Next Article in Journal
Genome-Wide Identification of the ABC Gene Family in Rosaceae and Its Evolution and Expression in Response to Valsa Canker
Next Article in Special Issue
Comprehensive Identification of Auxin Response Factor Gene Family and Their Expression Profiles Under Lanthanum Stress in Amorphophallus konjac
Previous Article in Journal
Prunus Movement Across the Silk Road: An Integrated Evolutionary and Breeding Analysis
Previous Article in Special Issue
Chromosome-Scale Genome of the Fern Cibotium barometz Unveils a Genetic Resource of Medicinal Value
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of Genomic SSR Markers for Assessing Genetic Diversity in Korean Native Fallopia multiflora

by
Raveendar Sebastin
1,†,
Ki Hyun Kim
2,†,
Hye Ran Shin
1,
Jin-Tae Jeong
3,
Ju-Kyung Yu
4,
Yoon-Sup So
4,* and
Jong-Wook Chung
1,*
1
Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Republic of Korea
2
Chungbuk Agricultural Research and Extension Services, Cheongju 28130, Republic of Korea
3
Department of Herbal Crop Research, NIHHS, R.D.A., Eumseong 27709, Republic of Korea
4
Department of Crop Science, Chungbuk National University, Cheongju 28644, Republic of Korea
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Horticulturae 2025, 11(1), 2; https://doi.org/10.3390/horticulturae11010002
Submission received: 7 November 2024 / Revised: 18 December 2024 / Accepted: 20 December 2024 / Published: 24 December 2024

Abstract

Fallopia multiflora, a perennial herb in the Polygonaceae family belonging to the genus Fallopia Adanson, is traditionally used as a Chinese herbal medicine. However, there is still confusion about the botanical origin of the species and the phylogenetic relationship between the cultivars and the wild relatives. To develop an efficient identification method, a molecular analysis was performed using SSR markers. The genetic diversity of the F. multiflora genetic resources has been assessed by using 10 locally collected accessions, including varieties and landraces. We screened 100 pairs of SSR primers and selected 71 successfully amplified SSR markers, in which one SSR was found to be a monomorphic marker. The results indicated that the number of alleles (NA) ranged from 2 to 10, with an average of 4.1 alleles. The major allele frequency (MAF) spanned from 0.20 to 0.90, the observed heterozygosity (HO) ranged from 0 to 0.80, and the polymorphic information content (PIC) varied between 0.16 and 0.86. Clustering analysis using an unweighted pair group mean algorithm (UPGMA) with all 70 SSR markers revealed three clusters among the F. multiflora accessions. Furthermore, seven minimum marker set combinations were identified and proved useful for variety identification. Therefore, these SSR markers could be valuable for various applications, including cultivar identification and assessing the purity of F. multiflora populations. Three genetic groups of F. multiflora should be considered as independent units for conservation and germplasm management of the species.

1. Introduction

Fallopia multiflora (Thunb.) Haraldson is a plant species belonging to the genus Fallopia, which is classified within the Polygonaceae family and is characterized as a perennial herb exhibiting root hypertrophy and twining stems. F. multiflora holds significant economic importance due to its utilization in traditional Chinese herbal medicine [1] and it is primarily found in the southern regions of China [2]. For nearly a millennium, the tuberous roots of F. multiflora have been incorporated into numerous formulations within traditional Chinese medicine [3], with its usage recorded in the pharmacopoeias of Japan and Korea alongside those of China [4,5]. The species is often used clinically for detoxification, clearing carbuncles, moisturizing the intestines, acting as a laxative, and fighting malaria [6].
The processed derivatives of F. multiflora are also recognized for their hepatorenal tonic properties and their ability to contribute to the maintenance of hair pigmentation [6]. Moreover, the species is commonly used in traditional Chinese medicine to alleviate allergies and alopecia and its usage extends to regions like America, Australia, and Europe. Indeed, identification challenges persist due to the morphological resemblance and the absence of standardized local and trade names for herbaceous plants like F. multiflora (Thunb.) Haraldson, which share similarities with other close relatives such as F. multiflora var. ciliinervis, Pteroxygonum giraldii, and Cynanchum auriculatum [7]. This confusion can affect the safety and effectiveness of using F. multiflora in traditional medicine. To address this, it is crucial to standardize names and improve plant authentication methods.
Initially, Polygonum multiflorum was first described by Thunberg in 1784, originally classified within the genus Polygonum. In 1978, Haraldson reclassified P. multiflorum into the genus Fallopia Adanson, resulting in the new designation F. multiflora (Thunb.) Haraldson. Subsequently, the independent genus Fallopia was recognized [8]. Within China, there are seven species of Fallopia, including two varieties. Of these, four species are annual herbs, while the remaining three are perennial herbs. Despite extensive studies on F. multiflora, the classification and infraspecific taxonomy remain contentious. Recent investigations have sought to clarify the taxonomic relationships within F. multiflora, yet significant debate persists regarding its precise taxonomic status [9,10,11,12]. To date, the taxonomic classification of F. multiflora has been predominantly based on comparisons of external and internal morphological structures [13].
The traditional Chinese medicine Heshouwu, obtained from the dried root tubers of F. multiflora, contains a variety of bioactive compounds. Phytochemical studies have identified stilbene glycosides, anthraquinones, phenols, and flavonoids as its primary constituents [1,14]. These compounds are well-known for their health-promoting properties [6]. Nevertheless, recent investigations have highlighted concerns regarding liver injury linked to F. multiflora, examining the issue from multiple angles [15]. Furthermore, studies suggest that the quality of Heshouwu is influenced by its germplasm source [16].
To authenticate the originality of the species, various molecular marker techniques have been proposed and extensively employed [17,18]. A notable example includes the design of species-specific primers for identifying the species F. multiflora, which were based on the rDNA internal transcribed spacer (ITS) sequences [19]. However, these primers are suboptimal due to the non-specific amplification of fragments from other varieties such as F. multiflora var. ciliinervis, an issue that could only be resolved by using high-fidelity polymerase in the PCR system. Recent studies using morphological, molecular, and chemical analyses have led to taxonomic updates in which F. multiflora var. ciliinervis has been tentatively reclassified as a separate species, while F. multiflora var. angulata remains classified as a variety of F. multiflora [16]. Consequently, there is a pressing need to develop an alternative method for producing diagnostic primers with enhanced species specificity. Whole-genome sequence acquisition has become relatively easier with improvements in next-generation sequencing (NGS) technology, facilitating the use of single-nucleotide polymorphisms (SNP) and simple sequence repeat (SSR) markers in various applications [20]. Recent advancements in nanopore sequencing technologies have greatly enhanced the accuracy, read length, and throughput for analyzing DNA and RNA molecules [21].
SSR motifs, typically 1–6 base pairs in length, are prevalent in both the coding and non-coding regions of genomes, including organellar genomes [22,23]. The high polymorphism levels of SSRs, combined with their universality and reproducibility in genotype analysis, render them valuable tools for plant breeding, including marker-assisted selection [24,25]. Genetic diversity plays a critical role in plant breeding programs and the preservation of genetic resources. SSR markers offer a powerful tool for assessing genetic diversity within medicinal germplasms. The species status of F. multiflora has been evaluated using morphology, molecular phylogeny, and chemical analysis [16]. However, genetic diversity studies in Fallopia using SSR markers remain unreported, largely due to the absence of efficient genomic markers for this genus. The main objectives of the present study are to develop polymorphic SSR markers through genome sequencing and to identify a minimum marker set capable of authenticating Fallopia germplasm accessions.

2. Materials and Methods

2.1. Plant Sample and DNA Extraction

A total of 10 F. multiflora accessions were collected locally from the Chungcheongbuk-do Agricultural Research and Extension Services (36°43′34.3″ N 127°27′46.4″ E) in South Korea (Table 1). Fresh young leaf samples were collected from three-week-old seedlings, wiped with 75% ethanol, and preserved in an ultra-low temperature freezer at −80 °C for future DNA extraction. Initially, the freeze-dried leaves were ground into powder using a Tissue Lyser II (QIAGEN, Germantown, MD, USA) for genomic DNA extraction. Following the manufacturer’s protocol, genomic DNA was subsequently extracted using the GeneAll® Plant SV mini kit (GeneAll, Seoul, Republic of Korea). The quality of the DNA was confirmed by 1.5% agarose gel electrophoresis, and the concentration and purity were quantified using an Epoch Microplate Spectrophotometer (BioTek, Bridgewater, NJ, USA). Each sample was diluted to 20 ng/μL and stored at −20 °C.

2.2. Genomic SSR Marker Development

We produced a short-read sequence employing Oxford Nanopore Technology (ONT) sequencing. The sequencing library was prepared utilizing the ONT gDNA Kit SQK-LSK110 (ONT, Oxford, UK). ONT sequencing was performed on the GridION platform, managed with MinKNOW Core 4.4.3, utilized a flow cell vR9.4 (FLO-MIN106), and followed the manufacturer’s protocols. Raw ONT sequencing data (FAST5 files) were converted into FASTQ format using Guppy v5.0.17 software. This process utilized the default high-accuracy parameters integrated within MinKNOW 13. The short reads were trimmed to remove low-quality bases and adapters using Trimmomatic (version 0.39) with default parameters, which included trimming 15 bases from both ends and retaining reads with a minimum length of 150 bases. The simple sequence repeat mining within the genomic data was conducted using the MIcroSAtellite identification tool [26].
Based on the SSR mining results from the sequence of the F. multiflora genome, a total of 83,995 SSR motifs were identified. These included di-nucleotide motifs with at least six repeats, tri-nucleotide motifs with at least five repeats, tetra-nucleotide motifs with at least four repeats, and penta-nucleotide or greater motifs with a minimum of three repeats. Among these identified SSR motifs, 100 primers were randomly selected from each repeat type for subsequent study. Primer3 software [27] was used to design the primers specific to flanking genomic sequences of the microsatellite regions.

2.3. Primer Screening and SSR Amplification

For primer screening in PCR analysis using the primers listed in Table 2, genomic DNA was extracted from F. multiflora accessions using the Exgene Plant SV kit (GeneAll, Seoul, Republic of Korea) according to the manufacturer’s instructions. To determine the optimal PCR conditions for each primer, initial PCR amplification was performed at an annealing temperature of 55 °C with genomic DNA. If primers failed to amplify or produced multiple bands at this temperature, more stringent conditions were tested at 52 °C and 58 °C to minimize off-target amplification. The PCR amplification reaction was conducted in a total volume of 40 µL, consisting of 15 µL of Excel TB 2× Taq Pre-Mix (Inclone Biotech, Seongnam City, Gyeonggi-do, Republic of Korea), 2 µL of 10 pmol/µL forward and reverse primers, 19 µL of distilled water, and 2 µL of DNA. The PCR reaction cycle included an initial denaturation at 95 °C for 3 min, followed by 34 cycles of denaturation at 95 °C for 30 s, annealing at the established temperature (52 °C, 55 °C, or 58 °C) for 45 s, and an extension at 72 °C for 1 min, with a final extension at 72 °C for 15 min. The resulting PCR products were analyzed by 2.5% agarose gel electrophoresis, and fragment sizes were assessed using Agilent 5300 Fragment Analyzer (Advanced Analytical Technologies, Inc., Ankeny, IA, USA).

2.4. Data Analysis

The genetic diversity indices of SSR markers were analyzed using various software packages. PowerMarker version 3.25 [28] was used to calculate the number of alleles (NA), major allele frequency (MAF), observed heterozygosity (HO), and polymorphic information content (PIC) for the SSR markers. Shared allele distances were also calculated with PowerMarker version 3.25. Following this, UPGMA (unweighted pair group method with arithmetic mean) clustering was performed on all F. multiflora accessions utilizing MEGA version 5.2 [29]. To determine the minimum number of marker (n) required to differentiate individual accessions, we employed a methodology previously outlined by [30]. Once the optimal marker set combinations were selected, we performed a phylogenetic analysis to confirm the effectiveness of the chosen markers in distinguishing each accession using the minimal marker set.

3. Results

3.1. Characteristics of Genomic SSRs

The sequencing of the library yielded 10.87 gigabytes (Gb) of raw data, comprising 36,114,084 paired-end reads. Following the cleaning and filtering of raw reads, 32,368,028 high-quality reads were obtained, resulting in 7.85 Gb of data. Analysis of the genomic data of F. multiflora identified a total of 236,059 SSR motifs. Tri-nucleotide and tetra-nucleotide repeat motifs were found to be the most abundant within the genome sequence, comprising 90,313 (38.26%) and 76,013 (32.20%) SSRs, respectively. Di-nucleotide repeat motifs comprised 28,288 (11.98%) SSRs, followed by penta-nucleotide repeat motifs with 23,106 (9.79%) SSRs. Hexa-nucleotide and hepta-nucleotide repeat motifs were identified in 12,471 (5.28%) and 4217 (1.79%) SSRs, respectively. The octa-nucleotide, nona-nucleotide, and deca-nucleotide repeat motifs were the least prevalent, each comprising less than 1% of the identified repeats.
Furthermore, a total of 83,995 SSR primers were considered, with a repeat length of ≥12 bases (Table 2). Among these SSR motifs, di- and tetra-nucleotide SSR motifs were most prevalent, comprising 28,288 (33.68%) and 23,834 (28.38%) SSRs, respectively. Tri-nucleotide repeat motifs accounted for 19,025 (22.65%) SSRs. Penta-nucleotide, hexa-nucleotide, and hepta-nucleotide repeat motifs were present in 7296 (8.69%), 3833 (4.56%), and 1257 (1.50%) SSRs, respectively. The least abundant repeat motifs were octa-, nona-, and deca-nucleotide, each comprising less than 1% of the identified repeats.
The SSR motifs produced by 83,995 SSR primers in the F. multiflora genome were categorized based on their repeat units (Supplementary Table S1). Out of the 12 types of di-nucleotide repeats, TA had the highest frequency at 9531 (33.69%), followed by AT with 9493 (33.56%), TC with 1822 (6.44%), GA with 1631 (5.77%), AG with 1577 (5.57%), and CT with 1525 (5.39%). Out of the 60 tri-nucleotide repeat types, AAT had the highest frequency at 5015 (5.55%), followed by ATT and TTA with 4130 and 4129 (4.57%), respectively, and TTC with 4106 (4.55%). Out of the 244 tetra-nucleotide repeat types, AAAT had the highest frequency at 4810 (6.33%), followed by ATTT with 3561 (4.68%), TTTA with 3490 (4.59%), AATT with 2457 (3.23%), and TAAT with 2425 (3.19%). Out of the 712 penta-nucleotide repeat types, AAAAT had the highest frequency at 1369 (5.92%), followed by ATTTT with 1010 (4.37%), AAAAG with 876 (3.79%), and TTTTA with 788 (3.41%). Among the 1397 hexa-nucleotide repeat types, AAAAAT had the highest frequency at 333 (2.67%), followed by AAAAAG with 271 (2.17%), ATTTTT with 260 (2.08%), and TTTTTA with 194 (1.56%). Among the 880 types of hepta-nucleotide repeats, AAAAAAT had the highest frequency at 65 occurrences. For octa-nucleotide repeats, among the 331 types identified, TAAAAAAA was the most frequent with 22 occurrences. In the case of nona-nucleotide repeats, which numbered 69 types, motifs with a frequency of 3 were the most prevalent. Similarly, among the 18 types of deca-nucleotide repeats, motifs with a frequency of 3 were also the most abundant.

3.2. Diversity of SSR Markers

In this study, a comprehensive analysis of genome sequencing identified a total of 83,995 SSR motifs. Subsequently, 100 SSR primer sequences were randomly chosen for each specific repeat type (di-nucleotide, tri-nucleotide, and tetra-nucleotide) based on default criteria requiring a minimum number of repeats per sequence. These SSR primers were successfully optimized for PCR using F. multiflora resources. Testing these primers on F. multiflora samples confirmed the amplification of all 100 SSR primers, revealing 70 polymorphic and one monomorphic primer (Table 3). Among the 71 markers tested, 32% were di-nucleotides, 27% were tri-nucleotides, and 41% were tetra-nucleotides, showcasing the diversity of SSR motifs within the genome.
The genetic diversity indices of the 71 selected SSR markers in the F. multiflora genome are also presented in Table 3. This study confirmed the MAF, NA, HO, and PIC among the 10 Fallopia accessions. The major allele frequency (MAF) ranged from 0.2 (FM-gSSR-051) to 0.9 (FM-gSSR-057, FM-gSSR-085, and FM-gSSR-100), with an average value of 0.559. The number of alleles (NA) varied from 1 (FM-gSSR-071) to 10 (FM-gSSR-039), with an average of 4.1 alleles per locus. The observed heterozygosity (HO) varied from 0 (FM-gSSR-002, 29 markers) to 0.8 (FM-gSSR-051), with an average of 0.204. The polymorphic information content (PIC) generated ranged from 0.16 (FM-gSSR-057, FM-gSSR-085, and FM-gSSR-100) to 0.86 (FM-gSSR-051), with a mean PIC value of 0.514. Among the markers featuring di-nucleotide repeat motifs, the MAF was 0.54, with an average of 4.22 alleles per locus (NA). The observed heterozygosity (HO) and polymorphic information content (PIC) averaged 0.11 and 0.54, respectively. For markers with tri-nucleotide repeat motifs, the mean MAF was 0.49; the NA averaged 4.63 alleles per locus, the HO was 0.31, and the PIC averaged 0.58. In markers with tetra-nucleotide repeat motifs, the mean MAF was 0.63, the NA averaged 3.62 alleles per locus, the HO was 0.21, and the PIC averaged 0.452.

3.3. Phylogeny and Minimum Markers

The UPGMA clustering dendrograms, constructed using all 70 SSR markers, revealed three distinct clusters among the F. multiflora accessions (Figure 1). Cluster I consisted of a single variety, CBM134. Cluster II comprised two varieties and two collected accessions from Boeun and Jecheon. Cluster III included five accessions, where a landrace accession clustered with four collected accessions from Boeun and Jecheon. A minimal set of markers for discriminating accessions was developed using an accumulation curve (Figure 2) following the method outlined in our previous study [30]. FM-gSSR-036 was chosen as the initial marker. Subsequently, markers were selected based on their effectiveness in discriminating among the F. multiflora accessions using the phylogenetic tree. Using a phylogenetic tree analysis, it was confirmed that the set of seven markers (FM-gSSR-036, FM-gSSR-039, FM-gSSR-040, FM-gSSR-051, FM-gSSR-079, FM-gSSR-054, and FM-gSSR-065) effectively differentiated among the 10 F. multiflora accessions (Figure 3).

4. Discussion

SSRs, recognized as pivotal molecular markers, have been extensively employed for assessing genetic diversity, constructing genetic maps, and performing fingerprinting in medicinal plants [31,32,33]. Next-generation sequencing (NGS) has transformed the discovery of SSRs. In particular, ONT facilitates the sequencing of large amounts of DNA at once, reducing both time and cost. This makes it easier to develop SSR markers from the genomes of non-model organisms, especially crop plants [34,35]. In this study, a total of 236,059 SSR motifs were identified from 32,368,028 high-quality reads. Previously, ref. [36] reported a total of 71,207 SSR loci from the 99.6 million raw data in Astragali transcriptome sequencing. Also, [37] identified a total of 48,951 repeat motifs from 183.54 million bases in Indian dill. The high number of SSRs detected in the F. multiflora genome is likely due to recent advancements in NGS technologies, which allow for detailed genome-wide analysis. SSR and SNP markers have found extensive application in diverse research domains, prominently including genetic diversity studies in terrestrial plants [38,39,40]. However, there have been no reports on the development of SSR markers for the Fallopia species until now.
Plant genomes are predominantly characterized by di-nucleotide repeats, making them the most abundant SSR motifs [41]. However, tri-nucleotide repeats are reported to be the most abundant type of SSRs in the coding sequences of eukaryotic genomes [42,43]. In the present study, tri-nucleotide repeats were predominant in F. multiflora, aligning with other SSR studies [44], which support the relative distribution of motifs in these plant groups. SSR markers developed using NGS technology in other crop species [23] have also shown that di- and tri-nucleotide repeats are the most abundant, with AT/TA and ATT/AAT being the most frequently detected, consistent with our findings. Moreover, a consistent trend observed in previous studies was evident: as the number of SSR motifs decreased, the frequency of SSRs increased [45,46,47].
Of the 83,995 primers designed based on the highest repeat types in this study, 100 primers were successfully amplified, and 70 of these were found to be polymorphic (Table 3). Despite having appropriate priming sites, amplification may fail due to the specific and limited annealing temperatures applied in the PCR amplification [48]. Compared with other anonymous markers, SSR markers are co-dominant markers and provide more accurate estimates of genetic diversity. SSR markers are a preferred choice for genetic diversity analysis in various crop species [49,50]. Genetic diversity in plant species can be effectively identified using SSR loci, as evidenced by the observed allele numbers, heterozygosity, and polymorphism information content (PIC) values. In this study, a higher average of 4.1 alleles per locus was observed (Table 3), which is greater than those reported in previous studies [51,52]. The mean observed heterozygosity (0.20) of this study suggests a low to moderate level of genetic variation, which may be attributed to the small or isolated sample size. Conservation measures are essential to preserve or improve the genetic diversity of the population. Similarly, the mean PIC value of 0.514 was comparable to those found in other cultivated crop species [53]. For instance, in Perilla frutescens L., a medicinal crop plant, the PIC values ranged from 0.232 to 0.931, with an average of 0.592 [54]. These findings highlight the variability in allele frequencies and diversity indices across different SSR motifs.
Cluster analyses were conducted on F. multiflora accessions using the developed SSR markers. A dendrogram constructed with SSR data using the UPGMA method indicated that the F. multiflora accessions were grouped into three main clusters. The SSR markers developed in this study did not show distinct grouping of the 10 Fallopia accessions based on their geographic origin or variety, suggesting limited differentiation capability in these aspects. Molecular markers are highly effective in revealing differences in genetic makeup, phylogenetic relationships, and genotype classification with high precision [55,56]. Establishing a minimal set of molecular markers capable of distinguishing accessions sets the stage for future assessments of existing resources [57,58]. In our study, we constructed an UPGMA clustering tree using the seven minimal markers set based on Nei’s genetic similarity coefficient. This analysis successfully clustered all 10 F. multiflora accessions into three distinct groups. SSR markers derived from genomic DNA offer a valuable tool for species discrimination, complementing markers developed from plastid genomes [59]. This study demonstrates the potential of SSR markers for genetic studies and the classification of F. multiflora accessions, although their effectiveness in identifying geographic factors remains limited.
Understanding the genetic diversity within and between populations is essential for designing effective conservation strategies [60]. Genomic SSR loci, developed using whole-genome data, have been widely and successfully applied across various plant species [32,43]. SSR markers have proven effective in applications such as cultivar identification, molecular breeding, and analyzing population genetic structure. Our previous studies have also demonstrated the utility of minimal SSR marker sets for differentiating accessions, with SSR markers successfully distinguishing all accessions [30,61]. Compared to SSR markers, SNP markers often require a larger number of loci and tend to distinguish fewer accessions.

5. Conclusions

In this study, we successfully developed genomic SSR markers for F. multiflora using whole-genome sequencing. We identified 236,059 SSR motifs in total and utilized 70 polymorphic markers for genetic diversity analysis of the Fallopia germplasm collection. The analysis confirmed that a minimum set of 7 markers could distinguish all 10 F. multiflora accessions. The SSR markers developed in this study are valuable assets for exploring genetic diversity, managing germplasm, and conserving Fallopia species. However, a limitation of this study is the relatively small number of accessions analyzed. To address this, a larger and more diverse set of samples should be collected from across the country. Evaluating these additional samples using the minimal marker set could help bridge the existing gaps and provide a more comprehensive understanding. They may offer important insights into the genetic makeup of Fallopia, which will aid in conservation efforts and enhance future crop breeding and improvement programs.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae11010002/s1, Table S1: Sub-classification of genome-wide SSR motifs according to the number of repeats present in the SSR units.

Author Contributions

Conceptualization, J.-W.C. and Y.-S.S.; methodology, H.R.S. and K.H.K.; formal analysis, H.R.S. and J.-T.J.; software, J.-T.J. and K.H.K.; validation, J.-K.Y. and R.S.; investigation, J.-W.C.; resources, K.H.K.; data curation, J.-K.Y. and J.-T.J.; writing—original draft preparation, R.S.; writing—review and editing, R.S. and J.-W.C.; supervision, Y.-S.S.; project administration, J.-W.C.; funding acquisition, J.-W.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was carried out with the support of “Co-operative Research Program for Agriculture Science and Technology Development (Project No. RS-2022-RD010267)” Rural Development Administration, Republic of Korea.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Lin, L.; Ni, B.; Lin, H.; Zhang, M.; Li, X.; Yin, X.; Qu, C.; Ni, J. Traditional usages, botany, phytochemistry, pharmacology and toxicology of Polygonum multiflorum Thunb.: A review. J. Ethnopharmacol. 2015, 159, 158–183. [Google Scholar] [CrossRef] [PubMed]
  2. Li, A.; Bao, B.; Alisa, E.G.-B.; Suk-pyo, H.; McNeill, J.; Sergei, L.M.; Hideaki, O.; Chong-wook, P. Flora of China; Science Press: Beijing, China, 2003; pp. 277–350. [Google Scholar]
  3. Liu, R.; Li, X.; Huang, N.; Fan, M.; Sun, R. Chapter Eleven—Toxicity of traditional Chinese medicine herbal and mineral products. In Advances in Pharmacology; Du, G., Ed.; Academic Press: Cambridge, MA, USA, 2020; Volume 87, pp. 301–346. [Google Scholar]
  4. Korea Foodservice Distributors Association Committee. The Korean Pharmacopoeia, 12th ed.; Korea Foodservice Distributors Association Committee: Seoul, Republic of Korea, 2012. [Google Scholar]
  5. J.P.E. Committee. The Japanese Pharmacopoeia, 17th ed.; Japan Plastic Energy: Osaka, Japan, 2016. [Google Scholar]
  6. C.P. Committee. Pharmacopoeia of P.R. China, Part I; Chinese Pharmacopoeia Commettee: Beijing, China, 2020. [Google Scholar]
  7. Zheng, C.-J.; Zhao, S.-J.; Shao, L. Species identification of Chinese medicinal plant Fallopia multiflora (Thunb.) Haraldson by suppression subtraction hybridization. J. Nat. Med. 2014, 68, 192–198. [Google Scholar] [CrossRef] [PubMed]
  8. Li, A.R. Fallopia Adans. In Flora Reipublicae Popularis Sinicae; Science Press: Beijing, China, 1998; p. 25. [Google Scholar]
  9. Min, Y.; Zhou, Z.; Zhao, X.; Gao, P.; Long, C. Phylogenetic position of Polygonum bungeanum in Polygonum Ls. lat. (Polygonaceae) as evidenced from nrDNA ITS, cpDNA atpB-rbcL and trnL-F Sequences. Life Sci. J. 2013, 10, 2664–2670. [Google Scholar]
  10. Hanjing, Y.; Zhijian, F.; Hongyi, Z.; Shixiao, Y. Fallopia multiflora var. angulata, a New Combination in the Polygonaceae from China. Novon 2011, 21, 388–391. [Google Scholar]
  11. Gang, A.S.; Cai, X. Establishment of the distinct species status of Polygonum ciliinerve based on morphological and anatomical data. J. Syst. Evol. 2008, 46, 742–749. [Google Scholar] [CrossRef]
  12. Un, W.; An, C.; Zheng, X.-L.; Wan, H.-W.; Chen, Y.-S.; Li, D.-W.; Zhou, Z.-Z. Phylogenetic Analysis of Polygonum L. s. lat. and Related Genera (Polygonaceae) Inferred from nrDNA Internal Transcribed Spacer (ITS) Sequences. Plant Sci. J. 2014, 32, 228–235. [Google Scholar] [CrossRef]
  13. Xu, Y.; Qiu, H.G.; Cao, Z. Identification of Polygonum multiflorum Thunb. with its confused species Polygonum ciliinerve. Xinjiang J. Tradit. Chin. Med. Pharm. 1998, 16, 33–34. [Google Scholar]
  14. Kim, H.K.; Choi, Y.H.; Choi, J.S.; Choi, S.U.; Kim, Y.S.; Lee, K.R.; Kim, Y.-K.; Ryu, S.Y. A new stilbene glucoside gallate from the roots of Polygonum multiflorum. Arch. Pharmacal. Res. 2008, 31, 1225–1229. [Google Scholar] [CrossRef]
  15. Kong, L.; Cao, Y. Analysis on the Instructions of Chinese Patent Medicines Containing Polygoni Multiflori Radix in Chinese Pharmacopoeia 2020 Edition and Application Situation in Shandong Provincial Hospital Affiliated to Shandong First Medical University. Chin. Pharm. Aff. 2024, 38, 217–222. [Google Scholar] [CrossRef]
  16. Xie, H.Q.; Chu, S.S.; Zha, L.P.; Cheng, M.E.; Jiang, L.; Ren, D.D.; Yu, Y.; Peng, H.S.; Peng, D.Y. Determination of the species status of Fallopia multiflora, Fallopia multiflora var. angulata and Fallopia multiflora var. ciliinervis based on morphology, molecular phylogeny, and chemical analysis. J. Pharm. Biomed. Anal. 2019, 166, 406–420. [Google Scholar] [CrossRef]
  17. Gantait, S.; Debnath, S.; Nasim Ali, M. Genomic profile of the plants with pharmaceutical value. Biotech 2014, 4, 563–578. [Google Scholar] [CrossRef] [PubMed]
  18. Kiran, U.; Khan, S.; Mirza, K.J.; Ram, M.; Abdin, M.Z. SCAR markers: A potential tool for authentication of herbal drugs. Fitoterapia 2010, 81, 969–976. [Google Scholar] [CrossRef] [PubMed]
  19. Zheng, C.J.; Zhao, S.J.; Zhao, Z.H.; Guo, J. Molecular authentication of the traditional medicinal plant Fallopia multiflora. Planta Med. 2009, 75, 870–872. [Google Scholar] [CrossRef] [PubMed]
  20. Mishra, A.; Singh, P.K.; Bhandawat, A.; Sharma, V.; Sharma, V.; Singh, P.; Roy, J.; Sharma, H. Chapter 8—Analysis of SSR and SNP markers. In Bioinformatics; Singh, D.B., Pathak, R.K., Eds.; Academic Press: Cambridge, MA, USA, 2022; pp. 131–144. [Google Scholar]
  21. Lin, B.; Hui, J.; Mao, H. Nanopore Technology and Its Applications in Gene Sequencing. Biosensors 2021, 11, 214. [Google Scholar] [CrossRef]
  22. van Belkum, A. The role of short sequence repeats in epidemiologic typing. Curr. Opin. Microbiol. 1999, 2, 306–311. [Google Scholar] [CrossRef]
  23. Wang, X.; Yang, S.; Chen, Y.; Zhang, S.; Zhao, Q.; Li, M.; Gao, Y.; Yang, L.; Bennetzen, J.L. Comparative genome-wide characterization leading to simple sequence repeat marker development for Nicotiana. BMC Genom. 2018, 19, 500. [Google Scholar] [CrossRef]
  24. Guichoux, E.; Lagache, L.; Wagner, S.; Chaumeil, P.; Leger, P.; Lepais, O.; Lepoittevin, C.; Malausa, T.; Revardel, E.; Salin, F.; et al. Current trends in microsatellite genotyping. Mol. Ecol. Resour. 2011, 11, 591–611. [Google Scholar] [CrossRef]
  25. Zhang, L.W.; Cai, R.R.; Yuan, M.H.; Tao, A.F.; Xu, J.T.; Lin, L.H.; Fang, P.P.; Qi, J.M. Genetic diversity and DNA fingerprinting in jute (Corchorus spp.) based on SSR markers. Crop J. 2015, 3, 416–422. [Google Scholar] [CrossRef]
  26. Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef]
  27. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
  28. Liu, K.J.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [PubMed]
  29. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed]
  30. An, H.; Lee, H.-Y.; Shim, D.; Choi, S.H.; Cho, H.; Hyun, T.K.; Jo, I.-H.; Chung, J.-W. Development of CAPS Markers for Evaluation of Genetic Diversity and Population Structure in the Germplasm of Button Mushroom (Agaricus bisporus). J. Fungi 2021, 7, 375. [Google Scholar] [CrossRef] [PubMed]
  31. Zhu, Y.; Ma, T.; Lin, Y.; Peng, Y.; Huang, Y.; Jiang, J. SSR molecular marker developments and genetic diversity analysis of Zanthoxylum nitidum (Roxb.) DC. Sci. Rep. 2023, 13, 20767. [Google Scholar] [CrossRef] [PubMed]
  32. Shin, H.R.; Jo, I.H.; Sebastin, R.; Gil, J.; Kim, G.Y.; Moon, S.; Park, H.-S.; Oh, S.; Han, J.W.; Ma, K.H.; et al. Development of polymorphic simple sequence repeat markers in Agastache rugosa and their application in genetic evaluation and cross-taxon transferability of Agastache species. J. Appl. Res. Med. Aromat. Plants 2024, 38, 100519. [Google Scholar] [CrossRef]
  33. Li, Q.; Li, B.; Guo, S.X. DNA marker-assisted selection of medicinal plants (I). Breeding research of disease-resistant cultivars of Panax notoginseng. Zhongguo Zhong Yao Za Zhi 2017, 42, 63–69. [Google Scholar] [CrossRef]
  34. Ekblom, R.; Galindo, J. Applications of next generation sequencing in molecular ecology of non-model organisms. Heredity 2011, 107, 1–15. [Google Scholar] [CrossRef]
  35. Zalapa, J.E.; Cuevas, H.; Zhu, H.Y.; Steffan, S.; Senalik, D.; Zeldin, E.; McCown, B.; Harbut, R.; Simon, P. Using Next-Generation Sequencing Approaches to Isolate Simple Sequence Repeat (Ssr) Loci in the Plant Sciences. Am. J. Bot. 2012, 99, 193–208. [Google Scholar] [CrossRef]
  36. Jiang, M.; Yan, S.; Ren, W.; Xing, N.; Li, H.; Zhang, M.; Liu, M.; Liu, X.; Ma, W. Genetic diversity of the Chinese medicinal plant Astragali Radix based on transcriptome-derived SSR markers. Electron. J. Biotechnol. 2023, 62, 13–20. [Google Scholar] [CrossRef]
  37. Kumar, S.; Gandham, P.; Palve, A.; Rathore, A. Survey sequencing and in-silico development and validation of genomic SSR markers in Indian dill seed. J. King Saud Univ. Sci. 2020, 32, 862–866. [Google Scholar] [CrossRef]
  38. Hu, Q.M.; Wang, H.P.; Jiang, B.A.; Zhu, H.Y.; He, X.M.; Song, P.Y.; Song, J.P.; Yang, S.; Shen, J.J.; Li, Z.; et al. Genome wide simple sequence repeats development and their application in genetic diversity analysis in wax gourd (Benincasa hispida). Plant Breed. 2022, 141, 108–118. [Google Scholar] [CrossRef]
  39. Shehzad, T.; Okuno, K. QTL mapping for yield and yield-contributing traits in sorghum (Sorghum bicolor (L.) Moench) with genome-based SSR markers. Euphytica 2015, 203, 17–31. [Google Scholar] [CrossRef]
  40. Bharti, R.; Kumar, S.; Parekh, M.J. Development of genomic simple sequence repeat (gSSR) markers in cumin and their application in diversity analyses and cross-transferability. Ind. Crop. Prod. 2018, 111, 158–164. [Google Scholar] [CrossRef]
  41. Biswas, M.K.; Xu, Q.; Mayer, C.; Deng, X. Genome wide characterization of short tandem repeat markers in sweet orange (Citrus sinensis). PLoS ONE 2014, 9, e104182. [Google Scholar] [CrossRef]
  42. Tóth, G.; Gáspári, Z.; Jurka, J. Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Res. 2000, 10, 967–981. [Google Scholar] [CrossRef]
  43. Liu, S.-R.; Li, W.-Y.; Long, D.; Hu, C.-G.; Zhang, J.-Z. Development and Characterization of Genomic and Expressed SSRs in Citrus by Genome-Wide Analysis. PLoS ONE 2013, 8, e75149. [Google Scholar] [CrossRef]
  44. Varshney, R.K.; Graner, A.; Sorrells, M.E. Genic microsatellite markers in plants: Features and applications. Trends Biotechnol. 2005, 23, 48–55. [Google Scholar] [CrossRef]
  45. Cheng, J.; Zhao, Z.; Li, B.; Qin, C.; Wu, Z.; Trejo-Saavedra, D.L.; Luo, X.; Cui, J.; Rivera-Bustamante, R.F.; Li, S.; et al. A comprehensive characterization of simple sequence repeats in pepper genomes provides valuable resources for marker development in Capsicum. Sci. Rep. 2016, 6, 18919. [Google Scholar] [CrossRef]
  46. Portis, E.; Lanteri, S.; Barchi, L.; Portis, F.; Valente, L.; Toppino, L.; Rotino, G.L.; Acquadro, A. Comprehensive Characterization of Simple Sequence Repeats in Eggplant (Solanum melongena L.) Genome and Construction of a Web Resource. Front. Plant Sci. 2018, 9, 401. [Google Scholar] [CrossRef]
  47. Zhu, H.Y.; Song, P.Y.; Koo, D.H.; Guo, L.Q.; Li, Y.M.; Sun, S.R.; Weng, Y.Q.; Yang, L.M. Genome wide characterization of simple sequence repeats in watermelon genome and their application in comparative mapping and genetic diversity analysis. Bmc Genom. 2016, 17, 557. [Google Scholar] [CrossRef]
  48. Squirrell, J.; Hollingsworth, P.M.; Woodhead, M.; Russell, J.; Lowe, A.J.; Gibby, M.; Powell, W. How much effort is required to isolate nuclear microsatellites from plants? Mol. Ecol. 2003, 12, 1339–1348. [Google Scholar] [CrossRef] [PubMed]
  49. Wang, H.; Jiang, J.; Chen, S.; Qi, X.; Peng, H.; Li, P.; Song, A.; Guan, Z.; Fang, W.; Liao, Y.; et al. Next-Generation Sequencing of the Chrysanthemum nankingense (Asteraceae) Transcriptome Permits Large-Scale Unigene Assembly and SSR Marker Discovery. PLoS ONE 2013, 8, e62293. [Google Scholar] [CrossRef] [PubMed]
  50. Shao, Q.-S.; Guo, Q.-S.; Deng, Y.-M.; Guo, H.-P. A comparative analysis of genetic diversity in medicinal Chrysanthemum morifolium based on morphology, ISSR and SRAP markers. Biochem. Syst. Ecol. 2010, 38, 1160–1169. [Google Scholar] [CrossRef]
  51. Winton, L.M.; Krohn, A.L.; Conn, J.S. Microsatellite markers for the invasive plant species white sweetclover (Melilotus alba) and yellow sweetclover (Melilotus officinalis). Mol. Ecol. Notes 2007, 7, 1296–1298. [Google Scholar] [CrossRef]
  52. Li, X.; Qiao, L.; Chen, B.; Zheng, Y.; Zhi, C.; Zhang, S.; Pan, Y.; Cheng, Z. SSR markers development and their application in genetic diversity evaluation of garlic (Allium sativum) germplasm. Plant Divers. 2022, 44, 481–491. [Google Scholar] [CrossRef]
  53. Zhao, W.; Lee, G.-A.; Kwon, S.-W.; Ma, K.-H.; Lee, M.-C.; Park, Y.-J. Development and use of novel SSR markers for molecular genetic diversity in Italian millet (Setaria italica L.). Genes Genom. 2012, 34, 51–57. [Google Scholar] [CrossRef]
  54. Park, H.; Sa, K.J.; Lee, S.; Lee, J.K. Genetic variation of seed oil characteristics in native Korean germplasm of Perilla crop (Perilla frutescens L.) using SSR markers. Genes Genom. 2022, 44, 1159–1170. [Google Scholar] [CrossRef]
  55. Pourabed, E.; Jazayeri Noushabadi, M.R.; Jamali, S.H.; Moheb Alipour, N.; Zareyan, A.; Sadeghi, L. Identification and DUS Testing of Rice Varieties through Microsatellite Markers. Int. J. Plant Genom. 2015, 2015, 965073. [Google Scholar] [CrossRef]
  56. Benke, A.P.; Krishna, R.; Mahajan, V.; Ansari, W.A.; Gupta, A.J.; Khar, A.; Shelke, P.; Thangasamy, A.; Shabeer, T.P.A.; Singh, M.; et al. Genetic diversity of Indian garlic core germplasm using agro-biochemical traits and SRAP markers. Saudi J. Biol. Sci. 2021, 28, 4833–4844. [Google Scholar] [CrossRef]
  57. Mitrová, K.; Svoboda, P.; Ovesná, J. The selection and validation of a marker set for the differentiation of onion cultivars from the Czech Republic. Czech J. Genet. Plant Breed. 2015, 51, 62–67. [Google Scholar] [CrossRef]
  58. Luo, Y.; Zhang, X.; Xu, J.; Zheng, Y.; Pu, S.; Duan, Z.; Li, Z.; Liu, G.; Chen, J.; Wang, Z. Phenotypic and molecular marker analysis uncovers the genetic diversity of the grass Stenotaphrum secundatum. BMC Genet. 2020, 21, 86. [Google Scholar] [CrossRef] [PubMed]
  59. Han, E.H.; Cho, K.; Goo, Y.; Kim, M.; Shin, Y.W.; Kim, Y.H.; Lee, S.W. Development of molecular markers, based on chloroplast and ribosomal DNA regions, to discriminate three popular medicinal plant species, Cynanchum wilfordii, Cynanchum auriculatum, and Polygonum multiflorum. Mol. Biol. Rep. 2016, 43, 323–332. [Google Scholar] [CrossRef] [PubMed]
  60. Schemske, D.W.; Husband, B.C.; Ruckelshaus, M.H.; Goodwillie, C.; Parker, I.M.; Bishop, J.G. Evaluating Approaches to the Conservation of Rare and Endangered Plants. Ecology 1994, 75, 584–606. [Google Scholar] [CrossRef]
  61. Lee, H.Y.; Raveendar, S.; An, H.; Oh, Y.L.; Jang, K.Y.; Kong, W.S.; Ryu, H.; So, Y.S.; Chung, J.W. Development of Polymorphic Simple Sequence Repeat Markers using High-Throughput Sequencing in Button Mushroom (Agaricus bisporus). Mycobiology 2018, 46, 421–428. [Google Scholar] [CrossRef]
Figure 1. The UPGMA phylogenetic tree of 10 F. multiflora accessions from 70 simple sequence repeat markers based on the Shared Allele genetic distance (DAS).
Figure 1. The UPGMA phylogenetic tree of 10 F. multiflora accessions from 70 simple sequence repeat markers based on the Shared Allele genetic distance (DAS).
Horticulturae 11 00002 g001
Figure 2. The sufficient number of markers for serving as a minimum marker set was determined using an accumulation curve calculated with the poppr package in R.
Figure 2. The sufficient number of markers for serving as a minimum marker set was determined using an accumulation curve calculated with the poppr package in R.
Horticulturae 11 00002 g002
Figure 3. A phylogenetic tree illustrates the discrimination of 10 F. multiflora accessions using seven selected markers.
Figure 3. A phylogenetic tree illustrates the discrimination of 10 F. multiflora accessions using seven selected markers.
Horticulturae 11 00002 g003
Table 1. List of Fallopia accessions used in this study.
Table 1. List of Fallopia accessions used in this study.
No.SpeciesCodeType (Variety/Sampling Site)
1F. multifloraFM01Landrace
2F. multifloraFM02Variety (Daegeon)
3F. multifloraFM03Collection (Jecheon)
4F. multifloraFM04Collection (Jecheon)
5F. multifloraFM05Collection (Jecheon)
6F. multifloraFM06Variety (Cheongpungsuo)
7F. multifloraFM07Collection (Boeun)
8F. multifloraFM08Collection (Boeun)
9F. multifloraFM09Collection (Boeun)
10F. multifloraFM10Variety (CBM134)
Table 2. Distribution, frequency, and primer design of SSR types with varying repeat numbers in F. multiflora.
Table 2. Distribution, frequency, and primer design of SSR types with varying repeat numbers in F. multiflora.
SSR MotifsNo. of Repeats
345678910>(11–75)No. of SSRs (%)Primer Designed (%)
Di---14,1294205253116481225813373728,288 (11.98)28,288 (33.68)
Tri--51,89616,02078244263234416021180518490,313 (38.26)19,025 (22.65)
Tetra-62,10991162945906364256728016576,013 (32.20)23,834 (28.38)
Penta-19,056309265016235818206523,106 (9.79)7296 (8.69)
Hexa-942620685851861191618401312,471 (5.28)3833 (4.56)
Hepta-301864023512084402710434217 (1.79)1257 (1.50)
Octa-87614495662156 10711339 (0.57)375 (0.45)
Nona-15916201814-18-11256 (0.11)69 (0.08)
Deca-488-------56 (0.02)18 (0.02)
Total (%)94,692 (40.11)66,980 (28.37)34,679 (14.69)13,487 (5.71)7431 (3.15)4368 (1.85)2980 (1.26)2153 (0.91)9289 (3.94)236,059 (100)83,995 (100)
Table 3. List of the 71 SSR markers selected in F. multiflora genome for subsequent study and their genetic diversity index.
Table 3. List of the 71 SSR markers selected in F. multiflora genome for subsequent study and their genetic diversity index.
NoNameSSR_TypeLeft PrimerRight PrimerTM (°C)MAFNAHOPIC
1FM-gSSR-002ATAAGAACAGAGGTGGCACAACATATACCTTCGATCGAGAACCC550.7400.45
2FM-gSSR-007ATCACGGATGTAATCACCTACCAGTGAAATTCGAGATTGGAGTGT580.4460.130.71
3FM-gSSR-009ATGAGTATTACTGCTCCCAATCCATATTTACCGTAAGAAGCCTCCC550.5400.58
4FM-gSSR-010ATTAACTCCAAACCACTCTTCACCGTTCCACAACGCTCCTTACTT580.540.140.58
5FM-gSSR-012ATTTGTAGGGCACTAGTGGATTCTATGATGAACTTAATCCAGCACC580.7300.41
6FM-gSSR-013ATTTAACCGACAACTTTGAGAAGCGACTGAGAAATGTGAGGGTTGT550.67300.44
7FM-gSSR-014ATTGATGCCGTTACACACAAATAGCCCTGTCCTCGCTCATTAC550.56200.37
8FM-gSSR-016TAGGCAACTACAATTCTTTCATCCCTTGGGTGTAAGTTGGACAGAT580.44300.5
9FM-gSSR-020ATGAAATCTCTTGCATTCTCAAGCAGGTTATGTCGATCGATGAGTC550.78200.29
10FM-gSSR-021TATCGTACCATAAGGAGTGGTCTTAAATACAATCACTGGTGGGC550.7300.41
11FM-gSSR-025ATGTGCCTCTAAGTGGAAACTGTCTTTCACATTAGAAGTTGGGAGC550.4450.220.68
12FM-gSSR-026ATCAAGTTAGCTTGGCTTCTGAACGTCCCTTCCTCCTATCCAAC580.67200.35
13FM-gSSR-027ATATTCTGTTGAAGAAGGCCTGAAGGGATGGAACTAGGAATGAAA550.4400.6
14FM-gSSR-030TAGATGATTAACTAATGCCCTTGGTGTTTAGGGATTAGACCAGGTG580.5400.58
15FM-gSSR-031TACAGAGCCAAGATTATCTGAAGGCCCGTAACAAGTGTAGCTTGA550.6400.54
16FM-gSSR-032TATCGATCTAACGCACCCTATTATGCCAACTCTCATTGAATTCCT580.78200.29
17FM-gSSR-034ATCCAAGCATATTGCTTCCTTATCAGCTGAAATATTACGTGGTTGC550.5400.58
18FM-gSSR-035ATAGTGCAATCCAAATGTACCCTACAAACTTGTCATTCCTGAGACC550.540.50.57
19FM-gSSR-036ATTTGTTTGCTACCAGAACAGTTGTAATCAGAAGCACGACAGCTTA550.380.30.79
20FM-gSSR-037TATGTACGCGTAGTACGTTGAAATAGTTTGATCTGTCCAAGATTCG550.640.20.54
21FM-gSSR-038TAATAACTGGAGTGTGGTTCGTTTACCCTTAGACTCCTCCTCAGTC580.4440.110.52
22FM-gSSR-039TAGGAAGTGGATGAGTTTGTTCACCATCGGTTAAGATGCCTTAGAG580.3100.50.82
23FM-gSSR-040TAAGGTTTACATTCATTCCACCTGATTACACTTATTCCGACGCTGT580.380.40.79
24FM-gSSR-041TCTGTCATTTCACACCACTTTCTCCTACCTTCAGTGTCACAAACAGC580.530.70.55
25FM-gSSR-042TATGCAACGAGTTGGACAGTAATAGAAGAATGAAGGACTTCTTGGACA550.540.10.6
26FM-gSSR-043TCTGTGCACTCTGCAACTCTCTTCGACAGAGGAAAGCGTCGTC550.430.60.58
27FM-gSSR-046GATTCAGCTGATCTTGTTAGAAGCAGATGCTGGAGCCTATTATCATT580.4580.30.71
28FM-gSSR-051ATCCCACATAAGGCTTAAGATGAGCTGGTCGTAAACTAGCCTTTCTG550.290.80.86
29FM-gSSR-053TATAGCTGGAATAAGTAGGAAGGCTGTTCCTCACTCTCATCCAGAAG550.3360.330.75
30FM-gSSR-054AGACATAATTAGGCATGGAAAGCTCTACATCCAAGATAGCAAATCCC550.2570.50.79
31FM-gSSR-056ATTGCAACATGTCCATGCGTATTATACAAATGCAAATCTCGTAGGC550.650.50.55
32FM-gSSR-057AATCACACCTATAAAGGCCCAAACATTCTTTGATGGGATCCAG550.9200.16
33FM-gSSR-058ATGTACAACGTCACCAATCACCTTAATGTTGTGCTTCAAGTTCTCCT580.540.40.6
34FM-gSSR-059ATCGTTAAGTTGGCCCTGAATTGTAACCAACTCATGTCAATCGAGTA580.470.20.69
35FM-gSSR-060ATCGGTTTAAAGCCGATACTTCGTACCCTTTGTTTGGCTAAGGTT580.4540.40.58
36FM-gSSR-061TCTCCTCCTCTCATCTTCATCTTCATCTGCTCGACATTCTTGCTTAT550.3550.20.68
37FM-gSSR-062AGACTAGCGGTGCTCATAGAGAAACTTTCTCCTCCTCTTCCTCCT580.6200.36
38FM-gSSR-063ATTCAACGTCATAGTTGATCAGAGCCATGATCATTGGAGAGGAGAAT550.550.10.62
39FM-gSSR-064ATTCGACCCTCGTTAAGACTCATAGCTGCAATTCTCTTGCTACCTCT580.7530.30.37
40FM-gSSR-065ATAAGACAAGACATACAAGCCAGGTACGACAAATCGTGTGTCATCTA550.3560.40.76
41FM-gSSR-066TATGACGTACATATTCTAGCCCGAGGTTTCTCACCTCAGCAGTTGTT550.5300.49
42FM-gSSR-067ATGGGTGAAATGCCTAAGAGACAATCTCAAATCCTCCTACCACTCAA550.7200.33
43FM-gSSR-068CATCTTGACGCTGATTGCTGTATATCAGCTTCAGTTCTGTGTCAGGAT580.6530.30.44
44FM-gSSR-069TCTAACTGCTGTCTTGGTCTTCATTTATGACCACTAATCCAAACAAGG580.3540.50.66
45FM-gSSR-070ATAGTAAGAGGGTTGATTAGGTAGCGCAACGGCCTTACTCACTCTTTA550.7540.10.39
46FM-gSSR-071AAACCAAATGAAGGCTAGCATGTGTATCTACTGCAATGAACGAGAGAA551100
47FM-gSSR-073ATCTACTCAAGGACATGGTTATCAGGTTCATCCTCTTCATTCCTCCTA550.3850.50.68
48FM-gSSR-074TATTACTTTAGTTCTCGGGCGTTTACAGATACTACTGGCCTCCTCA550.4530.10.49
49FM-gSSR-075ACATTATCTTCATCAGCAGTTCCAAGGGCAGGATAGTTCTTGTTTGAG550.8200.27
50FM-gSSR-077ATGGAGGAGGATGGATATCAGAAAGGCCTTGTAAGCATGGCATAAGAC550.640.20.54
51FM-gSSR-078TATGCGACACCTCCTATTCATCTCATCATAGACGAATTAACGTGAGACC550.56300.49
52FM-gSSR-079ATTTAAAGCGACAAGAAGAACTCTGAGGAAAGGAATTAGGTCCCTCTA550.2560.750.77
53FM-gSSR-080AAAGGCCCTTGGTTATTGGAGAATTACCTCCACCATGGATTGTAAGTA550.7400.45
54FM-gSSR-081TATTCACACATCTATGTTTAACCTTACCCAACATCGTTCCGCAGTTG550.3550.30.72
55FM-gSSR-082AACACATCTCAACCTTATTGGTGTCAACGTAGTTGACGTAATGAGCCT550.8300.31
56FM-gSSR-083ATGTTTGTATTGTGTCTGCATGGGACGCATACGTAAGTGACAACAA550.8300.31
57FM-gSSR-084TGATCCTAGGGCTCATCATCAGATTTCCTGATTGCCTCTTCTTGTAT550.630.10.42
58FM-gSSR-085ATCTGAAATCAATTACTGGTTCCGTCAAGCTGAGACAACGCAATATG550.9200.16
59FM-gSSR-086ATCCCTTGCAACCTCAAGAATGTTAGAGTGGTAGTGTTCAAATTGCTG550.740.20.45
60FM-gSSR-087AGTGGAGTTAAACCCACTTGTGCTTCCACAGACACTTCACGTACACCT550.630.50.42
61FM-gSSR-088CATAATTGAGCTAGGCAAGACTTGAAGACTGAGTTAGGCCAGGTAAGA550.7540.10.39
62FM-gSSR-089TATCAGGGAGAAGCTTAAGAGGAAGAGCTCTTCTATCTGGGAACAACA550.8530.30.25
63FM-gSSR-091GAGGAGGGCACGATTTATACAAGAGACCTTCTTCCAATAGAGATAACCC550.6560.30.53
64FM-gSSR-092CTTTCATGTTGGATACATGTGGTGTTCATGCTTAATCCCTTCTCACAT550.7200.33
65FM-gSSR-093CTTTACATGATATGTTCTCTTTGCGGCCAGCTGATGGAGCTAGTAGAC520.5300.49
66FM-gSSR-094AAAGAAGGACCTGATCCACACATAAACCCTAATCATGCAAAGCAAA550.540.50.54
67FM-gSSR-095AATAATGGTCCTAGAGAGTTGCACATAAAGTTGGATCTCTTCCTGACA550.6540.50.5
68FM-gSSR-096AATAACCTGATCCTGCAAGAACTTTACTGTTAACGACTCAAACGGATT550.3560.50.72
69FM-gSSR-097TCTTTGAATACTCAGTGTTGGTGCATAAATCCAATGGAAAGAGGCTAC550.7300.41
70FM-gSSR-098TTATGTTCCACCCGATAGTAGAATCACACTGTGAGGAGATTCAATGTG550.3560.40.76
71FM-gSSR-100ATTATGCCGTGTCTTCCAATTTATGATGCTGGTGATAGAGGTTGAT550.9200.16
Mean 0.5594.10.2040.514
MAF, Major allele frequency; NA, Number of alleles; HO, Observed heterozygosity; PIC, Polymorphism information content.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sebastin, R.; Kim, K.H.; Shin, H.R.; Jeong, J.-T.; Yu, J.-K.; So, Y.-S.; Chung, J.-W. Development of Genomic SSR Markers for Assessing Genetic Diversity in Korean Native Fallopia multiflora. Horticulturae 2025, 11, 2. https://doi.org/10.3390/horticulturae11010002

AMA Style

Sebastin R, Kim KH, Shin HR, Jeong J-T, Yu J-K, So Y-S, Chung J-W. Development of Genomic SSR Markers for Assessing Genetic Diversity in Korean Native Fallopia multiflora. Horticulturae. 2025; 11(1):2. https://doi.org/10.3390/horticulturae11010002

Chicago/Turabian Style

Sebastin, Raveendar, Ki Hyun Kim, Hye Ran Shin, Jin-Tae Jeong, Ju-Kyung Yu, Yoon-Sup So, and Jong-Wook Chung. 2025. "Development of Genomic SSR Markers for Assessing Genetic Diversity in Korean Native Fallopia multiflora" Horticulturae 11, no. 1: 2. https://doi.org/10.3390/horticulturae11010002

APA Style

Sebastin, R., Kim, K. H., Shin, H. R., Jeong, J.-T., Yu, J.-K., So, Y.-S., & Chung, J.-W. (2025). Development of Genomic SSR Markers for Assessing Genetic Diversity in Korean Native Fallopia multiflora. Horticulturae, 11(1), 2. https://doi.org/10.3390/horticulturae11010002

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop