Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Growth and Pathogen Inoculation
2.2. Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM)
2.3. Determination of Wax Content in Melon Leaves
2.4. RNA-Seq
2.5. lncRNA Identification
2.6. Identification of Differentially and Specific Expressed mRNA and lncRNA
2.7. Pathway Enrichment Analysis
2.8. Construction of lncRNA–mRNA-Network
2.9. qRT-PCR Validation
3. Results
3.1. Response of PI 420145 and ’Baipicui’ to GSB
3.2. Ultrastructural Changes in Inoculated Leaves
3.3. RNA Sequencing
3.4. Identification of Differential Expressed Transcripts
3.5. Function Analysis of DEGs and the Target Genes of DELs
3.6. Construction of lncRNA–mRNA Network Based on KEGG Results
4. Discussion
4.1. Epicuticular Waxes and Cell Wall Lignin for Pre-Penetration Defense Hosted by PI 420145
4.2. lncRNA–mRNA Network for Post-Penetration Defense on PI 420145
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sitterly, W.R.; Keinath, A.P. Gummy Stem Blight Compendium of Cucurbit Disease. Available online: https://www.apsnet.org/edcenter/apsnetfeatures/Pages/GummyStemBlight.aspx (accessed on 28 December 2024).
- Wolukau, J.N.; Xiaohui, Z.; Jinfeng, C. Identification of amplified fragment length polymorphism markers linked to gummy stem blight (Didymella bryoniae) resistance in melon (Cucumis melo L.) PI 420145. Hortscience 2009, 44, 32–34. [Google Scholar] [CrossRef]
- Seblan, R.; Keinath, A.P.; Munkvold, G. Gummy stem blight: One disease, three pathogens. Mol. Plant Pathol. 2023, 24, 825–837. [Google Scholar] [CrossRef] [PubMed]
- Rennberger, G.; Keinath, A.P. Susceptibility of fourteen new cucurbit species to gummy stem blight caused by Stagonosporopsis citrulliunder field conditions. Plant Dis. 2018, 102, 1365–1375. [Google Scholar] [CrossRef] [PubMed]
- Virtuoso, M.C.S.; Valente, T.S.; Silva, E.H.C.; Braz, L.T.; Panizzi, R.d.C.; Vargas, P.F. Implications of the inoculation method and environment in the selection of melon genotypes resistant to Didymella bryoniae. Sci. Hortic. 2022, 300, 111066. [Google Scholar] [CrossRef]
- Garcia-Masa, J.; Benjaka, A.; Sanseverinoa, W.; Bourgeoisa, M.; Mira, G.; Gonzálezb, V.M.; Hénaffb, E.; Câmarac, F. The genome of melon (Cucumis melo L.). Proc. Natl. Acad. Sci. USA 2012, 109, 11872–11877. [Google Scholar] [CrossRef]
- Sowell, G. Additional sources of resistance to gummy stem blight of muskmelon. Plant Dis. 1981, 65, 253–254. [Google Scholar] [CrossRef]
- Sowell, G.; Prasad, J.K.; Norton, J.D. Resistance of cucumis melo introductions to Mycosphaerella citrullina. Plant Dis. Report. 1966, 50, 661–663. [Google Scholar]
- McGrath, D.J.; Vawdrey, L.; Walker, I.O. Resistance to gummy stem blight in muskmelon. HortScience 1993, 28, 930–931. [Google Scholar] [CrossRef]
- Zhang, Y.; Kyle, M.; Anagnostou, K.; Zitter, T.A. Screening melon (Cucumis melo) for resistance to gummy stem blight in the greenhouse and field. HortScience 1997, 32, 117–121. [Google Scholar] [CrossRef]
- Frantz, J.D.; Jahn, M.M. Five independent loci each control monogenic resistance to gummy stem blight in melon (Cucumis melo L.). Theor. Appl. Genet. 2004, 108, 1033–1038. [Google Scholar] [CrossRef]
- Wolukau, J.N.; Zhou, X.H.; Li, Y.; Zhang, Y.B.; Chen, J.F. Resistance to gummy stem blight in melon (Cucumis melo L.) germplasm and inheritance of resistance from plant introductions 157076,420145, and 323498. Hortscience 2007, 42, 215–221. [Google Scholar] [CrossRef]
- Ma, J.; Li, C.C.; Tian, J.X.; Qiu, Y.H.; Geng, L.H.; Wang, J.S. Identification and fine mapping of gummy stem blight resistance gene gsb-7(t) in melon. Phytopathology 2023, 113, 858–865. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Bi, Y.F.; Guo, J.; Xu, B.H.; Qian, C.T.; Chen, J.F. Changes of PAL, PPO, and POD activities in different resistant muskmelons inoculated with Mycosphaerella melonis. Plant Physiol. J. 2016, 52, 1169–1175. [Google Scholar]
- Lu, X.M.; Zhang, N.; Xia, M.L.; Qian, C.T.; Chen, J.F. Changes of endogenous hormone contents and expression analysis of related genes in melon with different resistance after inoculated with Didymella bryoniae. J. Nanjing Agric. Univ. 2018, 41, 248–255. [Google Scholar]
- Sarkar, A.; Roy-Barman, S. Spray-induced silencing of pathogenicity gene MoDES1 via exogenous double-stranded RNA can confer partial resistance against fungal blast in rice. Front. Plant Sci. 2021, 12, 733129. [Google Scholar] [CrossRef]
- Wang, L.; Xu, D.; Scharf, K.; Frank, W.; Leister, D.; Kleine, T. The RNA-binding protein RBP45D of arabidopsis promotes transgene silencing and flowering time. Plant J. 2021, 6, 1397–1407. [Google Scholar] [CrossRef]
- Liu, W.; Cui, J.; Luan, Y. Overexpression of lncRNA08489 enhances tomato immunity against Phytophthora infestans by decoying miR482e-3p. Biochem. Biophys. Res. Commun. 2022, 587, 36–41. [Google Scholar] [CrossRef]
- Ariel, F.; Jegu, T.; Latrasse, D.; Romero-Barrios, N.; Christ, A.; Benhamed, M.; Crespi, M. Noncoding transcription by alternative RNA polymerases dynamically regulates an auxin-driven chromatin loop. Mol. Cell 2014, 55, 383–396. [Google Scholar] [CrossRef]
- Tian, J.; Zhang, F.; Zhang, G.; Li, X.; Wen, C.; Li, H. A long noncoding rna functions in pumpkin fruit development through S-adenosyl-l-methionine synthetase. Plant Physiol. 2024, 195, 940–957. [Google Scholar] [CrossRef]
- Zhao, X.; Li, F.; Ali, M.; Li, X.; Fu, X.; Zhang, X. Emerging roles and mechanisms of lncRNAs in fruit and vegetables. Hortic. Res. 2024, 11, uhae046. [Google Scholar] [CrossRef]
- Zhang, C.; Ding, Z.; Wu, K.; Yang, L.; Li, Y.; Yang, Z.; Shi, S.; Liu, X.; Zhao, S.; Yang, Z.; et al. Suppression of jasmonic acid-mediated defense by viral-inducible microRNA319 facilitates virus infection in rice. Mol. Plant 2016, 9, 1302–1314. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Li, J.; Qiu, B.; Zhao, Y.; Liu, Z.; Yang, J.; Kang, X. Long non-coding RNA and its regulatory network response to cold stress in Eucalyptus urophylla S.T.Blake. Forests 2021, 12, 836. [Google Scholar] [CrossRef]
- Das, P.; Grover, M.; Mishra, D.C.; Guha Majumdar, S.; Shree, B.; Kumar, S.; Mir, Z.A.; Chaturvedi, K.K.; Bhardwaj, S.C.; Singh, A.K.; et al. Genome-wide identification and characterization of Puccinia striiformis-responsive lncRNAs in Triticum aestivum. Front. Plant Sci. 2023, 14, 1120898. [Google Scholar] [CrossRef] [PubMed]
- Wierzbicki, A.T.; Blevins, T.; Swiezewski, S. Long noncoding RNAs in plants. Annu. Rev. Plant Biol. 2021, 72, 245–271. [Google Scholar] [CrossRef] [PubMed]
- Duan, X.X.; Song, X.S.; Wang, J.X.; Zhou, M.G. Genome-wide identification and characterization of Fusarium graminearum-responsive lncRNAs in Triticum aestivum. Genes 2020, 11, 1135. [Google Scholar] [CrossRef]
- Chen, D.; Zhang, Z.; Chen, Y.; Li, B.; Chen, T.; Tian, S. Transcriptional landscape of pathogen-responsive lncRNAs in tomato unveils the role of hydrolase encoding genes in response to Botrytis cinerea invasion. Plant Cell Environ. 2024, 47, 651–663. [Google Scholar] [CrossRef]
- Cui, J.; Luan, Y.S.; Jiang, N.; Bao, H.; Meng, J. Comparative transcriptome analysis between resistant and susceptible tomato allows the identification of lncRNA16397 conferring resistance to Phytophthora infestans by co-expressing glutaredoxin. Plant J. 2017, 89, 577–589. [Google Scholar] [CrossRef]
- Zhou, X.; Cui, J.; Cui, H.; Jiang, N.; Hou, X.; Liu, S.; Gao, P.; Luan, Y.; Meng, J.; Luan, F. Identification of lncRNAs and their regulatory relationships with target genes and corresponding miRNAs in melon response to powdery mildew fungi. Gene 2020, 735, 144403. [Google Scholar] [CrossRef]
- Gao, C.; Sun, J.; Dong, Y.; Wang, C.; Xiao, S.; Mo, L.; Jiao, Z. Comparative transcriptome analysis uncovers regulatory roles of long non-coding rnas involved in resistance to powdery mildew in melon. BMC Genom. 2020, 21, 125. [Google Scholar] [CrossRef]
- Islam, M.R.; Hossain, M.R.; Kim, H.-T.; Nath, U.K.; Abuyusuf, M.; Jung, H.-J.; Park, J.-I.; Nou, I.-S. Molecular characterization of Acidovorax citrulli strain NIHHS1515-280 causing bacterial fruit blotch disease in korea and screening of resistance sources in melon. Hortic. Environ. Biotechnol. 2019, 61, 115–126. [Google Scholar] [CrossRef]
- Kang, Z.; Buchenauer, H. Ultrastructural and cytochemical studies on the infection of wheat spikes by Fusarium culmorum as well as on degradation of cell wall components and localization of mycotoxins in the host tissue. Mycol. Res. 2000, 104, 1083–1093. [Google Scholar] [CrossRef]
- Russin, J.S.; Guo, B.Z.; Tubajika, K.M.; Brown, R.L.; Cleveland, T.E.; Widstrom, N.W. Comparison of kernel wax from corn genotypes resistant or susceptible to Aspergillus flavus. Phytopathol. 1997, 87, 529–533. [Google Scholar] [CrossRef] [PubMed]
- Guttman, M.; Garber, M.; Levin, J.Z.; Donaghey, J.; Robinson, J.; Adiconis, X.; Fan, L.; Koziol, M.J.; Gnirke, A.; Nusbaum, C.; et al. Ab initio reconstruction of cell type-specific transcriptomes in mouse reveals the conserved multi exonic structure of lincRNAs. Nat. Biotechnol. 2010, 28, 503–510. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; Baren, M.J.V.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
- Kong, L.; Zhang, Y.; Ye, Z.Q.; Liu, X.Q.; Zhao, S.Q.; Wei, L.P.; Gao, G. CPC: Assess the protein-coding potential of transcripts using sequence features and support vector machine. Nucleic Acids Res. 2007, 35, W345–W349. [Google Scholar] [CrossRef]
- Sun, L.; Luo, H.T.; Bu, D.C.; Zhao, G.G.; Yu, K.T.; Zhang, C.H.; Liu, Y.N.; Chen, R.S.; Zhao, Y. Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 2013, 41, e166. [Google Scholar] [CrossRef]
- Zdobnov, E.M.; Apweiler, R. Interproscan-an integration platform for the signature-recognition methods in interPro. Bioinformatics 2001, 17, 847–848. [Google Scholar] [CrossRef]
- Lin, M.F.; Jungreis, I.; Kellis, M. Phylocsf: A comparative genomics method to distinguish protein coding and non-coding regions. Bioinformatics 2011, 27, i275–i282. [Google Scholar] [CrossRef]
- Yu, G.C.; Wang, L.G.; Han, Y.Y.; He, Q.Y. Clusterprofiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Wang, H.M.; Chu, Z.L.; Chang, S.; Jia, S.H.; Pang, L.; Xi, C.; Liu, J.; Zhao, H.P.; Wang, Y.D.; Han, S.C. Transcriptomic identification of long noncoding RNAs and their hormone-associated nearby coding genes involved in the differential development of caryopses localized on different branches in rice. J. Plant Physiol. 2022, 271, 153663. [Google Scholar] [CrossRef]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
- Steve, H.; Langfelder, P. Tutorials for the WGCNA Package for R: WGCNA Background and Glossary. 2011. Available online: https://www.rdocumentation.org/ (accessed on 28 December 2024).
- Ziv, C.; Zhao, Z.Z.; Gao, Y.G.; Xia, Y. Multifunctional roles of plant cuticle during plant-pathogen interactions. Front. Plant Sci. 2018, 9, 1088. [Google Scholar] [CrossRef] [PubMed]
- Kunst, L.; Samuels, L. Plant cuticles shine: Advances in wax biosynthesis and export. Curr. Opin. Plant Biol. 2009, 12, 721–727. [Google Scholar] [CrossRef] [PubMed]
- Arya, G.C.; Sarkar, S.; Manasherova, E.; Aharoni, A.; Cohen, H. The plant cuticle: An ancient guardian barrier set against long-standing rivals. Front. Plant Sci. 2021, 12, 663165. [Google Scholar] [CrossRef]
- Hansjakob, A.; Riederer, M.; Hildebrandt, U. Wax matters: Absence of very-long-chain aldehydes from the leaf cuticular wax of the glossy11 mutant of maize compromises the prepenetration processes of Blumeria graminis. Plant Pathol. 2011, 60, 1151–1161. [Google Scholar] [CrossRef]
- Wang, X.Y.; Zhi, P.; Fan, Q.X.; Zhang, M.; Chang, C. Wheat CHD3 protein TaCHR729 regulates the cuticular wax biosynthesis required for stimulating germination of Blumeria graminis F. Sp. Tritici. J. Exp. Bot. 2019, 70, 701–713. [Google Scholar] [CrossRef]
- Kong, L.Y.; Zhi, P.F.; Liu, J.; Li, H.Y.; Zhang, X.N.; Xu, J.; Zhou, J.Q.; Wang, X.; Chang, C. Epigenetic activation of Enoyl-coa reductase by an acetyltransferase complex triggers wheat wax biosynthesis. Plant Physiol. 2020, 183, 1250–1267. [Google Scholar] [CrossRef]
- Liu, Q.; Luo, L.; Zheng, L. Lignins: Biosynthesis and biological functions in plants. Int. J. Mol. Sci. 2018, 19, 335. [Google Scholar] [CrossRef]
- Miedes, E.; Vanholme, R.; Boerjan, W.; Molina, A. The role of the secondary cell wall in plant resistance to pathogens. Front. Plant Sci. 2014, 5, 358. [Google Scholar] [CrossRef]
- Tobimatsu, Y.; Schuetz, M. Lignin polymerization: How do plants manage the chemistry so well? Curr. Opin. Biotechnol. 2019, 56, 75–81. [Google Scholar] [CrossRef]
- Zhang, J.; Bruton, B.D.; Biles, C.L. Cell wall-degrading enzymes of Didymella bryoniae in relation to fungal growth and virulence in cantaloupe fruit. Eur. J. Plant Pathol. 2014, 139, 749–761. [Google Scholar] [CrossRef] [PubMed]
- Chilosi, M.; Magro. Pectolytic enzymes produced in vitro and during colonization of melon tissues by Didymella bryoniae. Plant Pathol. 2002, 47, 700–705. [Google Scholar] [CrossRef]
- Curren, T. Pectic and cellulolytic enzymes produced by Mycosphaerella citrullina and their relation to black rot of squash. Can. J. Bot. 1969, 47, 791–794. [Google Scholar] [CrossRef]
- Wang, H.; Wei, X.; Mo, C.; Wei, M.; Li, Y.; Fan, Y.; Gu, X.; Zhang, X.; Zhang, Y.; Kong, Q. Integrated full-length transcriptome and metabolome analysis reveals the defence response of melon to gummy stem blight. Plant Cell Environ. 2024, 47, 1997–2010. [Google Scholar] [CrossRef] [PubMed]
- Walters, D.R. Physiological Responses of Plantsto Attack; Springer: Berlin/Heidelberg, Germany, 2015; pp. 41–87. [Google Scholar]
- Serrano, I.; Audran, C.; Rivas, S. Chloroplasts at work during plant innate immunity. J. Exp. Bot. 2016, 67, 3845–3854. [Google Scholar] [CrossRef]
- Yang, H.; Luo, P.G. Changes in photosynthesis could provide important insight into the interaction between wheat and fungal pathogens. Int. J. Mol. Sci. 2021, 22, 8865. [Google Scholar] [CrossRef]
- Kumar, M.; Brar, A.; Yadav, M.; Chawade, A.; Vivekanand, V.; Pareek, N. Chitinases-potential candidates for enhanced plant resistance towards fungal pathogens. Agriculture 2018, 8, 88. [Google Scholar] [CrossRef]
- Raza, A.; Su, W.; Gao, A.; Mehmood, S.S.; Hussain, M.A.; Nie, W.; Lv, Y.; Zou, X.; Zhang, X. Catalase (CAT) gene family in rapeseed (Brassica napus L.): Genome-wide analysis, identification, and expression pattern in response to multiple hormones and abiotic stress conditions. Int. J. Mol. Sci. 2021, 22, 4281. [Google Scholar] [CrossRef]
- Corpas, F.J.; Barroso, J.B.; González-Gordo, S.; Muñoz-Vargas, M.A.; Palma, J.M. Hydrogen sulfide: A novel component in arabidopsis peroxisomes which triggers catalase inhibition. J. Integr. Plant Biol. 2019, 61, 871–883. [Google Scholar] [CrossRef]
- Zhang, Y.; Zheng, L.J.; Yun, L.; Ji, L.; Li, G.H.; Ji, M.C.; Shi, Y.; Zheng, X. Catalase (CAT) gene family in wheat (Triticum aestivum L.): Evolution, expression pattern and function analysis. Int. J. Mol. Sci. 2022, 23, 542. [Google Scholar] [CrossRef]
- Zhou, Y.; Liu, S.Q.; Yang, Z.J.; Yang, Y.G.; Jiang, L.W.; Hu, L.F. CsCAT3, a catalase gene from Cucumis sativus, confers resistance to a variety of stresses to Escherichia coli. Biotechnol. Biotec Eq 2017, 31, 886–896. [Google Scholar] [CrossRef]
- Wu, Q.B.; Chen, Y.L.; Zou, W.H.; Pan, Y.B.; Lin, P.X.; Xu, L.P.; Grisham, M.P.; Ding, Q.; Su, Y.; Que, Y. Genome-wide characterization of sugarcane catalase gene family identifies a ScCAT1 gene associated disease resistance. Int. J. Biol. Macromol. 2023, 232, 123398. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Zhou, W.L.; Zhang, X.M.; Li, Y. Roles of long non-coding rnas in plant immunity. PLoS Pathog. 2023, 19, e1011340. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Xu, Y.; Li, Q.; Cao, Y.; Yang, D.; Liu, S.; Wang, X.; Mi, Y.; Liu, Y.; Ding, C.; et al. A lncRNA fine-tunes salicylic acid biosynthesis to balance plant immunity and growth. Cell Host Microbe 2022, 30, 1124–1138.e1128. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.; Jiang, N.; Meng, J.; Yang, G.L.; Liu, W.W.; Zhou, X.X.; Ma, N.; Hou, X.; Luan, Y. LncRNA33732 respiratory burst oxidase module associated with wrky1 in tomato-phytophthora infestans interactions. Plant J. 2018, 97, 933–946. [Google Scholar] [CrossRef]
- Xu, G.Y.; Moeder, W.; Yoshioka, K.; Shan, L. A tale of many families: Calcium channels in plant immunity. Plant Cell 2022, 34, 1551–1567. [Google Scholar] [CrossRef]
- Tang, D.Z.; Wang, G.X.; Zhou, J.M. Receptor kinases in plant-pathogen interactions: More than pattern recognition. Plant Cell 2017, 29, 618–637. [Google Scholar] [CrossRef]
- Zhang, L.; Zhu, Q.; Tan, Y.; Deng, M.; Zhang, L.; Cao, Y.; Guo, X. Mitogen-activated protein kinases MPK3 and MPK6 phosphorylate receptor-like cytoplasmic kinase CDL1 to regulate soybean basal immunity. Plant Cell 2024, 36, 963–986. [Google Scholar] [CrossRef]
- Jiang, R.; Zhou, S.; Da, X.; Yan, P.; Wang, K.; Xu, J.; Mo, X. OsMKK6 regulates disease resistance in rice. Int. J. Mol. Sci. 2023, 24, 12678. [Google Scholar] [CrossRef]
- Song, L.; Fang, Y.; Chen, L.; Wang, J.; Chen, X. Role of non-coding RNAs in plant immunity. Plant Commun. 2021, 2, 100180. [Google Scholar] [CrossRef]
- Su, C.; Wang, Z.; Cui, J.; Wang, Z.; Wang, R.; Meng, J.; Luan, Y. Sl-lncRNA47980, a positive regulator affects tomato resistance to Phytophthora infestans. Int. J. Biol. Macromol. 2023, 248, 125824. [Google Scholar] [CrossRef]





| Type | Name | Forward Primers (5′→3′) | Reverse Primers (5′→3′) |
|---|---|---|---|
| Gene | β-Actin (MELO3C008032) | GTGATGGTGTGAGTCACACTGTT | GGCAGTGGTGGTGAACATG |
| MELO3C032345 | TGTGTTCACTTTTGGTGTTGG | GTTTCCCTATTTCGTCTCTGC | |
| MELO3C011422 | TACAATGAGAACTGGCGGAAT | TGAGACAATGCTTGGATACGA | |
| MELO3C007037 | ATGTCGTTGCTCAGCCTTCGC | TCGGTAGAGCCTCCACCATCA | |
| MELO3C003295 | CTTCCTGTGCCACCCTAAC | TACAAGCCAACGACTCCAT | |
| LncRNA | LNC_000022 | TACCTCGCTTCTTGTCCTT | TCACCCTATTTCGCTTACTC |
| LNC_000031 | ATAGAGACTTTGGGGATTCA | CTTCACGACCTTCCAGATTG | |
| LNC_000147 | AACTGAAGTGGTTTAGATGG | CTCTTTATTGAGTTTGGCAT | |
| LNC_000381 | ACTCAAACAACACAGACGA | GAAAAACGGTGAAGGCATA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, R.; Chen, J.; Zhang, Y.; Lu, X.; Cheng, C.; Li, J.; Lou, Q.; Wang, Y.; Qian, C. Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145. Horticulturae 2025, 11, 31. https://doi.org/10.3390/horticulturae11010031
Zhang R, Chen J, Zhang Y, Lu X, Cheng C, Li J, Lou Q, Wang Y, Qian C. Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145. Horticulturae. 2025; 11(1):31. https://doi.org/10.3390/horticulturae11010031
Chicago/Turabian StyleZhang, Rui, Jing Chen, Yongbing Zhang, Xiumei Lu, Chunyan Cheng, Ji Li, Qunfeng Lou, Yuhui Wang, and Chuntao Qian. 2025. "Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145" Horticulturae 11, no. 1: 31. https://doi.org/10.3390/horticulturae11010031
APA StyleZhang, R., Chen, J., Zhang, Y., Lu, X., Cheng, C., Li, J., Lou, Q., Wang, Y., & Qian, C. (2025). Long Noncoding RNA–Messenger RNA (lncRNA–mRNA) Network in Resistance to Gummy Stem Blight (Stagonosporopsis cucurbitacearum) of Melon Plant Introduction (PI) 420145. Horticulturae, 11(1), 31. https://doi.org/10.3390/horticulturae11010031

