossRef]
  40. Zha, L.; Liu, W. Effects of light quality, light intensity, and photoperiod on growth and yield of cherry radish grown under red plus blue LEDs. Hortic. Environ. Biotechnol. 2018, 59, 511–518. [Google Scholar] [CrossRef]
  41. Rabara, R.C.; Behrman, G.; Timbol, T.; Rushton, P.J. Effect of Spectral Quality of Monochromatic LED Lights on the Growth of Artichoke Seedlings. Front. Plant Sci. 2017, 8, 190. [Google Scholar] [CrossRef]
  42. Miao, Y.; Chen, Q.; Qu, M.; Gao, L.; Hou, L. Blue light alleviates ‘red light syndrome’ by regulating chloroplast ultrastructure, photosynthetic traits and nutrient accumulation in cucumber plants. Sci. Hortic. 2019, 257, 108680. [Google Scholar] [CrossRef]
  43. Li, Y.; Xu, J.; Zhang, F.; Gu, Y.; Tian, W.; Tian, W.; Tong, Y.; Li, J. The combination of red and blue light increases the biomass and steroidal saponin contents of Paris polyphylla var. yunnanensis. Ind. Crops Prod. 2023, 194, 116311. [Google Scholar] [CrossRef]
  44. Liang, Y.; Kang, C.; Kaiser, E.; Kuang, Y.; Yang, Q.; Li, T. Red/blue light ratios induce morphology and physiology alterations differently in cucumber and tomato. Sci. Hortic. 2021, 281, 109995. [Google Scholar] [CrossRef]
  45. Chu, Q.; Qin, Y.; Li, C.; Cheng, S.; Su, L.; He, Z.; Zhou, X.; Shao, D.; Guo, X. Effects of Different Photoperiods on the Growth and Nutritional Characteristics of Two Celery Cultivars in Plant Factory. Agronomy 2023, 13, 3039. [Google Scholar] [CrossRef]
  46. Wojciechowska, R.; Kolton, A.; Dlugosz-Grochowska, O.; Knop, E. Nitrate content in Valerianella locust L. plants is affected by supplemental LED lighting. Sci. Hortic. 2016, 211, 179–186. [Google Scholar] [CrossRef]
  47. Samuoliene, G.; Sirtautas, R.; Brazaityte, A.; Duchovskis, P. LED lighting and seasonality effects antioxidant properties of baby leaf lettuce. Food Chem. 2012, 134, 1494–1499. [Google Scholar] [CrossRef]
  48. Kolton, A.; Dlugosz-Grochowska, O.; Wojciechowska, R.; Czaja, M. Biosynthesis Regulation of Folates and Phenols in Plants. Sci. Hortic. 2022, 291, 110561. [Google Scholar] [CrossRef]
  49. Kim, E.-Y.; Park, S.-A.; Park, B.-J.; Lee, Y.; Oh, M.-M. Growth and Antioxidant Phenolic Compounds in Cherry Tomato Seedlings Grown under Monochromatic Light-emitting Diodes. Hortic. Environ. Biotechnol. 2014, 55, 506–513. [Google Scholar] [CrossRef]
  50. Maathuis, F.J.; Diatloff, E. Roles and functions of plant mineral nutrients. Methods Mol. Biol. 2013, 953, 1–21. [Google Scholar]
  51. Gao, S.; Kong, Y.; Lv, Y.; Cao, B.; Chen, Z.; Xu, K. Effect of different LED light quality combination on the content of vitamin C, soluble sugar, organic acids, amino acids, antioxidant capacity and mineral elements in green onion. Food Res. Int. 2022, 156, 111329. [Google Scholar] [CrossRef]
  52. Huyskens-Keil, S.; Eichholz-Duendar, I.; Hassenberg, K.; Herppich, W.B. Impact of light quality (white, red, blue light and UV-C irradiation) on changes in anthocyanin content and dynamics of PAL and POD activities in apical and basal spear sections of white asparagus after harvest. Postharvest Biol. Technol. 2020, 161, 111069. [Google Scholar] [CrossRef]
  53. Sng, B.J.R.; Mun, B.; Mohanty, B.; Kim, M.; Phua, Z.W.; Yang, H.; Lee, D.Y.; Jang, I.C. Combination of red and blue light induces anthocyanin and other secondary metabolite biosynthesis pathways in an age-dependent manner in Batavia lettuce. Plant Sci. 2021, 310, 110977. [Google Scholar] [CrossRef] [PubMed]
  54. Yan, J.; He, L.; Xu, S.; Wan, Y.; Wang, H.; Wang, Y.; Yu, L.; Zhu, W. Expression Analysis, Functional Marker Development and Verification of AgFNSI in Celery. Sci. Rep. 2020, 10, 531. [Google Scholar] [CrossRef] [PubMed]
  55. Liu, Y.; Fang, S.; Yang, W.; Shang, X.; Fu, X. Light quality affects flavonoid production and related gene expression in Cyclocarya paliurus. J. Photochem. Photobiol. B-Biol. 2018, 179, 66–73. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 11 00774 g001
Figure 1. Relative spectra of different LED light quality treatments. Red for red light, blue for blue light.
Figure 1. Relative spectra of different LED light quality treatments. Red for red light, blue for blue light.
Horticulturae 11 00774 g001
Horticulturae 11 00774 g002
Figure 2. Effect of different light quality treatments on celery growth. W (white light), R (red light), B (blue light), 3R1B (red light/blue light = 3:1), 4R1B (red light/blue light = 4:1), and 5R1B (red light/blue light = 5:1). Values labeled with different letters in the graph are significantly different (p < 0.05).
Figure 2. Effect of different light quality treatments on celery growth. W (white light), R (red light), B (blue light), 3R1B (red light/blue light = 3:1), 4R1B (red light/blue light = 4:1), and 5R1B (red light/blue light = 5:1). Values labeled with different letters in the graph are significantly different (p < 0.05).
Horticulturae 11 00774 g002
Horticulturae 11 00774 g003
Figure 3. Effect of different light quality treatments on celery growth.
Figure 3. Effect of different light quality treatments on celery growth.
Horticulturae 11 00774 g003
Horticulturae 11 00774 g004
Figure 4. Effects of different light quality treatments on photosynthetic pigment content and photosynthetic gas exchange parameters of celery. (A) Chlorophyll a, (B) chlorophyll b, (C) carotenoids, (D) total chlorophyll, (E) net photosynthetic rate (Pn), (F) intercellular CO2 concentration (Ci), (G) stomatal conductance (Gs), (H) transpiration rate (Tr). Values labeled with different letters in the graph are significantly different (p < 0.05).
Figure 4. Effects of different light quality treatments on photosynthetic pigment content and photosynthetic gas exchange parameters of celery. (A) Chlorophyll a, (B) chlorophyll b, (C) carotenoids, (D) total chlorophyll, (E) net photosynthetic rate (Pn), (F) intercellular CO2 concentration (Ci), (G) stomatal conductance (Gs), (H) transpiration rate (Tr). Values labeled with different letters in the graph are significantly different (p < 0.05).
Horticulturae 11 00774 g004
Horticulturae 11 00774 g005
Figure 5. Effects of different light quality treatments on quality of celery. (A) Nitrate, (B) soluble sugar, (C) soluble protein, (D) vitamin C, (E) cellulose, (F) total phenolics. Values labeled with different letters in the graph are significantly different (p < 0.05).
Figure 5. Effects of different light quality treatments on quality of celery. (A) Nitrate, (B) soluble sugar, (C) soluble protein, (D) vitamin C, (E) cellulose, (F) total phenolics. Values labeled with different letters in the graph are significantly different (p < 0.05).
Horticulturae 11 00774 g005
Horticulturae 11 00774 g006
Figure 6. The effects of different light quality treatments on (A) anthocyanin, (B) total flavonoids, and (C) apigenin. Values labeled with different letters in the graph are significantly different (p < 0.05).
Figure 6. The effects of different light quality treatments on (A) anthocyanin, (B) total flavonoids, and (C) apigenin. Values labeled with different letters in the graph are significantly different (p < 0.05).
Horticulturae 11 00774 g006
Horticulturae 11 00774 g007
Figure 7. The contents of Ca (A), Mg (B), Zn (C), and Fe (D) in celery leaves and petioles under different light quality treatments. Values labeled with different letters in the graph are significantly different (p < 0.05).
Figure 7. The contents of Ca (A), Mg (B), Zn (C), and Fe (D) in celery leaves and petioles under different light quality treatments. Values labeled with different letters in the graph are significantly different (p < 0.05).
Horticulturae 11 00774 g007
Horticulturae 11 00774 g008
Figure 8. Changes in enzyme activity related to flavonoid synthesis of celery under different light quality treatments. (A) Phenylalanine deaminase PAL, (B) chalcone synthase CHS, (C) chalcone synthase CHS, (D) flavonoid synthase FNS, (E) anthocyanin synthase ANS. Values labeled with different letters in the graph are significantly different (p < 0.05).
Figure 8. Changes in enzyme activity related to flavonoid synthesis of celery under different light quality treatments. (A) Phenylalanine deaminase PAL, (B) chalcone synthase CHS, (C) chalcone synthase CHS, (D) flavonoid synthase FNS, (E) anthocyanin synthase ANS. Values labeled with different letters in the graph are significantly different (p < 0.05).
Horticulturae 11 00774 g008
Horticulturae 11 00774 g009
Figure 9. Effects of different light quality treatments on genes related to celery flavonoid synthesis. (A) Phenylalanine deaminase PAL, (B) Chalcone isomerase CHI, (C) Chalcone synthase CHS, (D) Flavonoid synthase FNS, (E) Anthocyanin synthase ANS, Values labeled with different letters in the graph are significantly different (p < 0.05).
Figure 9. Effects of different light quality treatments on genes related to celery flavonoid synthesis. (A) Phenylalanine deaminase PAL, (B) Chalcone isomerase CHI, (C) Chalcone synthase CHS, (D) Flavonoid synthase FNS, (E) Anthocyanin synthase ANS, Values labeled with different letters in the graph are significantly different (p < 0.05).
Horticulturae 11 00774 g009
Horticulturae 11 00774 g010
Figure 10. Correlation analysis between celery quality and light quality in the leaves (A) and petioles (B) of celery.
Figure 10. Correlation analysis between celery quality and light quality in the leaves (A) and petioles (B) of celery.
Horticulturae 11 00774 g010
Table 1. List of primer sequences used for qRT-PCR analysis.
Table 1. List of primer sequences used for qRT-PCR analysis.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
AgACTINCTTCCTGCCATATATGATTGGGCCAGCACCTCGATCTTCATG
AgPALTGATGCAGGGGAAGCCTGAATTTATGAGGACCAAGCCACTGAGGAGAT
AgCHSGGGCCTTACCTTCCATCTTCTTAAGGTCGCTCGCATTTTTTCTTCCTT
AgCHICACTTGTCATTCCTTCTTCCTTGCAACTGGTCTGCCGTCTTGCCCTTC
AgFNSAAGGCGGCTTTACTATCTCCACTCCACCTAGCACCATTAACTTCTCAC
AgANSCTCTTTCCTCCTCGTACCTTTGCTCTTCGGTGTTCTTATGTTCCCCTG
Table 2. Comparison of celery biomass under different light quality treatments.
Table 2. Comparison of celery biomass under different light quality treatments.
TreatmentShoot FW (g)Shoot DW (g)Root FW (g)Root DW (g)Stem Thickness (mm)
W26.12 ± 0.582 b2.08 ± 0.073 b7.95 ± 0.367 b0.96 ± 0.205 bc12.49 ± 0.465 ab
R22.64 ± 0.711 c1.82 ± 0.010 bc7.16 ± 1.252 b0.91 ± 0.165 bc10.51 ± 1.462 b
B17.21 ± 0.655 d1.45 ± 0.063 d3.98 ± 0.967 c0.54 ± 0.033 c11.01 ± 0.950 ab
3R1B32.71 ± 1.155 a3.19 ± 0.138 a11.42 ± 0.357 a1.62 ± 0.040 a13.88 ± 0.122 a
4R1B24.36 ± 1.566 bc2.05 ± 0.085 b8.18 ± 0.105 b0.61 ± 0.188 c11.30 ± 0.966 ab
5R1B23.95 ± 0.680 c1.64 ± 0.255 bc9.45 ± 0.429 ab1.15 ± 0.021 b10.42 ± 0.398 b
Note: different letters in the same column indicate significant differences at p < 0.05 level.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tang, L.; Chu, Q.; Liu, K.; Lu, Y.; Cheng, S.; Pan, T.; Zhou, X.; He, Z. The Impact of Light Quality on the Growth and Quality of Celery. Horticulturae 2025, 11, 774. https://doi.org/10.3390/horticulturae11070774

AMA Style

Tang L, Chu Q, Liu K, Lu Y, Cheng S, Pan T, Zhou X, He Z. The Impact of Light Quality on the Growth and Quality of Celery. Horticulturae. 2025; 11(7):774. https://doi.org/10.3390/horticulturae11070774

Chicago/Turabian Style

Tang, Li, Qianwen Chu, Kaiyue Liu, Yingyi Lu, Shaobo Cheng, Tonghua Pan, Xiaoting Zhou, and Zhongqun He. 2025. "The Impact of Light Quality on the Growth and Quality of Celery" Horticulturae 11, no. 7: 774. https://doi.org/10.3390/horticulturae11070774

APA Style

Tang, L., Chu, Q., Liu, K., Lu, Y., Cheng, S., Pan, T., Zhou, X., & He, Z. (2025). The Impact of Light Quality on the Growth and Quality of Celery. Horticulturae, 11(7), 774. https://doi.org/10.3390/horticulturae11070774

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop