Next Article in Journal
Metabolic Response Induced by Methyl Jasmonate and Benzothiadiazole in Vitis vinifera cv. Monastrell Seedlings
Previous Article in Journal
Genome-Wide Identification of Watermelon Trihelix Genes and Their Expression Patterns Under Biotic and Abiotic Stresses
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 11
Issue 3
10.3390/horticulturae11030276
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Managing the Microbiome on the Surface of Tomato Fruit by Treatment of Tomato Plants with Non-Thermal Atmospheric-Pressure Plasma During Cultivation

by
Hideki Takahashi
1,*,
Keisuke Takashima
2,
Shuhei Miyashita
1,
Shota Sasaki
2,
Abebe Alemu Derib
1,
Kazuhisa Kato
1,
Yoshinori Kanayama
1 and
Toshiro Kaneko
2,*
1
Graduate School of Agricultural Science, Tohoku University, Sendai 980-0845, Japan
2
Graduate School of Engineering, Tohoku University, Sendai 980-8579, Japan
*
Authors to whom correspondence should be addressed.
Horticulturae 2025, 11(3), 276; https://doi.org/10.3390/horticulturae11030276
Submission received: 15 January 2025 / Revised: 21 February 2025 / Accepted: 28 February 2025 / Published: 4 March 2025
(This article belongs to the Section Postharvest Biology, Quality, Safety, and Technology)
Browse Figures
Review Reports Versions Notes

Abstract

:
The treatment of plants with non-thermal atmospheric-pressure plasma impacts several aspects of plant life. However, the effects of long-term plasma irradiation on crop cultivation are not enough investigated. The purpose of the current study is to address this subject. The growth of tomato plants, the preservation status of harvested tomato fruits, and the microbial community on the surface of harvested tomato fruits were compared between 12 long-term plasma-irradiated plants and 12 air-irradiated plants with statistical analyses. The growth parameters (plant height, number of leaves and fruit bunches, SPAD value, and plant dry weight) of the plants that were periodically irradiated with plasma from the three-leaf stage to the green-enlarged-fruit stage, were the same as those of the air-irradiated controls. However, the preservation status of the tomato fruits harvested from the plasma-irradiated plants was improved in comparison with that of the fruits from the air-irradiated controls. Analysis of the microbiome on the surface of the fruit indicated that long-term plasma irradiation during cultivation promoted an increased bacterial diversity on the fruit surface. Thus, the effect of plasma irradiation on the diversification of microbial population dynamics on tomato fruit may be associated with an improved preservation status of harvested tomato fruits.

1. Introduction

Plasma, which is known as an ionized gas containing ions, electrons, and neutral particles, is one of the four fundamental states of matter, alongside solids, liquids, and gases, and is a fascinating substance with a wide range of applications. In agriculture, plasma can be generated using various methods, such as electrical discharges or lasers, and has the potential to induce beneficial effects on crop cultivation and the preservation status of agricultural products including seeds and fruit [1,2,3,4,5,6].
Indeed, in several plant species, the germination rate of plasma-treated seeds is reported to be accelerated compared with that of non-treated seeds [3,7,8,9,10]. The treatment of seeds with plasma led to the early growth of seedlings in Andrographis paniculate, Avena sativa, Glycine max, Solanum lycopersicon, Spinacia oleracea, Raphanus sativus, Hordeum vulgare, Trigonella foenum-graecum, Triticum aestivum, and Lens culinaris [2,7,8,10]. Plasma seems to be able to alter the seed coat, improving water and nutrient uptake, while also stimulating biochemical processes within the seed [2,7,8,10]. Moreover, changes in gene expression, phytohormonal balance, and other metabolite content in seedlings germinated from plasma-treated seeds have been reported, and possible mechanisms have also been proposed [3,7,8,11,12].
The treatment of young plants with plasma gas or plasma-treated water in the early vegetative stage has also been reported to promote the growth of leaves, stems, and/or roots in Arabidopsis thaliana, Cannabis sativa, Capsicum annum, Medicago sativa, Raphanus sativus, Solanum lycopersicon, Tagetes erecta, Triticum aestivum, and Zinnia peruviana [2,13,14,15]. Plasma can induce the production of reactive oxygen species (ROS) and other signaling molecules that trigger various physiological responses in plants, such as enhanced photosynthesis, nutrient uptake, and stress tolerance [2,13,14,15]. Although short-term plasma treatments generally have a positive effect on the early growth of young plants in a growth chamber, the effects of long-term plasma treatments on plant growth have not been sufficiently investigated. When we consider the efficacy of plasma treatment on agricultural production, it seems to be important to provide evidence of the positive effects of long-term plasma treatments on plant growth from the early vegetative stage to the mature reproductive growth period.
Plasma treatment is also useful for postharvest disinfection and the preservation of agricultural products, which improves product quality [1,4,5,16,17,18]. Seed-borne diseases can be controlled by irradiating plant seeds with plasma, which thereby demonstrates the anti-microbial activity of plasma [3,16,19]. In addition, under appropriate conditions, the irradiation of agricultural products with plasma immediately after harvesting can reduce microbial contamination on the surface of tomatoes, melons, cherries, apples, strawberries, blueberries, and various citrus fruits, thereby helping to maintain the freshness of the harvested products [1,4,5,20,21,22,23,24,25,26,27].
However, when we look closely at previous findings regarding the effects of plasma on the life of plants, which were obtained from studies on plasma-treated young plants or harvested fruits, we find a wide range of responses to plasma among plants. Such variation seems to be caused by the difference and/or instability of reactive oxygen and nitrogen species created by different types of plasma apparatuses, the conditions of the plasma treatment, or multiple parameters that influence the effect of plasma. Therefore, although plasma agriculture holds great promise for sustainable and efficient farming practices, further research is needed to fully understand the effect of plasma on crop cultivation under conditions closer to those found in practical cultivation sites and optimize the application of plasma technology in different agricultural settings.
In the current study, since the effect of long-term plasma irradiation on plant cultivation has not been studied, we investigated the effects of plasma irradiation from the three-leaf stage to the green-enlarged-fruit stage on tomato cultivation by comparing various parameters between tomato plants periodically irradiated with plasma and control tomato plants irradiated with air. Plant length, number of leaves and fruit bunches, SPAD (soil and plant analysis development) value, and plant dry weight were used as the parameters for evaluating the effect of plasma on tomato plant cultivation. In addition, the influence of the long-term periodic plasma treatment of cultivated tomato plants on the preservation status of harvested tomato fruits and the microbiome diversity on the surface of harvested tomato fruits were also analyzed with the aim of clarifying the efficacy of long-term plasma irradiation on tomato production.

2. Materials and Methods

2.1. Plant Cultivation and Experimental Protocol

Research was carried out on tomato (Solanum lycopersicum L. cultivar Home-Momotaro). The seeds of tomato were germinated on distilled water-wetted filter paper in a Petri dish at 25 °C in the dark. The seedlings were transferred to a soilless mix (Metro-Mix® 380; Sun Gro Horticulture, Agawam, MA, USA) and cultivated at 25 °C under 14 h light conditions (171.43 μE/m2/s) in a growth chamber (KG-201 HL-D; Koito, Yokohama, Japan). At the three-leaf stage, the tomato plants were transferred to culture soil (Pot-Baido; Forex Mori Sangyo Co., Ltd., Hokkaido, Japan) in 13 L plastic pots, and cultivation was continued at 25 °C in a natural light-type phytotron system (NK-PT5.7P1; N.K. System Co. Ltd., Osaka, Japan) with six supplementary light devices (200 V, 360 W each) (Figure A1A; Figure 1). At the fourth fruit-bunch stage, the shoot apex and side branches were removed and further cultivated in the same phytotron, until fully enlarged green premature fruits developed (Figure A1B; Figure 1). The experimental protocol was based on the comparison between 12 plants cultivated for plasma treatment and 12 plants cultivated for air treatment as a control.

2.2. Plasma Treatment

The tomato plants were directly treated with a plasma effluent gas dissolved solution (PEGDS) at a distance of 10 cm for 1 min every Monday, Wednesday, and Friday. The plasma treatment started at the three-leaf stage and continued until the stage at which green mature fruits had developed. A battery-powered plasma treatment device was constructed to spray PEGDS as previously described [28], thereby enabling the long-term field investigation of the plant treatment (Figure 2). Plasma effluent gas was fed through a PFA tube to a spray nozzle to force the dissolving plasma effluent gas into liquid water and was separately fed by a water pump, under flow rate regulation (Figure 2). The nozzle was made of PTFE and PFA to minimize any ozone loss process in PEGDS. An AC high-voltage power supply for DBD plasma, the water pump, and an air compressor were powered via 24 V bus power lines fed from a rechargeable lithium-ion battery (Nittoku Co., Ltd., Saitama, Japan). For each treatment, the air and distilled water flow rates to generate and spray PEGDS were adjusted using flow meters at approximately 3 L/min and 20 mL/min, respectively. Typical reactive species compositions in the air plasma effluent gas were analyzed with Fourier transform infrared (FTIR) absorption spectroscopy, as previously described [29]. Liquid-phase ozone (O3aq) in the sprayed PEGDS was analyzed with a NaBr solution (5 M NaBr and 1 M HClO), according to a previously described method [30].

2.3. Analysis of Plant Growth

The growth parameters were plant height, number of leaves and fruit bunches, SPAD value, and dry weight of the plants. To obtain the SPAD value, which indicates the amount of chlorophyll in the leaves, 12 randomly selected leaves of each plant were measured using a SPAD device (SPAD-502Plus; Konica-Minolta, Tokyo, Japan). After harvesting enlarged green premature tomato fruits, the dry weight of the aboveground part of the 12 plasma-treated plants and the 12 air-treated control plants were weighed.
To evaluate the preservation status of the green premature fruits harvested from the 12 plasma-treated plants and 12 air-treated control plants, the harvested fruits were stored at 25 °C in a plastic storage container (Tupperware, Orlando, FL, USA) lined with wetted paper towels. Photographs were taken to record the status of the preservation of the tomato fruits immediately after harvesting and 2 weeks after harvesting.

2.4. Statistical Analysis

In each experiment measuring the growth parameters (plant length, number of leaves and fruit bunches, SPAD (soil and plant analysis development) value, and plant dry weight), the average ± standard deviation (SD) of the values obtained for the 12 independent plasma-irradiated samples and the 12 independent air-irradiated control samples was calculated. For the statistical analysis, the comparison between the two groups, the plasma-irradiated sample and the air-irradiated control sample, was subjected to Welch’s t-test, since heteroscedasticity of the variance of the two data sets was revealed by the F-test.

2.5. Analysis of the Microbial Community on the Surface of Tomato Fruits

Premature green tomato fruits were soaked into 10 mL of sterilized distilled water containing 0.005% surfactant (Silwet™ L-77; Momentive Performance Materials, Niskayuna, NY, USA) in sealing bags to avoid air contamination (Figure A2). To purify the microbial DNA from the water samples, the shaking water was filtrated through a nitrocellulose membrane filter with 0.25 μm pore size (Advantec Co., Ltd., Tokyo, Japan) to collect the microorganisms inhabiting the surface of the tomato fruits. Total microbial DNA in the water samples was isolated using a WaterMaster™ DNA Purification Kit (Epicentre Biotechnologies, Madison, WI, USA). The gene-specific primers (Table A1) 515F and 806R, corresponding to the V4 region of the 16S rRNA gene [31], and ITS1-F_KYO1 and ITS2_KYO2, corresponding to the ITS1 region of the 18S rRNA gene [32], were used for PCR amplification of 16S and 18S rDNA fragments obtained from the DNA templates isolated from the solution samples collected from the surface of the fruits harvested from six plasma- and six air-treated tomato plants. The first PCR was performed in 50 μL reaction mixtures containing 10 ng of DNA, 1× Taq HS Low DNA buffer containing dNTPs, each at 0.2 mM concentration, and 1 mM MgSO4, primers, each at 0.2 μM concentration, and 1 U of Taq HS Low DNA (Takara Bio, Shiga, Japan). PCR amplification was performed using a thermocycling program consisting of 95 °C for 2 min followed by 12 cycles of 95 °C for 40 s, 63 °C for 40 s, and 72 °C for 1 min. The PCR products were purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instructions. The amounts of the first PCR-amplified DNA were quantitatively measured using a fluorescent quantitation system (QuantiFluor® dsDNA System; Promega, Madison, WI, USA) with a multimode microplate reader (Synergy H1; Agilent, Santa Clara, CA, USA). Statistical differences in the amounts of the amplified DNA between the fruits harvested from plasma- and air-treated tomato plants were assessed using the Mann–Whitney U test (p < 0.05).
After quantitatively measuring the amount of the first PCR product, the second PCR was performed in 50 μL reaction mixtures containing 10 ng of the first PCR DNA, 1× Ex buffer containing dNTPs, each at 0.2 mM concentration, and 1 mM MgSO4, the 2ndF and 2ndR primers at 0.5 μM concentration (Table A1), and 1 U of Ex Taq HS (Takara Bio, Shiga, Japan) for amplicon library construction. PCR amplification was performed using a thermocycling program consisting of 94 °C for 2 min followed by 12 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. The second PCR product was added to 0.7 volumes of AMPure XP (Beckman Coulter, Brea, CA, USA) and purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel), according to the manufacturer’s instructions. The amplicon library was qualified and analyzed using the Fragment Analyzer system with a dsDNA 915 Reagent Kit (Agilent).
For each amplicon, 2 × 300 bp paired-end sequencing was performed using the MiSeq Reagent Kit v3 (Illumina, San Diego, CA, USA), according to the manufacturer’s instructions, and a total of 32 M reads were obtained. Quality filtering, assembling, clustering of sequence data, and removal of chimeras were performed using the FASTX-Toolkit (version 0.0.14) and the dada2 plug-in tool of Qiime2.0 (version 2020.8) [33]. A homology search for the roughly 250 bp V4 region of the 16S rRNA sequences aimed at phylogenetic classification was performed, and the results were analyzed against the EzBioCloud 16S database, using the q2-feature-classifier via the Qiime2 pipeline. A homology search for the roughly 280 bp ITS1 region of the 18S rRNA sequences aimed at phylogenetic classification was performed, and the results were analyzed against the UNITE (version 8.3) database.
The Shannon α-diversity index was calculated by the diversity plug-in tool of Qiime2. Statistical differences were assessed by the Kruskal–Wallis test, using the Qiime2 package. The Weighted_Unifrac β-diversity index was also evaluated using the diversity plug-in tool of Qiime2. To determine the statistical significance of β-diversity, PERMANOVA was performed using the Qiime2 package. Principal component analysis (PCA) with Weighted_UniFrac distance analysis of the microbiomes of the plasma-treated and air-treated tomato fruits was performed by the diversity plug-in tool of Qiime2.

3. Results

3.1. Analysis of Air Plasma Effluent Gas and Liquid-Phase O3

The reactive species density was determined by comparing the FTIR absorption spectrum (black) obtained during the PEGDS device test with a best-fit synthetic spectrum (red) composed of the spectra of individual reactive species (Figure A3). The individual reactive species are shown as having negative absorbance for visibility. The resultant density list and the limits of detection obtained during the PEGDS device test indicated that the densities of ozone (O3gas) and dinitrogen monoxide (N2O) were significant, being around 1.9 × 1016 and 1.6 × 1014 [cm−3], respectively (Table A2). When the liquid-phase ozone (O3aq) in PEGDS was analyzed by mixing it with a NaBr solution after a specified retention time (trete), the UV absorption spectra of the admixed solution and the Br3−aq peak at 266 nm suggested that O3aq concentration measured 10 cm downstream from the PEGDS spray nozzle was around 0.4 μM (Figure A4).

3.2. Influence of the Plasma Treatment on the Vegetative Growth of Tomato Plants

There were no significant differences in plant height, number of leaves, and SPAD value between plasma- and air-irradiated tomato plants during the 4-week period after the development of the first fruit bunches (Figure 3A,B and Figure 4). Moreover, no significant difference in the dry weight of the aboveground parts of the plants was observed between the plasma- and the air-irradiated tomato plants (Figure 3D). In the other two sets of independent experiments, no significant differences in plant height, leaf number, SPAD value, or dry weight of the aboveground parts of the plants were reproducibly observed between the plasma- and the air-treated tomato plants (Figure A5A–D, Figure A6A–D and Figure A7).

3.3. Influence of the Plasma Treatment on the Reproductive Growth of Tomato Plants

The number of fruit bunches in the plasma-irradiated plants did not significantly differ from that in the air-irradiated control plants at any time point during the 4-week period after the development of the first fruit bunches (Figure 3C). In addition, there was no significant difference in the timing of bunch development between the plasma- and the air-irradiated control plants (Figure 3C). The same results were reproducibly obtained in two other sets of independent experiments (Figure A5C and Figure A6C).
These results indicated that the long-term plasma treatment of tomato plants from the three-leaf stage to the green-enlarged-fruit stage did not influence the vegetative or reproductive growth of the tomato plants.

3.4. Influence of the Plasma Treatment on the Preservation Status of Tomato Fruits and on the Microbiome on the Surface of Tomato Fruits

After the analysis of plant growth in tomato plants irradiated with plasma or with air as a control, enlarged premature green tomato fruits were harvested from each plant and stored at 25 °C until the fruit color changed to red (Figure 5). The status of fruit ripening during storage was photographed at harvest (premature green fruits, Figure 5) and 2 weeks after harvest (Figure 5). Of note, fruit rot with fungal colonies was clearly observed on the surface of red fruits from air-irradiated tomato plants 2 weeks after harvest time but not on the surface of red fruits from plasma-treated tomato plants (Figure 5). The status of tomato fruit preservation after plasma and air treatment was reproducibly observed in another set of experiments (Figure A8).
To ascertain whether long-term periodic plasma irradiation before fruit harvest influences the microbial population on the surface of fruit, bacterial and fungal communities in water samples, obtained by shaking green premature tomato fruits harvested from long-term periodically plasma- or air-irradiated plants (Figure A2), were analyzed by amplicon sequencing of the V4 region of 16S rDNA and the ITS1 region of 18S rDNA. Quantitative measurements of the amount of PCR-amplified 16S rDNA and 18S rDNA indicated that there were no significant differences between the solution samples from green premature tomato fruits (Figure 6). Thus, long-term periodic plasma irradiation of tomato plants did not seem to quantitatively reduce the microbial population on the fruit surface.
Shannon α-diversity analysis indicated that bacterial richness in sample solutions containing microorganisms removed from the surface of fruits harvested from plasma- irradiated tomato plants was significantly higher compared with that in the samples from fruits from air-irradiated tomato plants (p < 0.05) (Figure 7A), whereas fungal richness was similar in the sample solutions from fruits from plasma- and air-irradiated tomato plants (Figure 7B). Furthermore, the Weighted_Unifrac β-diversity metrics with PCA, which were used to visualize bacterial and fungal β-diversity between the sample solutions from fruits harvested from plasma- and air-irradiated tomato plants (Figure 8A,D), indicated distinct clustering between the two types of sample solutions in the bacterial community (p < 0.05) (Figure 8B,C) but not in the fungal community (Figure 8E,F). The relative abundance of bacteria and fungi at the phylum level is shown in Figure A9 and Figure A10. These results suggest that bacterial diversity, but not fungal diversity, on the surface of premature enlarged green tomato fruits might be increased by long-term plasma irradiation during cultivation from the three-leaf stage to the premature-green-fruit stage.

4. Discussion

It has been reported that irradiation of tomato seeds or seedlings with different types of plasma gas or plasma-activated water produced by different types of plasma apparatuses enhances tomato plant growth at the seedling stage [8,11,14,15,34,35]. However, to evaluate the practical application of plasma in agricultural sites, it is necessary to investigate the effect of plasma treatment on crop cultivation from different perspectives, including analyses of periodic plasma treatment and different growth stages. Our experiments were designed with these perspectives in mind. The long-term periodic irradiation of tomato plants with non-thermal atmospheric-pressure plasma from the three-leaf stage to the green-enlarged-fruit stage (Figure 1) did not show a positive effect on the vegetative growth of tomato plants (Figure 3A–D, Figure 4, Figure A5A–D, Figure A6A–D and Figure A7). Regarding the reproductive stage of tomato plants, until now, the efficacy of plasma treatment on the formation of fruit bunches has not been sufficiently investigated. In our experiments, the long-term treatment of tomato plants with plasma did not affect the number of fruit bunches (Figure 3C, Figure A5C and Figure A6C). Thus, positive effects of plasma irradiation on vegetative or reproductive growth did not seem to be induced at any plant growth stage during the long-term periodic irradiation of tomato plants with plasma.
Regarding food safety, the plasma-mediated sanitation of post-harvested fresh fruits, fresh-cut fruits, processed foods, and food packaging surfaces has been reported [2]. Indeed, the direct efficacy of plasma treatment in the reduction of microbial contamination in onion flakes, fresh-cut apples, fresh-cut melon, and fresh-cut cantaloupe has been demonstrated [22,25,36,37,38]. Similar findings have been reported for tomatoes, blueberries, red currants, strawberries, and mulberries immediately after harvesting [1,21,23,24,25,26,39,40,41]. However, the analysis of the effects of atmospheric cold plasma treatment on the microbial community on the surface of harvested seeds and fruits during storage is limited to wheat and blueberries [42,43,44]. Moreover, changes in the microbiome on the surface of fruits that were not directly irradiated with plasma but were harvested from plasma-irradiated plants have yet to be investigated. The monitoring of the microbial communities on the surface of tomato fruits in our study suggested that the total amounts of bacteria and fungi did not change on fruits from tomato plants periodically irradiated with plasma before harvesting (Figure 6). However, the bacterial community on the surface of the fruits was more diverse compared with that on fruits from air-treated control plants when the tomato plants were periodically irradiated with plasma before harvesting (Figure 7 and Figure 8). At same time, the status of preservation of the tomato fruits was improved after the plasma treatment of the tomato plants (Figure 5). Robust microbial population dynamics, established by long-term plasma irradiation, may exert a positive impact on the preservation status of tomato fruits by suppressing the propagation of rot-causing microorganisms on the surface of tomato fruits, rather than by eliminating rot-causing microorganisms directly or through plasma-generated reactive oxygen/nitrogen species.
The mechanism by which plasma determines a diverse bacterial community on the surface of fruit has yet to be elucidated, but one possible explanation is that long-term exposure of tomato fruit bunches and/or premature green fruits to plasma or reactive oxygen/nitrogen species generated by plasma irradiation may help to establish a robust microbial population structure on the surface of fruit [45]. Another possibility is that the long-term exposure of tomato plants to plasma or reactive oxygen/nitrogen species may change the physiological status of the plants, which enables a diverse microbial population structure to be maintained on the surface of fruit [46]. Moreover, to further interpret the improved preservation status of fruits by plasma treatment, the regulation of respiration, the softening process, and other physiological activities except for the alteration of the microbial community should be analyzed.
Although there are several reports about the beneficial effects of plasma treatment on acceleration of seed germination, promotion of seedling growth, microbial decontamination, and sanitation of harvested fruits accompanied with a reduction in the microbial population, to our knowledge, the present study is the first that analyzed the microbial population dynamics on the surface of fruit harvested from tomato plants irradiated with plasma. The increased diversity in the bacterial community on the surface of tomato fruits harvested from periodically plasma-treated tomato plants, along with the improved preservation status of the harvested tomato fruits, suggests that utilizing plasma is effective for managing the microbiome on cultivated crops and harvested products.

5. Conclusions

The long-term periodic plasma irradiation of tomato plants did not have a beneficial effect on either plant growth at the vegetative stage or the number of fruit bunches at the reproductive stage, but it did improve the preservation status of the harvested tomato fruits. An increase in the diversity of the bacterial community was observed on the surface of green enlarged tomato fruits harvested from plasma-irradiated tomato plants. Thus, utilizing plasma to manage the population dynamics of the microbiome on the surface of tomato fruits might be associated with an improved preservation status of the tomato fruits. The obtained knowledge provides new insights to understand the effect of plasma on crop cultivation in agricultural sites.

Author Contributions

Conceptualization, H.T. and T.K.; methodology, H.T., K.T. and S.M; validation, H.T. and T.K.; formal analysis, S.M.; investigation, H.T. and K.T.; resources, A.A.D. and K.K.; data curation, H.T. and K.T. writing—original draft preparation, H.T. and K.T.; writing—review and editing, S.S., A.A.D., K.K., Y.K. and T.K.; supervision, H.T. and T.K.; project administration, H.T. and T.K.; funding acquisition, H.T., Y.K. and T.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the commissioned research fund provided by F-REI (JPFR23020108); by the Tohoku University Research Program “Frontier Research in Duo” (FRiD) (https://w3.tohoku.ac.jp/frid-en/project/project04/); by the Japan Society for the Promotion of Science KAKENHI (grant numbers 19H02953, 22KK0081, 21H04721, 19K22300, and 23K18017); and by the Project of Integrated Compost Science (PICS).

Data Availability Statement

The original contributions presented in this study are included in the article material. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Table A1. Primer sequences for constructing the DNA library for amplicon sequencing.
Table A1. Primer sequences for constructing the DNA library for amplicon sequencing.
Primer Name (1)Nucleotide Sequence (2)
515FACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGCCAGCMGCCGCGGTAA
806RGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGACTACHVGGGTWTCTAAT
ITS1F_KYO1ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTHGGTCATTTAGAGGAASTAA
ITS2_KYO2GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTYRCTRCGTTCTTCATC
2ndFAATGATACGGCGACCACCGAGATCTACAC-Index2-ACACTCTTTCCCTACACGACGC
2ndRCAAGCAGAAGACGGCATACGAGAT-Index1-GTGACTGGAGTTCAGACGTGTG
(1) The primers 515F and 806R were used for the first PCR of the V4 region of 16S rDNA. The primers ITS1-F_KYO1 and 806R were used for the first PCR of the ITS1 region of 18S rDNA. The primers 2ndF and 2ndR were used for the second PCR. (2) The adapter sequences in 515F, 806R, ITS1F_KYO1, and ITS2_KYO2, which are homologous to the 2ndF and 2ndR primers, are underlined. Sequences in bold are homologous to the V4 region of 16S rDNA and the ITS1 region of 18S rDNA.
Horticulturae 11 00276 g0a1
Figure A1. Phytotron used for cultivation of tomato plants irradiated with non-thermal atmospheric-pressure plasma or air as a control. (A) Natural light-type phytotron with supplementary light devices. (B) Humidified air plasma device (left) and cultivated tomato plants (right).
Figure A1. Phytotron used for cultivation of tomato plants irradiated with non-thermal atmospheric-pressure plasma or air as a control. (A) Natural light-type phytotron with supplementary light devices. (B) Humidified air plasma device (left) and cultivated tomato plants (right).
Horticulturae 11 00276 g0a1
Horticulturae 11 00276 g0a2
Figure A2. Photograph of harvested premature green tomato fruits soaked in 10 mL of sterilized distilled water in sealing bags. The bags were shaken at 120 rpm at 25 °C for 30 min.
Figure A2. Photograph of harvested premature green tomato fruits soaked in 10 mL of sterilized distilled water in sealing bags. The bags were shaken at 120 rpm at 25 °C for 30 min.
Horticulturae 11 00276 g0a2

Appendix B

Horticulturae 11 00276 g0a3
Figure A3. FTIR absorption spectrum of air plasma effluent gas obtained during the PEGDS device test.
Figure A3. FTIR absorption spectrum of air plasma effluent gas obtained during the PEGDS device test.
Horticulturae 11 00276 g0a3
Table A2. Densities of air plasma effluent gas analyzed with FT-IR absorption spectroscopy and limits of detection (LOD) obtained during the PEGDS device test.
Table A2. Densities of air plasma effluent gas analyzed with FT-IR absorption spectroscopy and limits of detection (LOD) obtained during the PEGDS device test.
SpeciesDensities [cm−3]LOD [cm−3]
O31.9 × 10161 × 1014
NO<LOD4 × 1014
NO2<LOD4 × 1013
N2O1.6 × 10144 × 1013
N2O5<LOD2 × 1013
HNO3<LOD4 × 1013
H2O2<LOD2 × 1014
Horticulturae 11 00276 g0a4
Figure A4. Measured Br3−aq absorption spectra for samples sprayed and collected at various distances from the spray nozzle exit. A NaBr solution was mixed with the sprayed and collected PEGDS after the specified retention times (trete).
Figure A4. Measured Br3−aq absorption spectra for samples sprayed and collected at various distances from the spray nozzle exit. A NaBr solution was mixed with the sprayed and collected PEGDS after the specified retention times (trete).
Horticulturae 11 00276 g0a4
Horticulturae 11 00276 g0a5
Figure A5. Efficacy of long-term plasma irradiation i influencing tomato plant growth in Exp. 2. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. On 5, 12, 19 and 26 August 2022, the plant height (A), number of leaves (B), number of fruit bunches (C), and plant dry weight (D) were measured. The average of plant height, number of leaves, number of fruit bunches, and plant dry weight are shown in a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Figure A5. Efficacy of long-term plasma irradiation i influencing tomato plant growth in Exp. 2. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. On 5, 12, 19 and 26 August 2022, the plant height (A), number of leaves (B), number of fruit bunches (C), and plant dry weight (D) were measured. The average of plant height, number of leaves, number of fruit bunches, and plant dry weight are shown in a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Horticulturae 11 00276 g0a5
Horticulturae 11 00276 g0a6
Figure A6. Efficacy of long-term plasma irradiation in influencing tomato plant growth in Exp. 3. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. On 30 November 2022 and on 6, 13 and 20 January 2023, the plant height (A), number of leaves (B), number of fruit bunches (C), and plant dry weight (D) were analyzed. The average of plant height, number of leaves, number of fruit bunches, and plant dry weight are shown in a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Figure A6. Efficacy of long-term plasma irradiation in influencing tomato plant growth in Exp. 3. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. On 30 November 2022 and on 6, 13 and 20 January 2023, the plant height (A), number of leaves (B), number of fruit bunches (C), and plant dry weight (D) were analyzed. The average of plant height, number of leaves, number of fruit bunches, and plant dry weight are shown in a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Horticulturae 11 00276 g0a6
Horticulturae 11 00276 g0a7
Figure A7. Efficacy of long-term plasma irradiation in influencing the chlorophyll content of tomato plant leaves. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage on every Monday, Wednesday, and Friday. On 5, 12, 19, and 26 August 2022, the SPAD value, which indicates the amount of chlorophyll in the leaves, was measured (upper row of the bar charts) as well as on 30 November 2022 and on 6, 13, and 20 January 2023 (lower row of the bar charts). The average SPAD values are shown in the bar charts with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Figure A7. Efficacy of long-term plasma irradiation in influencing the chlorophyll content of tomato plant leaves. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage on every Monday, Wednesday, and Friday. On 5, 12, 19, and 26 August 2022, the SPAD value, which indicates the amount of chlorophyll in the leaves, was measured (upper row of the bar charts) as well as on 30 November 2022 and on 6, 13, and 20 January 2023 (lower row of the bar charts). The average SPAD values are shown in the bar charts with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Horticulturae 11 00276 g0a7
Horticulturae 11 00276 g0a8
Figure A8. Photographs of tomato fruits harvested from plasma- or air-irradiated tomato plants in Exp. 2. Premature enlarged green tomato fruits immediately after they were harvested (upper panel) and mature red tomato fruits 2 weeks after harvesting (lower panel) were photographed.
Figure A8. Photographs of tomato fruits harvested from plasma- or air-irradiated tomato plants in Exp. 2. Premature enlarged green tomato fruits immediately after they were harvested (upper panel) and mature red tomato fruits 2 weeks after harvesting (lower panel) were photographed.
Horticulturae 11 00276 g0a8
Horticulturae 11 00276 g0a9
Figure A9. Relative abundance bar chart of bacterial communities at the phylum level on the surface of tomato fruits harvested from plasma-irradiated plants. The bacterial communities on the surface of premature enlarged green tomato fruits harvested from six plasma-irradiated tomato plants are indicated by the red dashed line (A). The other bacterial communities were found on the surface of premature enlarged green tomato fruits harvested from six air-irradiated tomato plants as a control (A). Each bacterial communities at the phylum level is shown in panel B (B).
Figure A9. Relative abundance bar chart of bacterial communities at the phylum level on the surface of tomato fruits harvested from plasma-irradiated plants. The bacterial communities on the surface of premature enlarged green tomato fruits harvested from six plasma-irradiated tomato plants are indicated by the red dashed line (A). The other bacterial communities were found on the surface of premature enlarged green tomato fruits harvested from six air-irradiated tomato plants as a control (A). Each bacterial communities at the phylum level is shown in panel B (B).
Horticulturae 11 00276 g0a9
Horticulturae 11 00276 g0a10
Figure A10. Relative abundance bar chart of fungal communities at the phylum level on the surface of tomato fruits harvested from plasma-irradiated plants. The fungal communities on the surface of premature enlarged green tomato fruits harvested from six plasma-irradiated tomato plants are indicated by the red dashed line (A). The other fungal communities were found on the surface of premature enlarged green tomato fruits harvested from six air-irradiated tomato plants as a control (A). Each fungal communities at the phylum level is shown in panel B (B).
Figure A10. Relative abundance bar chart of fungal communities at the phylum level on the surface of tomato fruits harvested from plasma-irradiated plants. The fungal communities on the surface of premature enlarged green tomato fruits harvested from six plasma-irradiated tomato plants are indicated by the red dashed line (A). The other fungal communities were found on the surface of premature enlarged green tomato fruits harvested from six air-irradiated tomato plants as a control (A). Each fungal communities at the phylum level is shown in panel B (B).
Horticulturae 11 00276 g0a10

References

  1. Min, S.C.; Roh, S.H.; Niemira, B.A.; Boyd, G.; Sites, J.E.; Fan, X.; Sokorai, K.; Jin, T.Z. In-package atmospheric cold plasma treatment of bulk grape tomatoes for microbiological safety and preservation. Food Res. Int. 2018, 108, 378–386. [Google Scholar] [CrossRef]
  2. Adhikari, B.; Adhikari, M.; Park, G. The effects of plasma on plant growth, development, and sustainability. Appl. Sci. 2020, 10, 6045. [Google Scholar] [CrossRef]
  3. Waskow, A.; Howling, A.; Furno, I. Mechanisms of plasma-seed treatments as a potential seed processing technology. Front. Phys. 2021, 9, 617345. [Google Scholar] [CrossRef]
  4. Jia, S.; Zhang, N.; Ji, H.; Zhang, X.; Dong, C.; Yu, J.; Yan, S.; Chen, C.; Liang, L. Effects of atmospheric cold plasma treatment on the storage quality and chlorophyll metabolism of postharvest tomato. Foods 2022, 11, 4088. [Google Scholar] [CrossRef]
  5. Palumbo, M.; Attolico, G.; Capozzi, V.; Cozzolino, R.; Corvino, A.; de Chiara, M.L.V.; Pace, B.; Pelosi, S.; Ricci, I.; Romaniello, R.; et al. Emerging postharvest technologies to enhance the shelf-life of fruit and vegetables: An overview. Foods 2022, 11, 3925. [Google Scholar] [CrossRef]
  6. Kaneko, T.; Takashima, K.; Sasaki, S. Integrated transport model for controlled delivery of short-lived reactive species via plasma-activated liquid with practical applications in plant disease control. Plasma Chem. Plasma Process 2024, 44, 1165–1201. [Google Scholar] [CrossRef]
  7. Dobrin, D.; Magureanu, M.; Mandache, N.B.; Ionita, M. The effect of non-thermal plasma treatment on wheat germination and early growth. Innov. Food Sci. Emerg. Technol. 2015, 29, 255–260. [Google Scholar] [CrossRef]
  8. Sivachandiran, L.; Khacef, A. Enhanced seed germination and plant growth by atmospheric pressure cold air plasma: Combined effect of seed and water treatment. RSC Adv. 2017, 7, 1822–1832. [Google Scholar] [CrossRef]
  9. Zhang, B.; Li, R.; Yan, J. Study on activation and improvement of crop seeds by the application of plasma treating seeds equipment. Arch. Biochem. Biophys. 2018, 655, 37–42. [Google Scholar] [CrossRef]
  10. Liu, B.; Honnorat, B.; Yang, H.; Arancibia, J.; Rajjou, L.; Rousseau, A. Non-thermal DBD plasma array on seed germination of different plant species. J. Phys. D Appl. Phys. 2019, 52, 025401. [Google Scholar] [CrossRef]
  11. Adhikari, B.; Adhikari, M.; Ghimire, B.; Park, G.; Choi, E.H. Cold atmospheric plasma-activated water irrigation induces defense hormone and gene expression in tomato seedlings. Sci. Rep. 2019, 9, 16080. [Google Scholar] [CrossRef]
  12. Attri, P.; Koga, K.; Okumura, T.; Shiratani, M. Impact of atmospheric pressure plasma treated seeds on germination, morphology, gene expression and biochemical responses. Jpn. J. Appl. Phys. 2021, 60, 040502. [Google Scholar] [CrossRef]
  13. Park, D.P.; Davis, K.; Gilani, S.; Alonzo, C.-A.; Dobrynin, D.; Friedman, G.; Fridman, A.; Rabinovich, A.; Fridman, G. Reactive nitrogen species produced in water by non-equilibrium plasma increase plant growth rate and nutritional yield. Curr. Appl. Phys. 2013, 13, S19–S29. [Google Scholar] [CrossRef]
  14. Lindsay, A.; Byrns, B.; King, W.; Andhvarapou, A.; Fields, J.; Knappe, D.; Fonteno, W.; Shannon, S. Fertilization of radishes, tomatoes, and marigolds using a large-volume atmospheric glow discharge. Plasma Chem. Plasma Process 2014, 34, 1271–1290. [Google Scholar] [CrossRef]
  15. Vichiansan, V.; Chatmaniwat, K.; Sungkorn, M.; Leksakul, K.; Chaopaisarn, P.; Boonyawan, D. Effect of plasma-activated water generated using plasma jet on tomato (Solanum lycopersicum L. var. cerasiforme) seedling growth. J. Plant Growth Regul. 2023, 42, 935–945. [Google Scholar] [CrossRef]
  16. Ma, R.; Wang, G.; Tian, Y.; Wang, K.; Zhang, J.; Fang, J. Non-thermal plasma-activated water inactivation of food-borne pathogen on fresh produce. J. Hazard. Mater. 2015, 300, 643–651. [Google Scholar] [CrossRef]
  17. Trevisani, M.; Berardinelli, A.; Cevoli, C.; Cecchini, M.; Ragni, L.; Pasquali, F. Effects of sanitizing treatments with atmospheric cold plasma, SDS and lactic acid on verotoxin-producing Escherichia coli and Listeria monocytogenes in red chicory (radicchio). Food Cont. 2017, 78, 138–143. [Google Scholar] [CrossRef]
  18. Shanmugaraj, C.; Jaiganesh, V.; Akshay Kumar, H.M.; Biswas, M.K. Harnessing cold plasma: An innovative strategy for managing postharvest fungal infections in plants. Arch. Curr. Res. Int. 2024, 24, 320–331. [Google Scholar] [CrossRef]
  19. Ochi, A.; Konishi, H.; Ando, S.; Sato, K.; Yokoyama, K.; Tsushima, S.; Yoshida, S.; Morikawa, T.; Kaneko, T.; Takahashi, H. Management of bakanae and bacterial seedling blight diseases in nurseries by irradiating rice seeds with atmospheric plasma. Plant Pathol. 2017, 66, 67–76. [Google Scholar] [CrossRef]
  20. Hayashi, N.; Yagyu, Y.; Yonesu, A.; Shiratani, M. Sterilization characteristics of the surfaces of agricultural products using active oxygen species generated by atmospheric plasma and UV light. Jpn. J. Appl. Phys. 2014, 53, 605FR03. [Google Scholar] [CrossRef]
  21. Misra, N.; Patil, S.; Moiseev, T.; Bourke, P.; Mosnier, J.; Keener, K.; Cullen, P. In-package atmospheric pressure cold plasma treatment of strawberries. J. Food Eng. 2015, 161, 95. [Google Scholar] [CrossRef]
  22. Ramazzina, I.; Tappi, S.; Rocculi, P.; Sacchetti, G.; Berardinelli, A.; Marseglia, A.; Rizzi, F. Effect of cold plasma treatment on the functional properties of fresh-cut apples. J. Agric. Food Chem. 2016, 64, 8010–8018. [Google Scholar] [CrossRef]
  23. Hu, X.; Sun, H.; Yang, X.; Cui, D.; Wang, Y.; Zhuang, J.; Wang, X.; Ma, R.; Jiao, Z. Potential use of atmospheric cold plasma for postharvest preservation of blueberries. Postharvest Biol. Technol. 2021, 179, 111564. [Google Scholar] [CrossRef]
  24. Limnaios, A.; Pathak, N.; Bovi, G.G.; Fröhling, A.; Valdramidis, V.P.; Taoukis, P.S.; Schlüter, O. Effect of cold atmospheric pressure plasma processing on quality and shelf life of red currants. Food Sci. Technol. 2021, 151, 112213. [Google Scholar] [CrossRef]
  25. Zhou, D.; Li, T.; Cong, K.; Suo, A.; Wu, C. Influence of cold plasma on quality attributes and aroma compounds in fresh-cut cantaloupe during low temperature storage. Food Sci. Technol. 2022, 154, 112893. [Google Scholar] [CrossRef]
  26. Yinxin, L.; Can, Z.; Menglu, H.; Cui, S.; Jinping, C.; Jingyu, W.; Huang, L. Effect of cold atmospheric plasma on the gray mold rot of postharvest mulberry fruit. Food Cont. 2022, 137, 108906. [Google Scholar] [CrossRef]
  27. Liu, K.; Ran, C.; Geng, W.; Han, L.; Ostrikov, K.K. Temporal evolution characteristics of the excited species in a pulsed needle-water discharge: Effect of voltage and frequency. Plasma Process. Polym. 2023, 20, e2200134. [Google Scholar] [CrossRef]
  28. Takashima, K.; Hu, Y.; Goto, T.; Sasaki, S.; Kaneko, T. Liquid spray transport of air–plasma-generated reactive species toward plant disease management. J. Phys. D. Appl. Phys. 2020, 53, 354004. [Google Scholar] [CrossRef]
  29. Shimada, K.; Takashima, K.; Kimura, Y.; Nihei, K.; Konishi, H.; Kaneko, T. Humidification effect of air plasma effluent gas on suppressing conidium germination of a plant pathogenic fungus in the liquid phase. Plasma Process. Polym. 2020, 17, 1900004. [Google Scholar] [CrossRef]
  30. Takashima, K.; bin Ahmad Nor, A.S.; Ando, S.; Takahashi, H.; Kaneko, T. Evaluation of plant stress due to plasma-generated reactive oxygen and nitrogen species using electrolyte leakage. Jpn. J. Appl. Phys. 2020, 60, 010504. [Google Scholar] [CrossRef]
  31. Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Lozupone, C.A.; Turnbaugh, P.J.; Fierer, N.; Knight, R. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. USA 2011, 108 (Suppl. S1), 4516–4522. [Google Scholar] [CrossRef]
  32. Toju, H.; Tanabe, A.S.; Yamamoto, S.; Sato, H. High-coverage ITS primers for the DNA-based identification of Ascomycetes and Basidiomycetes in environmental samples. PLoS ONE 2012, 7, e40863. [Google Scholar] [CrossRef]
  33. Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugan, M.; Asnicar, F. Reproducible, interactive, scalable, and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
  34. Măgureanu, M.; Sîrbu, R.; Dobrin, D.; Gîdea, M. Stimulation of the germination and early growth of tomato seeds by non-thermal plasma. Plasma Chem. Plasma Proc. 2018, 38, 989–1001. [Google Scholar] [CrossRef]
  35. Jiang, J.; Li, J.; Dong, Y. Effect of cold plasma treatment on seedling growth and nutrient absorption of tomato. Plasma Sci. Technol. 2018, 20, 044007. [Google Scholar] [CrossRef]
  36. Tappi, S.; Gozzi, G.; Vannini, L.; Berardinelli, A.; Romani, S.; Ragni, L.; Rocculi, P. Cold plasma treatment for fresh-cut melon stabilization. Innov. Food Sci. Emerg. Technol. 2016, 33, 225–233. [Google Scholar] [CrossRef]
  37. Segura-Ponce, L.; Reyes, J.; Troncoso-Contreras, G.; Valenzuela-Tapia, G. Effect of low-pressure cold plasma (LPCP) on the wettability and the inactivation of Escherichia coli and Listeria innocua on fresh-cut apple (Granny Smith) skin. Food Bioprocess Technol. 2018, 11, 1075–1086. [Google Scholar] [CrossRef]
  38. Kim, J.H.; Min, S.C. Moisture vaporization-combined helium dielectric barrier discharge-cold plasma treatment for microbial decontamination of onion flakes. Food Cont. 2018, 84, 321–329. [Google Scholar] [CrossRef]
  39. Srey, S.; Park, S.Y.; Jahid, I.K.; Ha, S.-D. Reduction effect of the selected chemical and physical treatments to reduce L. monocytogenes biofilms formed on lettuce and cabbage. Food Res. Int. 2014, 62, 484–491. [Google Scholar] [CrossRef]
  40. Lacombe, A.; Niemira, B.A.; Gurtler, J.B.; Fan, X.; Sites, X.J.; Boyd, G.; Chen, H. Atmospheric cold plasma inactivation of aerobic microorganisms on blueberries and effects on quality attributes. Food Microbiol. 2015, 46, 479–484. [Google Scholar] [CrossRef]
  41. Bang, I.H.; Lee, E.S.; Lee, H.S.; Min, S.C. Microbial decontamination system combining antimicrobial solution washing and atmospheric dielectric barrier discharge cold plasma treatment for preservation of mandarins. Postharvest Biol. Technol. 2020, 162, 111102. [Google Scholar] [CrossRef]
  42. Los, A.; Ziuzina, D.; Boehm, D.; Bourke, P. Effects of cold plasma on wheat grain microbiome and antimicrobial efficacy against challenge pathogens and their resistance. Int. J. Food Microbiol. 2020, 335, e108889. [Google Scholar] [CrossRef]
  43. Mravlje, J.; Regvar, M.; Starič, P.; Mozetič, M.; Vogel-Mikuš, K. Cold plasma affects germination and fungal community structure of buckwheat seeds. Plants 2021, 10, e851. [Google Scholar] [CrossRef]
  44. Sun, H.; Duan, Y.; Li, H.; Hu, X.; Li, B.; Zhuang, J.; Feng, J.; Ma, R.; Jiao, Z. Microbiota characterization of atmospheric cold plasma treated blueberries. Food Sci. Technol. 2023, 180, 114720. [Google Scholar] [CrossRef]
  45. Ma, S.; Tong, M.; Yuan, S.; Liu, H. Responses of the microbial community structure in Fe(II)-bearing sediments to oxygenation: The role of reactive oxygen species. ACS Earth Space Chem. 2019, 3, 738–747. [Google Scholar] [CrossRef]
  46. Berrios, L.; Rentsch, J.D. Linking reactive oxygen species (ROS) to abiotic and biotic feedbacks in plant microbiomes: The dose makes the poison. Int. J. Mol. Sci. 2022, 23, 4402. [Google Scholar] [CrossRef]
Horticulturae 11 00276 g001
Figure 1. Timetable of tomato plant cultivation, non-thermal atmospheric-pressure plasma or air irradiation, analysis of plant growth, and evaluation of preservation status of harvested tomato fruits. Twelve tomato plants were periodically irradiated with plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. Measurements of plant height, numbers of leaves and fruit bundles, SPAD value, and dry weight were performed three times: the first experiment was conducted on June 4, 11, 18, and 25 in 2021 (Exp. 1); the second experiment was conducted on August 5, 12, 19, and 26 in 2022 (Exp. 2); and the third experiment was conducted on November 30 in 2022 and January 6, 13, and 20 in 2023 (Exp. 3). In these three experiments, green-enlarged premature fruits were harvested for evaluation of preservation status and microbiome analysis. At 2 weeks after harvesting, the status of the preserved fruits was photographed.
Figure 1. Timetable of tomato plant cultivation, non-thermal atmospheric-pressure plasma or air irradiation, analysis of plant growth, and evaluation of preservation status of harvested tomato fruits. Twelve tomato plants were periodically irradiated with plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. Measurements of plant height, numbers of leaves and fruit bundles, SPAD value, and dry weight were performed three times: the first experiment was conducted on June 4, 11, 18, and 25 in 2021 (Exp. 1); the second experiment was conducted on August 5, 12, 19, and 26 in 2022 (Exp. 2); and the third experiment was conducted on November 30 in 2022 and January 6, 13, and 20 in 2023 (Exp. 3). In these three experiments, green-enlarged premature fruits were harvested for evaluation of preservation status and microbiome analysis. At 2 weeks after harvesting, the status of the preserved fruits was photographed.
Horticulturae 11 00276 g001
Horticulturae 11 00276 g002
Figure 2. Schematic of the lab-built PEGDS spray device for tomato plant. The PEGDS spray device was powered by rechargeable lithium-ion batteries, which provided 24V bus power to the air compressor, water pOk,ump, and dielectric barrier discharge (DBD) plasma generator developed in a previous work [28]. The plasma effluent gas from DBD plasma was transferred to the PEGDS spray nozzle to force its dissolution into the liquid and be sprayed toward ambient. The flows of plasma effluent gas and water were shown by red and blue arrows, respectively. To avoid any reactive species loss, the nozzle and gas tubes were made of PTFE or PFA.
Figure 2. Schematic of the lab-built PEGDS spray device for tomato plant. The PEGDS spray device was powered by rechargeable lithium-ion batteries, which provided 24V bus power to the air compressor, water pOk,ump, and dielectric barrier discharge (DBD) plasma generator developed in a previous work [28]. The plasma effluent gas from DBD plasma was transferred to the PEGDS spray nozzle to force its dissolution into the liquid and be sprayed toward ambient. The flows of plasma effluent gas and water were shown by red and blue arrows, respectively. To avoid any reactive species loss, the nozzle and gas tubes were made of PTFE or PFA.
Horticulturae 11 00276 g002
Horticulturae 11 00276 g003
Figure 3. Efficacy of long-term plasma irradiation in influencing tomato plant growth. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. On 4, 11, 18, and 25 June 2021, plant height (A), number of leaves (B), number of fruit bunches (C), and plant dry weight (D) were analyzed. The average of plant height, number of leaves, number of fruit bunches, and plant dry weight are shown in a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Figure 3. Efficacy of long-term plasma irradiation in influencing tomato plant growth. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. On 4, 11, 18, and 25 June 2021, plant height (A), number of leaves (B), number of fruit bunches (C), and plant dry weight (D) were analyzed. The average of plant height, number of leaves, number of fruit bunches, and plant dry weight are shown in a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Horticulturae 11 00276 g003
Horticulturae 11 00276 g004
Figure 4. Efficacy of long-term plasma irradiation on the chlorophyll content of tomato plant leaves. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. The SPAD value, which indicates the amount of chlorophyll in the leaves, was measured on June 4, 11, 18, and 25 in 2021. The average of SPAD value is shown in a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Figure 4. Efficacy of long-term plasma irradiation on the chlorophyll content of tomato plant leaves. Twelve tomato plants were periodically irradiated with non-thermal atmospheric-pressure plasma or air as a control from the three-leaf stage to the premature-green-fruit stage every Monday, Wednesday, and Friday. The SPAD value, which indicates the amount of chlorophyll in the leaves, was measured on June 4, 11, 18, and 25 in 2021. The average of SPAD value is shown in a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Horticulturae 11 00276 g004
Horticulturae 11 00276 g005
Figure 5. Photograph of tomato fruits harvested from non-thermal atmospheric-pressure plasma- or air-irradiated tomato plants in Exp. 1. Premature enlarged green tomato fruits immediately after they were harvested (upper panel) and mature red tomato fruits 2 weeks after harvesting (lower panel) were photographed.
Figure 5. Photograph of tomato fruits harvested from non-thermal atmospheric-pressure plasma- or air-irradiated tomato plants in Exp. 1. Premature enlarged green tomato fruits immediately after they were harvested (upper panel) and mature red tomato fruits 2 weeks after harvesting (lower panel) were photographed.
Horticulturae 11 00276 g005
Horticulturae 11 00276 g006
Figure 6. Quantitative measurement of the amounts of the V4 region of 16S rDNA and the ITS1 region of 18S rDNA. The amounts of V4 region DNA from 16S rDNA and ITS1 region from 18S rDNA is shown in (A) and (B), respectively. The mean amount of DNA calculated for each sample was shown by a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Figure 6. Quantitative measurement of the amounts of the V4 region of 16S rDNA and the ITS1 region of 18S rDNA. The amounts of V4 region DNA from 16S rDNA and ITS1 region from 18S rDNA is shown in (A) and (B), respectively. The mean amount of DNA calculated for each sample was shown by a bar chart with error bars (n = 12, SD). Statistical analysis did not denote significant differences between plasma treatment and air treatment as a control (Welch’s t-test, p < 0.05).
Horticulturae 11 00276 g006
Horticulturae 11 00276 g007
Figure 7. Difference in the bacterial and fungal richness on the surface of tomato fruits harvested from non-thermal atmospheric-pressure plasma- and air-irradiated tomato plants. Shannon α-diversity of the bacterial community (A) and the fungal community (B) on the surface of premature green fruits harvested from plasma- and air (Control)-irradiated tomato plants are indicated by box-and-whisker plots. Mean of Shannon_entropy was calculated for each sample and is indicated by the horizontal line in each box. Error bars indicate the standard deviation around the mean. The statistical difference in Shannon α-diversity was assessed using the Kruskal-Wallis test. A significant difference is indicated by the asterisk (p < 0.05).
Figure 7. Difference in the bacterial and fungal richness on the surface of tomato fruits harvested from non-thermal atmospheric-pressure plasma- and air-irradiated tomato plants. Shannon α-diversity of the bacterial community (A) and the fungal community (B) on the surface of premature green fruits harvested from plasma- and air (Control)-irradiated tomato plants are indicated by box-and-whisker plots. Mean of Shannon_entropy was calculated for each sample and is indicated by the horizontal line in each box. Error bars indicate the standard deviation around the mean. The statistical difference in Shannon α-diversity was assessed using the Kruskal-Wallis test. A significant difference is indicated by the asterisk (p < 0.05).
Horticulturae 11 00276 g007
Horticulturae 11 00276 g008
Figure 8. Difference in β-diversity plots of the bacterial and fungal richness on the surface of tomato fruits harvested from non-thermal atmospheric-pressure plasma- or air-irradiated tomato plants. Weighted_Unifrac β-diversity of the bacterial community (A) and the fungal community (D) on the surface of premature green fruits harvested from plasma and air (Control)-irradiated tomato plants, is indicated by plots of the principal component analysis (PCA). β-diversity plots of plasma samples are indicated by black circles and β-diversity plots of air samples are indicated by white circles. Weighted_UniFrac distance of the plots within Control or Plasma to Control (B,E), and within Plasma or Control to Plasma (C,F), are indicated by box-and-whisker plots. The mean UniFrac distance was calculated for each sample and is indicated by the horizontal line in the box. Error bars indicate the standard deviation around the mean. The statistical difference in Weighted_Unifrac β-diversity was assessed using PERMANOVA. A significant difference is indicated by the asterisk (p < 0.05).
Figure 8. Difference in β-diversity plots of the bacterial and fungal richness on the surface of tomato fruits harvested from non-thermal atmospheric-pressure plasma- or air-irradiated tomato plants. Weighted_Unifrac β-diversity of the bacterial community (A) and the fungal community (D) on the surface of premature green fruits harvested from plasma and air (Control)-irradiated tomato plants, is indicated by plots of the principal component analysis (PCA). β-diversity plots of plasma samples are indicated by black circles and β-diversity plots of air samples are indicated by white circles. Weighted_UniFrac distance of the plots within Control or Plasma to Control (B,E), and within Plasma or Control to Plasma (C,F), are indicated by box-and-whisker plots. The mean UniFrac distance was calculated for each sample and is indicated by the horizontal line in the box. Error bars indicate the standard deviation around the mean. The statistical difference in Weighted_Unifrac β-diversity was assessed using PERMANOVA. A significant difference is indicated by the asterisk (p < 0.05).
Horticulturae 11 00276 g008
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Takahashi, H.; Takashima, K.; Miyashita, S.; Sasaki, S.; Derib, A.A.; Kato, K.; Kanayama, Y.; Kaneko, T. Managing the Microbiome on the Surface of Tomato Fruit by Treatment of Tomato Plants with Non-Thermal Atmospheric-Pressure Plasma During Cultivation. Horticulturae 2025, 11, 276. https://doi.org/10.3390/horticulturae11030276

AMA Style

Takahashi H, Takashima K, Miyashita S, Sasaki S, Derib AA, Kato K, Kanayama Y, Kaneko T. Managing the Microbiome on the Surface of Tomato Fruit by Treatment of Tomato Plants with Non-Thermal Atmospheric-Pressure Plasma During Cultivation. Horticulturae. 2025; 11(3):276. https://doi.org/10.3390/horticulturae11030276

Chicago/Turabian Style

Takahashi, Hideki, Keisuke Takashima, Shuhei Miyashita, Shota Sasaki, Abebe Alemu Derib, Kazuhisa Kato, Yoshinori Kanayama, and Toshiro Kaneko. 2025. "Managing the Microbiome on the Surface of Tomato Fruit by Treatment of Tomato Plants with Non-Thermal Atmospheric-Pressure Plasma During Cultivation" Horticulturae 11, no. 3: 276. https://doi.org/10.3390/horticulturae11030276

APA Style

Takahashi, H., Takashima, K., Miyashita, S., Sasaki, S., Derib, A. A., Kato, K., Kanayama, Y., & Kaneko, T. (2025). Managing the Microbiome on the Surface of Tomato Fruit by Treatment of Tomato Plants with Non-Thermal Atmospheric-Pressure Plasma During Cultivation. Horticulturae, 11(3), 276. https://doi.org/10.3390/horticulturae11030276

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop