First Report of Fusarium annulatum Causing Bulb Rot Disease of Tulip
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation of Fungi
2.2. Amplification and Analysis of Fungal DNA Barcoding Sequences
2.3. Microscopy
2.4. Pathogenicity Test of Fungal Isolates
3. Results
3.1. Colony Morphology of Fungal Isolates Resembling Fusarium
3.2. Identification of Fungal Isolates to Fusarium annulatum by DNA Barcoding Sequence Analyses
3.3. Micromorphology of Fusarium annulatum
3.4. Pathogenicity of Fusarium annulatum
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Nisa, Q.; Gulzar, G.; Dar, M.S.; Shahnaz, E.; Banday, S.; Bhat, Z.A.; El-Sheikh, M.A.; Nabi, S.U.; Arya, V.M.; Anwar, A.; et al. New reports of pathogen spectrum associated with bulb rot and their interactions during the development of rot in tulip. BMC Genom. Data 2024, 25, 40. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, N.T.; Reyad, N.-H.A.; Halawa, A. Management of root and bulb rot affecting some flower bulb production in Egypt. Egypt. J. Biol. Pest Control. 2017, 27, 271–278. [Google Scholar]
- Boyraz, N.; Bastas, K.; Maden, S.; Yasar, A. Bacterial leaf and peduncle soft rot caused by Pectobacterium carotovorum on tulips in Konya, Turkey. Phytoparasitica 2006, 34, 272–280. [Google Scholar] [CrossRef]
- Miller, W.B. Fusarium in tulips: Ethylene, gum, and aborted flowers. Greenh. Prod. News 2002, 12, 36–39. [Google Scholar]
- Michielse, C.B.; Rep, M. Pathogen profile update: Fusarium oxysporum. Mol. Plant. Pathol. 2009, 10, 311–324. [Google Scholar] [CrossRef] [PubMed]
- Lombard, L.; Sandoval-Denis, M.; Lamprecht, S.C.; Crous, P.W. Epitypification of Fusarium oxysporum–clearing the taxonomic chaos. Persoonia 2019, 43, 1–47. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, K.; Sutton, D.A.; Rinaldi, M.G.; Sarver, B.A.; Balajee, S.A.; Schroers, H.J.; Summerbell, R.C.; Robert, V.A.; Crous, P.W.; Zhang, N.; et al. Internet-accessible DNA sequence database for identifying fusaria from human and animal infections. J. Clin. Microbiol. 2010, 48, 3708–3718. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.M.; Crous, P.W.; Sandoval-Denis, M.; Han, S.L.; Liu, F.; Liang, J.M.; Duan, W.J.; Cai, L. Fusarium and allied genera from China: Species diversity and distribution. Persoonia 2022, 48, 1–53. [Google Scholar] [CrossRef] [PubMed]
- Yilmaz, N.; Sandoval-Denis, M.; Lombard, L.; Visagie, C.M.; Wingfield, B.D.; Crous, P.W. Redefining species limits in the Fusarium fujikuroi species complex. Persoonia 2021, 46, 129–162. [Google Scholar] [CrossRef] [PubMed]
- Duan, M.; Yuan, Y.; Zhao, J. The occurrence and control of the basal rot disease of tulip. Plant Prot. 1997, 23, 35–36. (In Chinese) [Google Scholar]
- Seifert, K.A.; Aoki, T.; Baayen, R.P.; Brayford, D.; Burgess, L.W.; Chulze, S.; Gams, W.; Geiser, D.; de Gruyter, J.; Leslie, J.F.; et al. The name Fusarium moniliforme should no longer be used. Mycol. Res. 2003, 107, 643–644. [Google Scholar] [CrossRef]
- Summerell, B.A. Resolving Fusarium: Current status of the genus. Annu. Rev. Phytopathol. 2019, 57, 323–339. [Google Scholar] [CrossRef] [PubMed]
- Chang, J.; Tao, G.; Li, Y. Identification of bulb wilt pathogen in Tulipa. Acta Agric. Boreali Sin. 2010, 19, 120–123, (In Chinese with English abstract). [Google Scholar]
- Crous, P.W.; Lombard, L.; Sandoval-Denis, M.; Seifert, K.A.; Schroers, H.J.; Chaverri, P.; Gené, J.; Guarro, J.; Hirooka, Y.; Bensch, K.; et al. Fusarium: More than a node or a foot-shaped basal cell. Stud. Mycol. 2021, 98, 100116. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to the Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Nat. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
- Reeb, V.; Lutzoni, F.; Roux, C. Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Mol. Phylogenet. Evol. 2004, 32, 1036–1060. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed]
- Trifinopoulos, J.; Nguyen, L.T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 2016, 44, W232–W235. [Google Scholar] [CrossRef] [PubMed]





| Locus | Primer | Sequence (5′-3′) | Reference |
|---|---|---|---|
| ITS | ITS1 | TCCGTAGGTGAACCTGCGG | [15] |
| ITS4 | TCCTCCGCTTATTGATATGC | [15] | |
| tef1 | EF1 | ATGGGTAAGGARGACAAGAC | [16] |
| EF2 | GGARGTACCAGTSATCATG | [16] | |
| rpb1 | RPB1-Fa | CAYAARGARTCYATGATGGGWC | [7] |
| RPB1-G2R | GTCATYTGDGTDGCDGGYTCDCC | [7] | |
| rpb2 | RPB2-5f2 | GGGGWGAYCAGAAGAAGGC | [17] |
| RPB2-11ar | GCRTGGATCTTRTCRTCSACC | [18] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Q.; Miura, S.; Liao, T.; Luo, J.; Shen, Y.; Chen, L.; Li, C.; Li, B.; An, Q. First Report of Fusarium annulatum Causing Bulb Rot Disease of Tulip. Horticulturae 2025, 11, 518. https://doi.org/10.3390/horticulturae11050518
Liu Q, Miura S, Liao T, Luo J, Shen Y, Chen L, Li C, Li B, An Q. First Report of Fusarium annulatum Causing Bulb Rot Disease of Tulip. Horticulturae. 2025; 11(5):518. https://doi.org/10.3390/horticulturae11050518
Chicago/Turabian StyleLiu, Quanhong, Shu Miura, Tianlan Liao, Jinyan Luo, Ying Shen, Lei Chen, Chengkai Li, Bin Li, and Qianli An. 2025. "First Report of Fusarium annulatum Causing Bulb Rot Disease of Tulip" Horticulturae 11, no. 5: 518. https://doi.org/10.3390/horticulturae11050518
APA StyleLiu, Q., Miura, S., Liao, T., Luo, J., Shen, Y., Chen, L., Li, C., Li, B., & An, Q. (2025). First Report of Fusarium annulatum Causing Bulb Rot Disease of Tulip. Horticulturae, 11(5), 518. https://doi.org/10.3390/horticulturae11050518

