Next Article in Journal
Enhancing Cracking Resistance and Post-Harvest Quality of Sweet Cherries (Prunus avium L.) Through Calcium and Potassium-Based Foliar Treatments
Previous Article in Journal
Cytokinin Oxidase (CKX) Family Members in ‘duli’ (Pyrus betulifolia Bunge): Genome-Wide Identification and Tissue Expression Profile Under Abiotic Stress
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145

1
National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, No. 1 Weigang, Nanjing 210095, China
2
Hami Melon Research Center, Xinjiang Academy of Agricultural Sciences, Urumqi 830091, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Horticulturae 2025, 11(1), 31; https://doi.org/10.3390/horticulturae11010031
Submission received: 11 November 2024 / Revised: 28 December 2024 / Accepted: 29 December 2024 / Published: 2 January 2025
(This article belongs to the Section Plant Pathology and Disease Management (PPDM))

Abstract

Gummy stem blight (GSB), caused by Stagonosporopsis cucurbitacearum (Didymella bryoniae), poses a growing threat to greenhouse melon production. Despite this, the defense mechanism of melon against S. cucurbitacearum remains poorly understood. In this study, by employing electron microscopy and transcriptome sequencing, we investigated the cellular ultrastructure differences and gene expression dynamics of two melon accessions, PI 420145 (resistant to GSB) and ‘Baipicui’ (susceptible), pre- and post- inoculation. Our results revealed that PI 420145 exhibits a thicker waxy layer on the leaf surface and limited conidial germination without obvious signs of cell damage compared to ‘Baipicui’. The transcriptomic analysis identified a total of 23,078 differentially expressed genes (DEGs) and 974 differentially expressed long noncoding RNAs (DELs). Specifically, phenylpropanoid biosynthesis, cyanoamino acid metabolism, and MAPK signaling–plant and plant–pathogen interactions were enriched in PI 420145, while ‘Baipicui’ displayed enrichment in metabolism and autophagy. Additionally, through lncRNA–mRNA network construction, we identified a total of 38 lncRNA–mRNA targeted regulatory relationships in the four most significant KEGG pathways for disease resistance.

1. Introduction

Gummy stem blight (GSB), caused by Stagonosporopsis cucurbitacearum (formerly Didymella bryoniae), is a devastating soil-borne fungal disease of melon and other cucurbit crops, primarily infecting the stems and leaves and retarding plant growth [1,2]. The initial disease symptom is water-soaked lesions, which progress to necrotic lesions on leaves and stems, leading to stem cankers and brown gummy exudate in cortical tissue [3]. Severe infections eventually encircle the stem, causing plant wilt and death [3]. The incidence of GSB in greenhouses can reach up to 80%, and in severe cases, yield loss can be as high as 100% [4,5]. The application of fungicides is the main strategy in managing GSB for melon production; however, excessive fungicide usage increases selection pressure on pathogen populations to adapt to fungicide resistance and poses risks to human health and the environment [2]. Thus, the development of melon cultivars with enhanced GSB resistance is crucial for sustainable production.
Cultivated melon varieties often lack genetic diversity due to domestication and breeding selection for desirable fruit quality traits, resulting in the loss of resistance to abiotic and biotic stresses [6]. Since the 1960s, at least 3000 germplasms have been screened for GSB-resistance; however, only a limited number of accessions exhibited high resistance levels, including Plant Introductions (PIs) 140471, PI 157082, PI 511890, PI 482398, PI 482399, PI 420145, and H55R, which exhibited either monogenic dominant or monogenic recessive resistance [7,8,9,10,11,12,13]. Among them, PI 420145 (Cucumis melo L.), collected from Japan, has displayed consistent resistance to GSB over the past 20 years. Its resistance is attributed to a monogenic dominant gene located on chromosome (Chr) 10, identified by the AFLP marker E-TG/M-CTC200 [2].
To unravel the genetic mechanisms underlying PI 420145’s resistance to GSB, a number of studies have been conducted. Previous studies have reported upregulated enzymes in PI 420145 in response to GSB, including peroxidase (POD), polyphenol oxidase (PPO), and phenylalanine ammonia-lyase (PAL) [14]. Additionally, differential regulation of jasmonic acids and salicylic acids in PI 420145 compared to the susceptible line ‘Baipicui’ hinted at their involvement in enhancing resistance against pathogen colonization and reproduction [15]. Moreover, analysis of circular RNAs (circRNAs) suggests that PI 420145 activates various pathways against S. cucurbitacearum invasion, such as salicylic acid (SA) [15]. Nonetheless, the precise mechanisms linking these molecular changes to GSB resistance in PI 420145 remain to be elucidated.
In addition to circRNAs, long noncoding RNAs (lncRNAs) have emerged as key regulators of gene expression in plant defense responses [16,17,18], playing crucial roles in modulating a variety of biological processes, including plant growth [19], development [20,21], and biotic and abiotic stress responses [22,23,24]. lncRNAs are classified as RNAs more than 200 nt in length that are not translated into functional proteins [25]. In recent years, numerous studies have highlighted the involvement of lncRNAs in plant–pathogen interactions in various species. For instance, in wheat, certain lncRNAs (XLOC_302848 and XLOC_321638) have been implicated in the resistance to Fusarium seedling blight [26]. In tomato, a total of 273 lncRNAs were identified in response to Botrytis cinerea infection, with a higher proportion of antisense lncRNAs targeting genes enriched in hydrolase activity [27]. The analysis of tomato lncRNA16397 through overexpression and silencing confirmed its role as a positive regulator of respiratory burst oxidase (RBOH) and its contribution to enhanced resistance of tomato to Pseudomonas pathogens [28]. A few studies in melon revealed a set of powdery mildew-responsive lncRNAs, such as LNC_018800, LNC_018062, and LNC_023803 [29,30]. Similar to these findings, our study aims to investigate the role of lncRNAs in melon’s defense response to S. cucurbitacearum. By identifying and characterizing lncRNAs involved in GSB resistance, we can gain valuable insights into the molecular mechanisms underlying plant–pathogen interactions and explore potential strategies for developing disease-resistant crops.

2. Materials and Methods

2.1. Plant Growth and Pathogen Inoculation

Two melon lines were utilized in this study: PI 420145 (highly resistant to GSB, preserved at Nanjing Agricultural University, NAU) and ‘Baipicui’ (highly susceptible to GSB and many other diseases, provided by Xinjiang Academy of Agricultural Sciences). PI 420145 bears small-medium fruits with thin and orange skin, while Baipicui produces medium-large fruits with thick, striped, and white skin at mature stages. PI 420145 also showed resistance to a number of diseases such as bacterial fruit blotch [31]. Seedlings of both lines were grown in a growth chamber (16 h light at 25 °C/8 h dark at 20 °C) until reaching the 3–5 true leaf stage for further pathogen inoculation experiments.
The isolates of Stagonosporopsis cucurbitacearum were collected from infected melon in the field of Baima Teaching and Scientific Research Base of NAU. These isolates were maintained on potato carrot agar (PCA) at 4 °C and cultured on potato dextrose agar (PDA) at 25 °C in darkness for 7 days, followed by exposure to continuous UV light (12 h UV/12 h dark) for 4 days at 25 °C. The conidia were then harvested to prepare spore suspension, adjusted to 5 × 105 conidia per mL measured by a hemocytometer. The freshly prepared conidial inoculum was directly sprayed on the seedling leaves using a hand sprayer. After inoculation, plants were enclosed within plastic domes to maintain high relative humidity for 3 days before moving out to grow in the normal condition as described above.

2.2. Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM)

Leaf samples from PI 420145 and ‘Baipicui’ were collected at 1, 3, and 7 days post-inoculation (dpi). They were vacuum-infiltrated and fixed with 2.5% glutaraldehyde for 2 h. Subsequently, half of the fixed samples were examined under a Hitachi S-3000 N scanning electron microscope (SEM) (Hitachi High-Technologies Corporation, Tokyo, Japan), following the protocol outlined by Kang and Buchenauer [32]. The remaining half of the samples were rinsed three times with phosphate buffer (pH = 6.8), fixed with 12% osmic acid for 2 h, and then examined under a Hitachi H-7650 transmission electron microscope (TEM) (Hitachi High-Technologies Corporation, Tokyo, Japan).

2.3. Determination of Wax Content in Melon Leaves

The epidermal wax was extracted from melon leaves at 0, 1, 3, 5, and 7 dpi following chloroform extraction methods [33]. Briefly, freshly chopped leaves were immersed in 40 mL of chloroform for 60 s in flasks and removed. The wax weight was determined by weight difference after chloroform evaporation at room temperature. The samples at each time point were replicated three times. The difference in epidermal wax content between the two melon cultivars was analyzed using a Student’s t test. (p < 0.05).

2.4. RNA-Seq

Total RNA was isolated from the leaf samples of PI 420145 and ‘Baipicui’ that were collected at 0 and 2 dpi, with three replicates for each line at each time point. Sample tissues were frozen immediately in liquid nitrogen and stored at −80 °C. Total RNA was extracted using Trizol reagent (Thermo Fisher Scientific Applied Biosystems, Shanghai, China) following the manufacturer’s procedure. The total RNA quantity and purity were analyzed with Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, Santa Clara, CA, USA), and high-quality RNA samples with RIN number > 7.0 were used to construct the sequencing library. RNA integrity and purity were also checked by electrophoresis on 1% agarose gel. To prepare the RNA-seq libraries, the ribosomal RNA (rRNA) was first removed by an EpicentreRibo-Zero™ rRNA Removal Kit (Epicentre, Madison, WI, USA). The libraries were then generated under the instructions provided by the NEB Next Ultra™ Directional RNA Library Prep kit for Illumina (NEB, lpswich, MA, USA). Subsequently, the clustering of the index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions. After cluster generation, a total of 12 libraries were sequenced on an Illumina HiSeq 2500 platform with 125 bp paired end reads.
The raw sequencing data were deposited in the National Center for Biotechnology Information (NCBI) sequence read archive under the accession numbers from SRR13180975 to SRR13180986. The melon draft genome (DHL92 v4.0) was used as the reference genome, obtained from CuGenDBv2 (http://cucurbitgenomics.org/v2/organism/23, accessed on 28 December 2024). After removing the low-quality reads and adaptors, the remaining clean reads were used. Mapped reads from each sample were assembled by both Scripture (beta2) [34] and Cufflinks (v2.1.1) [35] with a reference-based approach. After the final transcriptome was generated, Cufflinks (v2.1.1) [35] was used to estimate the expression levels of all transcripts and to perform expression abundance for mRNAs by calculating the FPKM (fragment per kilobase of transcript per million mapped reads) value.

2.5. lncRNA Identification

Transcripts with >200 nucleotides and >2 exons were kept and subjected to identify lncRNAs using Coding Potential Calculator (CPC, 0.9-r2) and Coding-Non-Coding-Index (CNCI, v2) [36,37]. Common transcripts identified by these two tools were then scanned against the Pfam database (Pfam Scan, v1.3) [38] to discover any probable protein domains. Phylogenetic codon substitution frequency (PhyloCSF) (v20121028) [39] was applied to determine whether a multi-species nucleotide sequence alignment is likely to represent a protein-coding region. Those transcripts without coding potential were candidate sets of lncRNAs.

2.6. Identification of Differentially and Specific Expressed mRNA and lncRNA

Cuffdiff (v2.1.1) [35] was applied to determine differentially expressed genes (DEGs) and differentially expressed lncRNAs (DELs) among samples with the criteria of p value < 0.05 and |log2FoldChange| > 1.5. The log2(Fold-Change) was assessed by FPKMs, which were calculated in Cuffdiff (v2.1.1).

2.7. Pathway Enrichment Analysis

The DEGs and DELs were used for Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses. The GO term annotation for the melon genome was obtained from CuGenDBv2. The KEGG pathway for melon proteins was annotated with the online tool KofamKOALA (https://www.genome.jp/tools/kofamkoala/, accessed on 28 December 2024). The enriched GO and KEGG terms were analyzed with the R/clusterProfiler package with function “compareCluster” and “enricher” with the following parameters: p-value cutoff at 0.05 level, minGSSize = 8, and maxGSSize = 500 [40].

2.8. Construction of lncRNA–mRNA-Network

The nearby coding genes within 100 kb upstream and downstream of a lncRNA were considered as its potential targets, which formed lncRNA–mRNA pairs [41]. In addition, if the expression patterns of lncRNA and its potential target mRNA show a highly positive or negative correlation, their functions may be highly correlated. Therefore, we examined the Pearson correlation between the expression levels of the DELs and DEGs to predict their targeting relationship with a r2 > 0.95 threshold. The relationship between the selected genes and lncRNAs was used to construct the lncRNA–mRNA network by using Cytoscape 3.8.2 software [42]. Hub genes were regarded as highly connected genes with other genes in the same module or genes with high module membership (kME) [43].

2.9. qRT-PCR Validation

Eight transcripts (four genes and four lncRNAs) were randomly selected for verification by Quantitative real-time (qRT)-PCR. The β-Actin gene (MELO3C008032) was used as an internal reference gene. Primers (Table 1) were designed using Primer Premier 5.0 software and verified with agarose gel. The qRT-PCR was conducted on a CFX96 Real-Time PCR (Bio-Rad Laboratories, Hercules, CA, USA) with ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech, Nanjing, China). The total reaction system was 20 μL, and the reaction procedures were as follows: 95 °C for 3 min, followed by 40 cycles at 95 °C for 20 s, 55–60 °C for 20 s, and 72 °C for 20 s. The relative gene expression levels were calculated by the 2−∆∆Ct method. Linear regression analysis was employed to assess the correlation between gene expression patterns and qRT-PCR results.

3. Results

3.1. Response of PI 420145 and ’Baipicui’ to GSB

The melon line PI 420145 was highly resistant and close to immune to GSB, while the other line ‘Baipicui’ displayed typical symptoms at 21 dpi including wilted vine, necrotic leaf callapse, and stem canker (Figure 1).
To elucidate the response of the two melon lines to infection, we examined their leaf surfaces using SEM at 0, 1, 3, and 7 dpi (Figure 2a). The epidermal cells of PI 420145 exhibited a thicker waxy cuticle layer compared to ‘Baipicui’ (Figure 2a). This inherent structural difference, as confirmed by wax content analysis (Figure S1; Table S9), likely contributes to the enhanced resistance of PI 420145. The stable wax content of PI 420145 following inoculation further suggests that its pre-existing physical barrier is sufficient to impede fungal colonization (Figure S1; Table S9).
On the leaf surface of ‘Baipicui’, conidia germinated and penetrated the waxy layer within 1 dpi. By 3 dpi, the hyphae had elongated, and a substantial number of hyphae were produced by 7 dpi (Figure 2a and Figure S2). In contrast, no noticeable germination of pathogen conidia or elongation of hyphae on the leaf surface of PI 420145 was observed (Figure 2a and Figure S2). These findings may suggest the high wax content and thick wax layer of PI 420145 serve as a primary physical barrier, inhibiting the germination and proliferation of S. cucurbitacearum.

3.2. Ultrastructural Changes in Inoculated Leaves

We further employed TEM to investigate the ultrastructural changes in host cells after inoculation (Figure 2b). At 1 dpi, both PI 420145 and ‘Baipicui’ exhibited normal cell morphology, characterized by elastic cell walls and intact organelles including oval mitochondria and chloroplast with starch granules, thylakoid lamella structure, and osmiophilic bodies. While PI 420145 maintained a relatively stable chloroplast structure with minimal alterations, ‘Baipicui’ displayed pronounced cellular damage by 3 dpi, characterized by cell wall contraction, chloroplast degeneration, and mitochondrial disruption. Particularly, chloroplasts became more spherical, the lamellar structure of thylakoid appeared cavitated, the volume of stroma and the number of osmiophilic bodies increased, and mitochondria adopted a rounded shape. These cellular aberrations intensified by 7 dpi, with chloroplast disintegration, stroma dispersion, and thylakoid disorganization evident in ‘Baipicui’. In contrast, PI 420145 exhibited negligible ultrastructural changes.

3.3. RNA Sequencing

To further reveal the early transcriptional response of PI 140145 and ‘Baipicui’ to S. cucurbitacearum infection, we collected leaf samples for RNA-seq at 0 and 2 dpi, prior to the appearance of visible lesions and symptoms. A total of 12 cDNA libraries were sequenced using the Illumina HiSeq 2500 platform. Each sample yielded an average of approximately 17.25 Gb raw bases, resulting in a total of 131.01 million clean reads, of which 92.10% (120.36 million) passed the quality control thresholds (Table S1). Principal component analysis (PCA) showed a significant difference among treatments, and the three biological replicates in the same treatment clustered together (Figure S3a). Pearson correlation analysis indicated that the gene expression correlation among biological replicates had a high coefficient (R2) ranging from 0.623 to 0.946, confirming the reliability of the data (Figure S3b).
The high-quality filtered reads were aligned to the melon DHL92 draft genome v4.0. As a result, a total of 23,078 protein-coding RNAs and 974 lncRNAs were identified to distribute on 12 chromosomes in melon (Figure 3a). The protein-coding RNAs exhibited an average length of 1863 bp, with 88.46% being less than 3000 bp and an average of 6 exons per mRNA. According to the location of lncRNAs in the melon genome, 79.36% of them were long intergenic noncoding RNAs (lincRNAs), with no intronic lncRNAs detected (Figure 3b; Table S2). The lengths of lncRNAs ranged from 202 bp to 14,999 bp, with 79.06% being less than 2000 bp. Furthermore, 99.79% of the lncRNAs had 2–6 exons, and their open reading frames (ORFs) were shorter compared to mRNAs (Figure 3b). These findings highlight distinct structural characteristics between lncRNAs and mRNAs, with lncRNAs typically possessing fewer exons and shorter ORFs than protein-coding RNAs.

3.4. Identification of Differential Expressed Transcripts

To investigate the gene expression levels in PI 420145 and ‘Baipicui’ seedlings before and after inoculation, the FPKM values were used to normalize the reads from RNA-seq. In total, we detected 8224 DEGs and 208 DELs across all the comparisons using criteria of |log2fold-change| > 1.5 and p value < 0.05 (Figure 3c,d; Table S3). Randomly selected DEGs and DELs were examined by qRT-PCR to further validate the RNA-Seq results. As shown in Figure S3c, the gene expression patterns evaluated by qRT-PCR and RNA-Seq have a high correlation (R2 = 0.98), suggesting the reliability of high-throughput RNA sequencing data.
Particularly, ‘Baipicui’ exhibited a more pronounced transcriptional response to S. cucurbitacearum infection, with a greater number of DEGs and DELs compared to PI 420145 at pre- and post-inoculation. Specifically, ‘Baipicui’ displayed 5412 DEGs and 106 DELs in the comparison at 0 and 2 dpi (designated as S0 vs. S2), while PI 420145 possessed 2997 DEGs and 42 DELs (designated as R0 vs. R2), indicating substantial transcriptional reprogramming upon infection in susceptible lines (Figure 3c,d). Direct comparisons between the two lines at each time point revealed a similar trend: while only 941 DEGs and 44 DELs were detected at 0 dpi (S0 vs. R0), this number surged to 5268 DEGs and 120 DELs at 2 dpi (S2 vs. R2), further emphasizing the limited transcriptional response of PI 420145 to the pathogen challenge.

3.5. Function Analysis of DEGs and the Target Genes of DELs

To explore the functions of DEGs and DELs identified between PI 420145 and ‘Baipicui’, we conducted GO and KEGG pathway enrichment analysis (Tables S4 and S5). In the comparison before pathogen penetration (S0 vs. R0), GO enrichment analysis revealed the enriched processes mainly related to plant defense and cell wall synthesis, including defense response (GO:0006952), response to hydrogen peroxide (GO:0042542), L-phenylalanine catabolic process (GO:0006559), cinnamic acid biosynthetic process (GO:0009800), and plant-type primary cell wall biogenesis (GO:0009833) (Figure 4a; Table S4). Moreover, approximately half of the enriched genes for defense response (GO:0006952), L-phenylalanine catabolic process (GO:0006559), and cinnamic acid biosynthetic process (GO: 0009800) could be targeted by lncRNAs that are differentially expressed as well (Figure 4b).
In the comparison of 2 dpi with 0 dpi, the GO terms showed common and distinct transcriptional differences in the susceptible line ‘Baipicui’ and the resistant line PI 420145. In both the R0 vs. R2 and S0 vs. S2 comparisons, the common enriched GO terms revealed cell division during leaf growth, including microtubule-based movement (GO:0007018) and cell wall organization (GO:0071555) (Figure 4a). Specifically, in the R0 vs. R2 comparison, a total of 11 DEGs were significantly enriched in regulation of defense response (GO:0031347), and 71 DEGs were enriched in cell wall-related processes (GO:0071555, GO:0042546, GO:0010411, GO:0009800, and GO:0006559), suggesting its potential in induction of basal defense regulation network (Figure 4a; Table S4). In the S0 vs. S2 comparison for ‘Baipicui’, a total of 71 DEGs were enriched related to photosynthesis (GO:0015979, GO:0010027, GO:0015995, and GO:0009903), suggesting that the leaf pigment degradation may be triggered by pathogen invasion. However, the enriched GO terms for DEL target mRNA did not fall into the photosynthesis-related terms, but instead the autophagy or cell death related-terms (e.g., GO:0006914, GO:0000422, GO:0009611) (Figure 4b).
In the KEGG pathway annotations, DEGs in the R0 vs. R2 comparison were mainly enriched in pathways related to phenylpropanoid biosynthesis (ko00940), plant–pathogen interaction (ko04626), MAPK pathway–plant signaling (ko04016), and cyanoamino acid metabolism (ko00460) (Figure 4c). Particularly, 52 and 42 genes were enriched in plant–pathogen interaction and MAPK signaling pathway, respectively. Moreover, among these pathways, only the pathway of phenylpropanoid biosynthesis (ko00940) was also enriched from DEL target mRNA (Figure 4d).
Particularly, no GO and KEGG pathways associated with cuticle, cutin, or wax biosynthesis or degradation were enriched. Since we observed the enhanced wax content in PI420145, we conducted a further examination of key DEGs involved in cuticle bio-synthesis pathways, such as 3-ketoacyl-CoA synthase, fatty acyl-CoA reductase and aldehyde dehydrogenase. The result revealed dynamic expression changes between 0 and 2 dpi in PI 420145 compared to ‘Baipicui’, suggesting their participation in GSB resistance (Figure S4; Table S7).

3.6. Construction of lncRNA–mRNA Network Based on KEGG Results

According to the KEGG analysis, the four most significantly represented pathways in PI 420145 were selected to construct the lncRNA–mRNA network, including phenylpropanoid biosynthesis (ko00940), cyanoamino acid metabolism (ko00460), MAPK-signaling pathway (ko04016), and plant–pathogen interaction (ko04626) (Figure 5; Table S6). Within this network, the phenylpropanoid biosynthesis pathway, critical for lignin formation, interconnects with cyanoamino acid metabolism, suggesting an integrated role in reinforcing cell walls against pathogen invasion. Additionally, MAPK-signaling and plant–pathogen interaction pathways share two lncRNA–mRNA connections, illustrating overlapping regulatory roles that may be essential for activating defense responses.
In total, 38 lncRNA–mRNA targeted regulatory relationships were identified, with 21 connections being one-to-one pair interaction. Particularly, LNC_000759 is proposed to target a cluster of phenylalanine ammonia-lyase (PAL) genes, including MELO3C014223, MELO3C014224, MELO3C014227, and MELO3C014228, which are central to lignin biosynthesis. Furthermore, the gene MELO3C026727, which encodes calcium-dependent protein kinase associated with plant–pathogen interaction pathways, is targeted by five lncRNAs (LNC_000706-709 and LNC_000742), indicating a likely coordinated regulatory mechanism. These interactions suggest that both lignin biosynthesis and MAPK signaling are finely regulated by lncRNAs to mediate pathogen resistance. This network’s intricate structure, wherein single lncRNAs target multiple mRNAs and some mRNAs are regulated by several lncRNAs, emphasizes the complexity of lncRNA-mediated regulation in GSB resistance.

4. Discussion

4.1. Epicuticular Waxes and Cell Wall Lignin for Pre-Penetration Defense Hosted by PI 420145

The plant cuticle, the outermost layer interfacing with the environment, serves as a physical barrier of defense against pathogen infection and various abiotic stresses [44]. It is mainly composed of a matrix of cutin (an insoluble polyester) and embedded wax [45]. Cuticular waxes, positioned as either epicuticular or intracuticular, contain a mixture of C20 to C40 very-long-chain fatty acids (VLCFAs), further modified into alkanes, aldehydes, ketones, primary and secondary alcohols, and esters [46]. Studies in maize and wheat have demonstrated that alterations in wax composition can significantly impact pathogen establishment. For instance, the maize very-long-chain C26 aldehydes have been shown to impede conidial germination and penetration by barley powdery mildew Blumeria graminis f.sp. hordei [47]. Similarly, silencing wheat 3-ketoacyl-CoA synthase 6 (KCS6) and enoyl-CoA reductase (ECR), crucial for VLCFA biosynthesis, weakens spore germination of B. graminis [48,49]. In our findings, PI 420145 possesses a thicker waxy cuticle layer, which likely functions as a physical barrier hindering conidial germination and penetration of S. cucurbitacearum. These findings align with previous observations in cereal crops, where similar structural traits correlated with enhanced disease resistance (Tables S5 and S6). Future research with precise quantification of wax composition across different time points and organs would further elucidate the role of waxes in GSB resistance.
Alongside the role of epicuticular waxes, cell wall composition, such as lignin, plays a crucial role in plant defense against fungal pathogens [50,51]. Lignin is a key structural component of the cell wall, composed of p-hydroxycinnamyl alcohols (monolignols), guaiacyl (G), and syringyl (S) units, serving in enhancing the mechanical strength, stiffness, and hydrophobic properties of plant cell walls [52]. When plants are infected by pathogens, an increase in lignin content in the cell wall forms a protective barrier, limiting pathogen spread and reducing the penetration of fungal enzymes and toxins into plant cells [50,51]. Previous studies showed that S. cucurbitacearum produces a variety of cell wall-degrading enzymes, including polygalacturonase (PG), pectate lyase (PNL), β-galactosidase (β-Gal), and pectin lyase (PL), which play a crucial role in the pathogenesis of S. cucurbitacearum in decaying cucurbit tissue [53,54,55]. In the present study, we found several enriched GO pathways related to cell wall biogenesis (GO:0009833, GO:0042546, GO:0071555, and GO:0010411) and specific lignin biosynthetic processes, including L-phenylalanine catabolic process (GO:0006559), cinnamic acid biosynthetic processes (GO:0009800), and glutathione metabolic processes (GO:0006749) (Figure 4a). Previous studies showed that the resistant melon accession PI 511890 showed inhibited conidial germination and hyphal growth of GSB pathogens, with lower lignin and flavonoids levels in the leaf cell wall compared to the susceptible inbred line ‘Payzawat’ post infection [56]. While we did not directly measure lignin and flavonoid levels in our study, the differential expression of genes involved in their biosynthesis suggests that these compounds may contribute to the enhanced resistance of PI 420145. This differential gene expression pattern may reflect distinct resistance mechanisms between PI 511089 and PI 420145, possibly involving specific features of their leaf surface structure [56]. Future studies including lignin and flavonoid quantification could provide more definitive correlations between lignin composition and resistance levels across genotypes.

4.2. lncRNA–mRNA Network for Post-Penetration Defense on PI 420145

Plants employ a multifaceted defense system to combat pathogen post-penetration, activating diverse defense mechanisms to strengthen immune response. Pathogen-induced disruption of the photosynthesis in infected leaves is a common phenomenon observed in susceptible plants [57], not only impacting energy production but also affecting immunity-related signaling pathways [58,59]. Consistent with this notion, our TEM imaging showed that the susceptible line ‘Baipicui’ displayed chloroplast disintegration, mitochondrial rounding, and cell rupture upon infection (2 dpi), while PI 420145 exhibited minimal ultrastructural alterations. These observations were corroborated by RNA-seq analysis, which revealed significant enrichment of DEGs related to photosynthesis, chloroplast function, chlorophyll biosynthetic processes and autophagy in the comparison of S0 vs. S2 and S2 vs. R2 (Figure 4a). We further constructed lncRNA–mRNA networks for S0 vs. S2. Interestingly, the majority of these genes are upregulated in ‘Baipicui’ compared to the control (S0 vs. S2), while the remaining were non-differentially expressed in PI 420145 (R0 vs. R2) (Table S3; Figure S5). The expression pattern of autophagy-related genes was reversed, with the activation of these genes in S0 vs. S2 potentially linked to significant changes in organelles following inoculation (Table S8; Figure S5). These findings implied that PI 420145’s structural integrity helps maintain photosynthetic activity during infection, which may indirectly support its defensive resilience.
In addition, GO and KEGG analysis revealed significant enrichment in PI 420145 of genes involved in plant defense response (GO:0006952), especially in the plant–pathogen interaction pathway and the MAPK signaling–plant pathway (Figure 4). In particular, the MAPK signaling–plant pathway plays a pivotal role in orchestrating plant immunity, which contained a number of upregulated DEGs including pathogenesis-related proteins (PR1) (MELO3C018539 and MELO3C018394), chitinase/ChiB (MELO3C003412, MELO3C007961 and MELO3C007962), and catalase/CAT1 (MELO3C026532 and MELO3C017023). These proteins are components of well-established resistance pathways across multiple crops. Specifically, chitinases can enhance the plant’s defense system by degrading chitin, a key component of the pathogenic fungal cell wall, rendering the fungi inactive with minimal impact on the plant [60]. Catalase, a robust reactive oxygen species (ROS)-scavenging enzyme plays a critical role in many biological processes, including biotic stress responses [61], and has been documented in Arabidopsis [62], wheat [63], cucumber [64], and sugarcane [65]. This collective upregulation of these DEGs implies an active role for the MAPK signaling pathway in reinforcing PI 420145’s resistance to S. cucurbitacearum.
lncRNAs have emerged as critical modulators in plant–pathogen interactions, often functioning by targeting transcription factors (TFs) involved in immunity. For instance, in Arabidopsis, the lncRNA SABC1 downregulates its adjacent gene NAC3, a NAC TF, thereby repressing immune responses in healthy plants [66,67]. Pathogen-induced changes in lncRNA expression can modulate defense mechanisms such as ROS production [28,68], calcium influx [69], and MAPK cascades [70]. In soybean, GmCDL1 positively regulates the soybean immune response and enhances resistance to soybean cyst nematode by activating the GmMPK3 and GmMPK6 signaling pathway through a positive feedback mechanism [71]. Similarly, in rcie, the OsMKK6–OsMPK4 signaling cascade is involved in regulating rice resistance to Magnaporthe oryzae, suggesting a conserved role of MAPK signaling in plant immunity [72]. In addition, lncRNAs can also regulate plant immunity by modulating the biosynthesis or signaling pathways of plant hormones, including ethylene (ET), jasmonic acid (JA), and SA [73]. For example, Sl-lncRNA47980 positively regulates tomato resistance to Phytophthora infestans by increasing JA levels and decreasing SA and gibberellin (GA) levels [74]. Previous studies have also shown that the regulation of SA and JA in melon after inoculation with S. cucurbitacearum differs between resistant and susceptible cultivars [15]. In this study, we identified 53 unique lncRNAs that co-localized and co-expressed with genes involved in plant–pathogen interactions, MAPK signaling pathways, and phenylpropanoid biosynthesis. These lncRNAs form a complex network with 38 lncRNA–mRNA targeted regulatory relationships (Figure 5; Table S7). The majority (21/38) of the lncRNA–mRNA targeted networks belong to one-to-one pairings, while a few DEGs were targeted by the same lncRNA, highlighting the intricate role of lncRNA in regulating immune responses in PI 420145 (Figure 5). Further experimental validation, such as RNA pull-down assays and other techniques, is necessary to confirm the identified lncRNA–mRNA interactions.
The findings of this study highlight the vital roles of structural integrity, MAPK signaling, and the lncRNA–mRNA network in the defense responses of PI 420145 against GSB. Future research could delve into these pathways to elucidate specific lncRNA–mRNA interactions and their contributions to plant immune responses. Integrating additional omics approaches, such as metabolomics and proteomics, could further illuminate resistance networks. Furthermore, the key genes and lncRNAs identified in our study can be validated using gene editing techniques and can be integrated into melon breeding programs to enhance plant immunity.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae11010031/s1, Figure S1: The content of epidermis wax post-inoculation with S. cucurbitacearum in ‘Baipicui’ (susceptible) and PI 420145 (resistant). The data are reported as the average values of three biological replicates (Mean ± SE). Asterisks represent significant differences for the content of epidermis wax using Student’s t test. (* p < 0.05, ** p < 0.01); Figure S2: The germination percentage of conidia (a) and length of hyphae (b) post-inoculation with S. cucurbitacearum in ‘Baipicui’ (susceptible) and PI 420145 (resistant). The data are reported as the average values of three biological replicates (Mean ± SE). Asterisks represent significant differences using Student’s t test. (* p < 0.05, ** p < 0.01); Figure S3: The gene expression profiles of 12 samples and qRT-PCR varification. (a) principal component analysis (PCA) showed the uniformity of 12 samples. (b) Pearson correlation coefficient analysis of gene expression levels among samples showed that the samples had a high consistency in one group. (c) The expression correlation of eight selected transcripts were compared between RNA-seq and qRT-PCR. Each dot represents a transcript, and gray is the 95% confidence interval. R0 and R2 represent the leaves sample collected from PI 420145 at 0 and 2 days post infection (dpi). S0 and S2 represent leaf sample collected from ‘Baipicui’ at 0 and 2 dpi; Figure S4: Heat map of expression of key DEGs involved in cuticle biosynthesis pathways; Figure S5: The gummy stem blight-associated lncRNA–mRNA regulatory network diagram in susceptible ‘Baipicui’. The square and round symbols represent differentially expressed gene (DEG) and differentially expressed lncRNA (DEL) in S0 vs. S2 comparison, respectively. S0 and S2 represent leaf samples collected from ‘Baipicui’ at 0 and 2 dpi, respectively; Table S1: Transcriptome sequencing of PI420145 (resistant) and ‘Baipicui’ (susceptible) at 0 and 2 day post infection (dpi) with Stagonosporopsis cucurbitacearum; Table S2: lncRNAs identified in this study; Table S3: Differentially expressed transcripts including differentially expressed genes (DEGs) and differentially expressed lncRNAs (DELs); Table S4: GO term enrichment for DEGs and DELs targeted mRNAs; Table S5: KEGG pathway enrichment for DEGs and DEL-target mRNAs; Table S6: lncRNA–mRNA network for five KEGG pathway in R0 vs. R2 comparison; Table S7: Differential expressed genes (DEGs) related to cuticle, cutin and wax biosynthetic process; Table S8: lncRNA–mRNA network for five KEGG pathway in S0 vs. S2 comparison; Table S9: The content of epidermis wax post-inoculation with S. cucurbitacearum in ‘Baipicui’ (susceptible) and PI 420145 (resistant).

Author Contributions

J.C. and R.Z. performed the majority of experiments. Y.Z., X.L., C.C., J.L. and Q.L. participated in data collection and data analysis. C.Q. conceived and supervised the study. Y.W., R.Z. and J.C. wrote the manuscripts with input from other co-authors. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Tianshan Talent Training Program (2023TSYCLJ0015); Key research and development task special project of Xinjiang (2022B02002); National modern agricultural industrial technology system project (Grant No. CARS-25-G2); Construction of national agricultural sustainable development experimental demonstration Zone (tzyjy202302); Science and technology of Suzhou city (SNG2022203); Fundamental Research Funds for the Central Universities (KJYQ202426); the Young Scientists Fund of the National Natural Science Foundation of China (32102391); the Open Research Fund of State Key Laboratory of Crop Genetics & Germplasm Enhancement and Utilization (ZW202306); and a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Data Availability Statement

The genome sequences of melon were downloaded from the Melon (DHL92) v4.0 Genome (http://cucurbitgenomics.org/v2/organism/23, accessed on 28 December 2024). All the RNA-seq reads have been deposited in the Sequence Read Archive (https://www.ncbi.nlm.nih.gov/sra, accessed on 28 December 2024) with the accession codes (BioProject ID: SRR13180975–SRR13180986). The seeds of susceptible material ‘Baipicui’ (S) were obtained from the Xinjiang Academy of Agricultural Sciences, and the resistant material PI 420145 (R) was collected from Japan, provided by The North Central Regional Center for Genetic resources Preservation, Iowa, and preserved in the Laboratory of Cucurbit Genetics and Germplasm Enhancement, Nanjing Agricultural University, both of which were selfed for multiple generations. Permission to collect these materials has been obtained.

Acknowledgments

The authors wish to thank the high-performance computing platforms at the Bioinformatics Center of Nanjing Agricultural University for supporting this project.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sitterly, W.R.; Keinath, A.P. Gummy Stem Blight Compendium of Cucurbit Disease. Available online: https://www.apsnet.org/edcenter/apsnetfeatures/Pages/GummyStemBlight.aspx (accessed on 28 December 2024).
  2. Wolukau, J.N.; Xiaohui, Z.; Jinfeng, C. Identification of amplified fragment length polymorphism markers linked to gummy stem blight (Didymella bryoniae) resistance in melon (Cucumis melo L.) PI 420145. Hortscience 2009, 44, 32–34. [Google Scholar] [CrossRef]
  3. Seblan, R.; Keinath, A.P.; Munkvold, G. Gummy stem blight: One disease, three pathogens. Mol. Plant Pathol. 2023, 24, 825–837. [Google Scholar] [CrossRef] [PubMed]
  4. Rennberger, G.; Keinath, A.P. Susceptibility of fourteen new cucurbit species to gummy stem blight caused by Stagonosporopsis citrulliunder field conditions. Plant Dis. 2018, 102, 1365–1375. [Google Scholar] [CrossRef] [PubMed]
  5. Virtuoso, M.C.S.; Valente, T.S.; Silva, E.H.C.; Braz, L.T.; Panizzi, R.d.C.; Vargas, P.F. Implications of the inoculation method and environment in the selection of melon genotypes resistant to Didymella bryoniae. Sci. Hortic. 2022, 300, 111066. [Google Scholar] [CrossRef]
  6. Garcia-Masa, J.; Benjaka, A.; Sanseverinoa, W.; Bourgeoisa, M.; Mira, G.; Gonzálezb, V.M.; Hénaffb, E.; Câmarac, F. The genome of melon (Cucumis melo L.). Proc. Natl. Acad. Sci. USA 2012, 109, 11872–11877. [Google Scholar] [CrossRef]
  7. Sowell, G. Additional sources of resistance to gummy stem blight of muskmelon. Plant Dis. 1981, 65, 253–254. [Google Scholar] [CrossRef]
  8. Sowell, G.; Prasad, J.K.; Norton, J.D. Resistance of cucumis melo introductions to Mycosphaerella citrullina. Plant Dis. Report. 1966, 50, 661–663. [Google Scholar]
  9. McGrath, D.J.; Vawdrey, L.; Walker, I.O. Resistance to gummy stem blight in muskmelon. HortScience 1993, 28, 930–931. [Google Scholar] [CrossRef]
  10. Zhang, Y.; Kyle, M.; Anagnostou, K.; Zitter, T.A. Screening melon (Cucumis melo) for resistance to gummy stem blight in the greenhouse and field. HortScience 1997, 32, 117–121. [Google Scholar] [CrossRef]
  11. Frantz, J.D.; Jahn, M.M. Five independent loci each control monogenic resistance to gummy stem blight in melon (Cucumis melo L.). Theor. Appl. Genet. 2004, 108, 1033–1038. [Google Scholar] [CrossRef]
  12. Wolukau, J.N.; Zhou, X.H.; Li, Y.; Zhang, Y.B.; Chen, J.F. Resistance to gummy stem blight in melon (Cucumis melo L.) germplasm and inheritance of resistance from plant introductions 157076,420145, and 323498. Hortscience 2007, 42, 215–221. [Google Scholar] [CrossRef]
  13. Ma, J.; Li, C.C.; Tian, J.X.; Qiu, Y.H.; Geng, L.H.; Wang, J.S. Identification and fine mapping of gummy stem blight resistance gene gsb-7(t) in melon. Phytopathology 2023, 113, 858–865. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, N.; Bi, Y.F.; Guo, J.; Xu, B.H.; Qian, C.T.; Chen, J.F. Changes of PAL, PPO, and POD activities in different resistant muskmelons inoculated with Mycosphaerella melonis. Plant Physiol. J. 2016, 52, 1169–1175. [Google Scholar]
  15. Lu, X.M.; Zhang, N.; Xia, M.L.; Qian, C.T.; Chen, J.F. Changes of endogenous hormone contents and expression analysis of related genes in melon with different resistance after inoculated with Didymella bryoniae. J. Nanjing Agric. Univ. 2018, 41, 248–255. [Google Scholar]
  16. Sarkar, A.; Roy-Barman, S. Spray-induced silencing of pathogenicity gene MoDES1 via exogenous double-stranded RNA can confer partial resistance against fungal blast in rice. Front. Plant Sci. 2021, 12, 733129. [Google Scholar] [CrossRef]
  17. Wang, L.; Xu, D.; Scharf, K.; Frank, W.; Leister, D.; Kleine, T. The RNA-binding protein RBP45D of arabidopsis promotes transgene silencing and flowering time. Plant J. 2021, 6, 1397–1407. [Google Scholar] [CrossRef]
  18. Liu, W.; Cui, J.; Luan, Y. Overexpression of lncRNA08489 enhances tomato immunity against Phytophthora infestans by decoying miR482e-3p. Biochem. Biophys. Res. Commun. 2022, 587, 36–41. [Google Scholar] [CrossRef]
  19. Ariel, F.; Jegu, T.; Latrasse, D.; Romero-Barrios, N.; Christ, A.; Benhamed, M.; Crespi, M. Noncoding transcription by alternative RNA polymerases dynamically regulates an auxin-driven chromatin loop. Mol. Cell 2014, 55, 383–396. [Google Scholar] [CrossRef]
  20. Tian, J.; Zhang, F.; Zhang, G.; Li, X.; Wen, C.; Li, H. A long noncoding rna functions in pumpkin fruit development through S-adenosyl-l-methionine synthetase. Plant Physiol. 2024, 195, 940–957. [Google Scholar] [CrossRef]
  21. Zhao, X.; Li, F.; Ali, M.; Li, X.; Fu, X.; Zhang, X. Emerging roles and mechanisms of lncRNAs in fruit and vegetables. Hortic. Res. 2024, 11, uhae046. [Google Scholar] [CrossRef]
  22. Zhang, C.; Ding, Z.; Wu, K.; Yang, L.; Li, Y.; Yang, Z.; Shi, S.; Liu, X.; Zhao, S.; Yang, Z.; et al. Suppression of jasmonic acid-mediated defense by viral-inducible microRNA319 facilitates virus infection in rice. Mol. Plant 2016, 9, 1302–1314. [Google Scholar] [CrossRef] [PubMed]
  23. Chen, H.; Li, J.; Qiu, B.; Zhao, Y.; Liu, Z.; Yang, J.; Kang, X. Long non-coding RNA and its regulatory network response to cold stress in Eucalyptus urophylla S.T.Blake. Forests 2021, 12, 836. [Google Scholar] [CrossRef]
  24. Das, P.; Grover, M.; Mishra, D.C.; Guha Majumdar, S.; Shree, B.; Kumar, S.; Mir, Z.A.; Chaturvedi, K.K.; Bhardwaj, S.C.; Singh, A.K.; et al. Genome-wide identification and characterization of Puccinia striiformis-responsive lncRNAs in Triticum aestivum. Front. Plant Sci. 2023, 14, 1120898. [Google Scholar] [CrossRef] [PubMed]
  25. Wierzbicki, A.T.; Blevins, T.; Swiezewski, S. Long noncoding RNAs in plants. Annu. Rev. Plant Biol. 2021, 72, 245–271. [Google Scholar] [CrossRef] [PubMed]
  26. Duan, X.X.; Song, X.S.; Wang, J.X.; Zhou, M.G. Genome-wide identification and characterization of Fusarium graminearum-responsive lncRNAs in Triticum aestivum. Genes 2020, 11, 1135. [Google Scholar] [CrossRef]
  27. Chen, D.; Zhang, Z.; Chen, Y.; Li, B.; Chen, T.; Tian, S. Transcriptional landscape of pathogen-responsive lncRNAs in tomato unveils the role of hydrolase encoding genes in response to Botrytis cinerea invasion. Plant Cell Environ. 2024, 47, 651–663. [Google Scholar] [CrossRef]
  28. Cui, J.; Luan, Y.S.; Jiang, N.; Bao, H.; Meng, J. Comparative transcriptome analysis between resistant and susceptible tomato allows the identification of lncRNA16397 conferring resistance to Phytophthora infestans by co-expressing glutaredoxin. Plant J. 2017, 89, 577–589. [Google Scholar] [CrossRef]
  29. Zhou, X.; Cui, J.; Cui, H.; Jiang, N.; Hou, X.; Liu, S.; Gao, P.; Luan, Y.; Meng, J.; Luan, F. Identification of lncRNAs and their regulatory relationships with target genes and corresponding miRNAs in melon response to powdery mildew fungi. Gene 2020, 735, 144403. [Google Scholar] [CrossRef]
  30. Gao, C.; Sun, J.; Dong, Y.; Wang, C.; Xiao, S.; Mo, L.; Jiao, Z. Comparative transcriptome analysis uncovers regulatory roles of long non-coding rnas involved in resistance to powdery mildew in melon. BMC Genom. 2020, 21, 125. [Google Scholar] [CrossRef]
  31. Islam, M.R.; Hossain, M.R.; Kim, H.-T.; Nath, U.K.; Abuyusuf, M.; Jung, H.-J.; Park, J.-I.; Nou, I.-S. Molecular characterization of Acidovorax citrulli strain NIHHS1515-280 causing bacterial fruit blotch disease in korea and screening of resistance sources in melon. Hortic. Environ. Biotechnol. 2019, 61, 115–126. [Google Scholar] [CrossRef]
  32. Kang, Z.; Buchenauer, H. Ultrastructural and cytochemical studies on the infection of wheat spikes by Fusarium culmorum as well as on degradation of cell wall components and localization of mycotoxins in the host tissue. Mycol. Res. 2000, 104, 1083–1093. [Google Scholar] [CrossRef]
  33. Russin, J.S.; Guo, B.Z.; Tubajika, K.M.; Brown, R.L.; Cleveland, T.E.; Widstrom, N.W. Comparison of kernel wax from corn genotypes resistant or susceptible to Aspergillus flavus. Phytopathol. 1997, 87, 529–533. [Google Scholar] [CrossRef] [PubMed]
  34. Guttman, M.; Garber, M.; Levin, J.Z.; Donaghey, J.; Robinson, J.; Adiconis, X.; Fan, L.; Koziol, M.J.; Gnirke, A.; Nusbaum, C.; et al. Ab initio reconstruction of cell type-specific transcriptomes in mouse reveals the conserved multi exonic structure of lincRNAs. Nat. Biotechnol. 2010, 28, 503–510. [Google Scholar] [CrossRef] [PubMed]
  35. Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; Baren, M.J.V.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
  36. Kong, L.; Zhang, Y.; Ye, Z.Q.; Liu, X.Q.; Zhao, S.Q.; Wei, L.P.; Gao, G. CPC: Assess the protein-coding potential of transcripts using sequence features and support vector machine. Nucleic Acids Res. 2007, 35, W345–W349. [Google Scholar] [CrossRef]
  37. Sun, L.; Luo, H.T.; Bu, D.C.; Zhao, G.G.; Yu, K.T.; Zhang, C.H.; Liu, Y.N.; Chen, R.S.; Zhao, Y. Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 2013, 41, e166. [Google Scholar] [CrossRef]
  38. Zdobnov, E.M.; Apweiler, R. Interproscan-an integration platform for the signature-recognition methods in interPro. Bioinformatics 2001, 17, 847–848. [Google Scholar] [CrossRef]
  39. Lin, M.F.; Jungreis, I.; Kellis, M. Phylocsf: A comparative genomics method to distinguish protein coding and non-coding regions. Bioinformatics 2011, 27, i275–i282. [Google Scholar] [CrossRef]
  40. Yu, G.C.; Wang, L.G.; Han, Y.Y.; He, Q.Y. Clusterprofiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
  41. Wang, H.M.; Chu, Z.L.; Chang, S.; Jia, S.H.; Pang, L.; Xi, C.; Liu, J.; Zhao, H.P.; Wang, Y.D.; Han, S.C. Transcriptomic identification of long noncoding RNAs and their hormone-associated nearby coding genes involved in the differential development of caryopses localized on different branches in rice. J. Plant Physiol. 2022, 271, 153663. [Google Scholar] [CrossRef]
  42. Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
  43. Steve, H.; Langfelder, P. Tutorials for the WGCNA Package for R: WGCNA Background and Glossary. 2011. Available online: https://www.rdocumentation.org/ (accessed on 28 December 2024).
  44. Ziv, C.; Zhao, Z.Z.; Gao, Y.G.; Xia, Y. Multifunctional roles of plant cuticle during plant-pathogen interactions. Front. Plant Sci. 2018, 9, 1088. [Google Scholar] [CrossRef] [PubMed]
  45. Kunst, L.; Samuels, L. Plant cuticles shine: Advances in wax biosynthesis and export. Curr. Opin. Plant Biol. 2009, 12, 721–727. [Google Scholar] [CrossRef] [PubMed]
  46. Arya, G.C.; Sarkar, S.; Manasherova, E.; Aharoni, A.; Cohen, H. The plant cuticle: An ancient guardian barrier set against long-standing rivals. Front. Plant Sci. 2021, 12, 663165. [Google Scholar] [CrossRef]
  47. Hansjakob, A.; Riederer, M.; Hildebrandt, U. Wax matters: Absence of very-long-chain aldehydes from the leaf cuticular wax of the glossy11 mutant of maize compromises the prepenetration processes of Blumeria graminis. Plant Pathol. 2011, 60, 1151–1161. [Google Scholar] [CrossRef]
  48. Wang, X.Y.; Zhi, P.; Fan, Q.X.; Zhang, M.; Chang, C. Wheat CHD3 protein TaCHR729 regulates the cuticular wax biosynthesis required for stimulating germination of Blumeria graminis F. Sp. Tritici. J. Exp. Bot. 2019, 70, 701–713. [Google Scholar] [CrossRef]
  49. Kong, L.Y.; Zhi, P.F.; Liu, J.; Li, H.Y.; Zhang, X.N.; Xu, J.; Zhou, J.Q.; Wang, X.; Chang, C. Epigenetic activation of Enoyl-coa reductase by an acetyltransferase complex triggers wheat wax biosynthesis. Plant Physiol. 2020, 183, 1250–1267. [Google Scholar] [CrossRef]
  50. Liu, Q.; Luo, L.; Zheng, L. Lignins: Biosynthesis and biological functions in plants. Int. J. Mol. Sci. 2018, 19, 335. [Google Scholar] [CrossRef]
  51. Miedes, E.; Vanholme, R.; Boerjan, W.; Molina, A. The role of the secondary cell wall in plant resistance to pathogens. Front. Plant Sci. 2014, 5, 358. [Google Scholar] [CrossRef]
  52. Tobimatsu, Y.; Schuetz, M. Lignin polymerization: How do plants manage the chemistry so well? Curr. Opin. Biotechnol. 2019, 56, 75–81. [Google Scholar] [CrossRef]
  53. Zhang, J.; Bruton, B.D.; Biles, C.L. Cell wall-degrading enzymes of Didymella bryoniae in relation to fungal growth and virulence in cantaloupe fruit. Eur. J. Plant Pathol. 2014, 139, 749–761. [Google Scholar] [CrossRef] [PubMed]
  54. Chilosi, M.; Magro. Pectolytic enzymes produced in vitro and during colonization of melon tissues by Didymella bryoniae. Plant Pathol. 2002, 47, 700–705. [Google Scholar] [CrossRef]
  55. Curren, T. Pectic and cellulolytic enzymes produced by Mycosphaerella citrullina and their relation to black rot of squash. Can. J. Bot. 1969, 47, 791–794. [Google Scholar] [CrossRef]
  56. Wang, H.; Wei, X.; Mo, C.; Wei, M.; Li, Y.; Fan, Y.; Gu, X.; Zhang, X.; Zhang, Y.; Kong, Q. Integrated full-length transcriptome and metabolome analysis reveals the defence response of melon to gummy stem blight. Plant Cell Environ. 2024, 47, 1997–2010. [Google Scholar] [CrossRef] [PubMed]
  57. Walters, D.R. Physiological Responses of Plantsto Attack; Springer: Berlin/Heidelberg, Germany, 2015; pp. 41–87. [Google Scholar]
  58. Serrano, I.; Audran, C.; Rivas, S. Chloroplasts at work during plant innate immunity. J. Exp. Bot. 2016, 67, 3845–3854. [Google Scholar] [CrossRef]
  59. Yang, H.; Luo, P.G. Changes in photosynthesis could provide important insight into the interaction between wheat and fungal pathogens. Int. J. Mol. Sci. 2021, 22, 8865. [Google Scholar] [CrossRef]
  60. Kumar, M.; Brar, A.; Yadav, M.; Chawade, A.; Vivekanand, V.; Pareek, N. Chitinases-potential candidates for enhanced plant resistance towards fungal pathogens. Agriculture 2018, 8, 88. [Google Scholar] [CrossRef]
  61. Raza, A.; Su, W.; Gao, A.; Mehmood, S.S.; Hussain, M.A.; Nie, W.; Lv, Y.; Zou, X.; Zhang, X. Catalase (CAT) gene family in rapeseed (Brassica napus L.): Genome-wide analysis, identification, and expression pattern in response to multiple hormones and abiotic stress conditions. Int. J. Mol. Sci. 2021, 22, 4281. [Google Scholar] [CrossRef]
  62. Corpas, F.J.; Barroso, J.B.; González-Gordo, S.; Muñoz-Vargas, M.A.; Palma, J.M. Hydrogen sulfide: A novel component in arabidopsis peroxisomes which triggers catalase inhibition. J. Integr. Plant Biol. 2019, 61, 871–883. [Google Scholar] [CrossRef]
  63. Zhang, Y.; Zheng, L.J.; Yun, L.; Ji, L.; Li, G.H.; Ji, M.C.; Shi, Y.; Zheng, X. Catalase (CAT) gene family in wheat (Triticum aestivum L.): Evolution, expression pattern and function analysis. Int. J. Mol. Sci. 2022, 23, 542. [Google Scholar] [CrossRef]
  64. Zhou, Y.; Liu, S.Q.; Yang, Z.J.; Yang, Y.G.; Jiang, L.W.; Hu, L.F. CsCAT3, a catalase gene from Cucumis sativus, confers resistance to a variety of stresses to Escherichia coli. Biotechnol. Biotec Eq 2017, 31, 886–896. [Google Scholar] [CrossRef]
  65. Wu, Q.B.; Chen, Y.L.; Zou, W.H.; Pan, Y.B.; Lin, P.X.; Xu, L.P.; Grisham, M.P.; Ding, Q.; Su, Y.; Que, Y. Genome-wide characterization of sugarcane catalase gene family identifies a ScCAT1 gene associated disease resistance. Int. J. Biol. Macromol. 2023, 232, 123398. [Google Scholar] [CrossRef] [PubMed]
  66. Huang, J.; Zhou, W.L.; Zhang, X.M.; Li, Y. Roles of long non-coding rnas in plant immunity. PLoS Pathog. 2023, 19, e1011340. [Google Scholar] [CrossRef] [PubMed]
  67. Liu, N.; Xu, Y.; Li, Q.; Cao, Y.; Yang, D.; Liu, S.; Wang, X.; Mi, Y.; Liu, Y.; Ding, C.; et al. A lncRNA fine-tunes salicylic acid biosynthesis to balance plant immunity and growth. Cell Host Microbe 2022, 30, 1124–1138.e1128. [Google Scholar] [CrossRef] [PubMed]
  68. Cui, J.; Jiang, N.; Meng, J.; Yang, G.L.; Liu, W.W.; Zhou, X.X.; Ma, N.; Hou, X.; Luan, Y. LncRNA33732 respiratory burst oxidase module associated with wrky1 in tomato-phytophthora infestans interactions. Plant J. 2018, 97, 933–946. [Google Scholar] [CrossRef]
  69. Xu, G.Y.; Moeder, W.; Yoshioka, K.; Shan, L. A tale of many families: Calcium channels in plant immunity. Plant Cell 2022, 34, 1551–1567. [Google Scholar] [CrossRef]
  70. Tang, D.Z.; Wang, G.X.; Zhou, J.M. Receptor kinases in plant-pathogen interactions: More than pattern recognition. Plant Cell 2017, 29, 618–637. [Google Scholar] [CrossRef]
  71. Zhang, L.; Zhu, Q.; Tan, Y.; Deng, M.; Zhang, L.; Cao, Y.; Guo, X. Mitogen-activated protein kinases MPK3 and MPK6 phosphorylate receptor-like cytoplasmic kinase CDL1 to regulate soybean basal immunity. Plant Cell 2024, 36, 963–986. [Google Scholar] [CrossRef]
  72. Jiang, R.; Zhou, S.; Da, X.; Yan, P.; Wang, K.; Xu, J.; Mo, X. OsMKK6 regulates disease resistance in rice. Int. J. Mol. Sci. 2023, 24, 12678. [Google Scholar] [CrossRef]
  73. Song, L.; Fang, Y.; Chen, L.; Wang, J.; Chen, X. Role of non-coding RNAs in plant immunity. Plant Commun. 2021, 2, 100180. [Google Scholar] [CrossRef]
  74. Su, C.; Wang, Z.; Cui, J.; Wang, Z.; Wang, R.; Meng, J.; Luan, Y. Sl-lncRNA47980, a positive regulator affects tomato resistance to Phytophthora infestans. Int. J. Biol. Macromol. 2023, 248, 125824. [Google Scholar] [CrossRef]
Figure 1. Phenotypes of PI 420145 (resistant) and ‘Baipicui’ (susceptible) lines inoculated with Stagonosporopsis cucurbitacearum. Typical symptoms on seedling (a) leaves (b), stems (c), and fruit (d) of PI 420145 (left) and ‘Baipicui’ (right) post infection.
Figure 1. Phenotypes of PI 420145 (resistant) and ‘Baipicui’ (susceptible) lines inoculated with Stagonosporopsis cucurbitacearum. Typical symptoms on seedling (a) leaves (b), stems (c), and fruit (d) of PI 420145 (left) and ‘Baipicui’ (right) post infection.
Horticulturae 11 00031 g001
Figure 2. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) of leaves of PI420145 (resistant) and ‘Baipicui’ (susceptible) after inoculation with Stagonosporopsis cucurbitacearum. (a) Germination of conidia and hyphal growth on the surface of leaves examined by SEM. (b) Ultrastructural changes in host cell post-inoculation examined by TEM. Wl—wax layer, Sp—spore germination, Hy—hypha, Ch—chloroplast, Mi—mitochondria, St—stroma, Sg—starch granule, Mp—membranous proliferation, Ob—osmiophilic bodies.
Figure 2. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) of leaves of PI420145 (resistant) and ‘Baipicui’ (susceptible) after inoculation with Stagonosporopsis cucurbitacearum. (a) Germination of conidia and hyphal growth on the surface of leaves examined by SEM. (b) Ultrastructural changes in host cell post-inoculation examined by TEM. Wl—wax layer, Sp—spore germination, Hy—hypha, Ch—chloroplast, Mi—mitochondria, St—stroma, Sg—starch granule, Mp—membranous proliferation, Ob—osmiophilic bodies.
Horticulturae 11 00031 g002
Figure 3. Features of transcripts and identification analysis of differentially expressed genes (DEGs) and differentially expressed lncRNAs (DELs) in melon. (a) Location sketch of genes and transcripts on the melon chromosome according to DHL92 v4.0 draft genome. (b) Classification of lncRNA and comparison of length, exon number, and ORF length between lncRNAs and mRNAs. (c,d) Upset plot of DEGs (c) and DELs (d) among four comparisons. R0 and R2 represent the leaf samples collected from PI 420145 (resistant) at 0 and 2 days post infection (dpi) with Stagonosporopsis cucurbitacearum. S0 and S2 represent leaf samples collected from ‘Baipicui’ (susceptible) at 0 and 2 dpi.
Figure 3. Features of transcripts and identification analysis of differentially expressed genes (DEGs) and differentially expressed lncRNAs (DELs) in melon. (a) Location sketch of genes and transcripts on the melon chromosome according to DHL92 v4.0 draft genome. (b) Classification of lncRNA and comparison of length, exon number, and ORF length between lncRNAs and mRNAs. (c,d) Upset plot of DEGs (c) and DELs (d) among four comparisons. R0 and R2 represent the leaf samples collected from PI 420145 (resistant) at 0 and 2 days post infection (dpi) with Stagonosporopsis cucurbitacearum. S0 and S2 represent leaf samples collected from ‘Baipicui’ (susceptible) at 0 and 2 dpi.
Horticulturae 11 00031 g003
Figure 4. GO and KEGG enrichment in PI 420145 (resistant) and ‘Baipicui’ (susceptible) after inoculation with Stagonosporopsis cucurbitacearum. (a,b) GO terms enriched for DEGs (a) and the DEL-target mRNA (b). (c,d) KEGG pathway enriched for DEGs (c) and the DEL-target mRNA (d). R0 and R2 represent the leaf samples collected from PI 420145 at 0 and 2 days post infection (dpi), respectively. S0 and S2 represent leaf samples collected from ‘Baipicui’ at 0 and 2 dpi, respectively.
Figure 4. GO and KEGG enrichment in PI 420145 (resistant) and ‘Baipicui’ (susceptible) after inoculation with Stagonosporopsis cucurbitacearum. (a,b) GO terms enriched for DEGs (a) and the DEL-target mRNA (b). (c,d) KEGG pathway enriched for DEGs (c) and the DEL-target mRNA (d). R0 and R2 represent the leaf samples collected from PI 420145 at 0 and 2 days post infection (dpi), respectively. S0 and S2 represent leaf samples collected from ‘Baipicui’ at 0 and 2 dpi, respectively.
Horticulturae 11 00031 g004
Figure 5. The gummy stem blight resistance-associated lncRNA–mRNA regulatory network diagram in resistant melon PI 420145. The square and round symbol represent differentially expressed genes (DEGs) and differentially expressed lncRNAs (DELs) in the R0 vs. R2 comparison, respectively.
Figure 5. The gummy stem blight resistance-associated lncRNA–mRNA regulatory network diagram in resistant melon PI 420145. The square and round symbol represent differentially expressed genes (DEGs) and differentially expressed lncRNAs (DELs) in the R0 vs. R2 comparison, respectively.
Horticulturae 11 00031 g005
Table 1. Primers and sequences of qRT-PCR used in the present study.
Table 1. Primers and sequences of qRT-PCR used in the present study.
TypeNameForward Primers (5′→3′)Reverse Primers (5′→3′)
Geneβ-Actin (MELO3C008032)GTGATGGTGTGAGTCACACTGTTGGCAGTGGTGGTGAACATG
MELO3C032345TGTGTTCACTTTTGGTGTTGGGTTTCCCTATTTCGTCTCTGC
MELO3C011422TACAATGAGAACTGGCGGAATTGAGACAATGCTTGGATACGA
MELO3C007037ATGTCGTTGCTCAGCCTTCGCTCGGTAGAGCCTCCACCATCA
MELO3C003295CTTCCTGTGCCACCCTAACTACAAGCCAACGACTCCAT
LncRNALNC_000022TACCTCGCTTCTTGTCCTTTCACCCTATTTCGCTTACTC
LNC_000031ATAGAGACTTTGGGGATTCACTTCACGACCTTCCAGATTG
LNC_000147AACTGAAGTGGTTTAGATGGCTCTTTATTGAGTTTGGCAT
LNC_000381ACTCAAACAACACAGACGAGAAAAACGGTGAAGGCATA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, R.; Chen, J.; Zhang, Y.; Lu, X.; Cheng, C.; Li, J.; Lou, Q.; Wang, Y.; Qian, C. Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145. Horticulturae 2025, 11, 31. https://doi.org/10.3390/horticulturae11010031

AMA Style

Zhang R, Chen J, Zhang Y, Lu X, Cheng C, Li J, Lou Q, Wang Y, Qian C. Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145. Horticulturae. 2025; 11(1):31. https://doi.org/10.3390/horticulturae11010031

Chicago/Turabian Style

Zhang, Rui, Jing Chen, Yongbing Zhang, Xiumei Lu, Chunyan Cheng, Ji Li, Qunfeng Lou, Yuhui Wang, and Chuntao Qian. 2025. "Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145" Horticulturae 11, no. 1: 31. https://doi.org/10.3390/horticulturae11010031

APA Style

Zhang, R., Chen, J., Zhang, Y., Lu, X., Cheng, C., Li, J., Lou, Q., Wang, Y., & Qian, C. (2025). Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145. Horticulturae, 11(1), 31. https://doi.org/10.3390/horticulturae11010031

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop