Reference Gene Selection and Gene Expression Analysis during Gall Development of Zizania latifolia
by
, ,
Yipeng Li
1
,
Huan Yi
2,
Qing Gu
2,
Zhaisheng Zheng
1,
Mingxing Zhu
1,
Xiaojun Zha
2,
Shangfa Zhang
1 and
Mengfei Yang
1,* 1
Zhejiang Provincial Key Laboratory of Characteristic Aquatic Vegetable Breeding and Cultivation, Jinhua Academy of Agricultural Sciences, Jinhua 321051, China
2
College of Life Sciences, Zhejiang Normal University, Jinhua 321001, China
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(7), 759; https://doi.org/10.3390/horticulturae10070759
Submission received: 6 June 2024
/
Revised: 13 July 2024
/
Accepted: 16 July 2024
/
Published: 18 July 2024
(This article belongs to the Section Developmental Physiology, Biochemistry, and Molecular Biology)
Abstract
:The stem tips of Zizania latifolia at different development stages were used as research materials. The expression stability of nine candidate reference genes (ACT1, H2B, UBI, EF-1α, GAPDH, β-actin, 60S, SKIP and AQP) were evaluated using qRT-PCR. The data were analyzed with GeNorm and NormFinder software. Present results indicated that the expression of ACT1 was stable and that it could be used as the optimal reference gene for studying the development stage of gall formation. ACT1 was selected as the reference gene to verify the expression level of the correlative genes in the gall formation stage of Z. latifolia. Our results were consistent with the previous transcriptome sequencing results. This study revealed that ACT1 was the classic reference gene for the analysis of correlative genes in all of the gall development stages of Z. latifolia.
1. Introduction
Real-time quantitative PCR (qRT-PCR) has become an important tool in modern molecular biology for the study of gene expression variation due to its high sensitivity, high specificity, good reproducibility, and wide range of dynamic quantitative monitoring [1]. This technique provides support for the analysis of complex pathogenesis, genetic traits, resistance and basic defense, and biometabolic pathways in plants and animals. However, as reported by Ginzinger [2], Derveaux [3], and the researchers mentioned further, in the practical application of qRT-PCR technology, there may be some bias and instability in qRT-PCR data results due to uncertainties in RNA extraction quality, reverse transcription efficiency, and template quality [4]. There were two methods for mRNA quantification using qRT-PCR: “absolute quantification” and “relative quantification”. The objective of “relative quantification” is to determine the relative proportion of target genes in a sample—which usually requires one or more housekeeping genes with stable expression in various tissues, stages of growth and development as reference genes to correct and standardize the data [5]—and to obtain relative accurate and reliable data results compared with non-reference genes. Therefore, the selection of stable reference genes for “relative quantification” analysis is an important prerequisite for the study of gene expression using the qRT-PCR technique. The commonly used reference genes are ribosomal rRNA (18S rRNA and 25S rRNA), microtubulin gene (Tubulin), actin gene (Actin), transcriptional elongation factor gene (EF-1α), cyclophilin gene (CYP), and glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) for plants due to the expression levels of these genes being relatively stable [6,7,8,9]. However, an increasing number of studies have shown that although these reference genes are constitutively expressed in different plants with high conserved and relatively consistent expression levels, their expression varies somewhat across cells, tissues, organs, and stages of growth and development. Many genes have proven to be somewhat variable in in-depth studies, and no single reference gene can be applied to all experimental studies under all conditions for plants [10,11]. Therefore, with the increasing requirements for quantitative analysis, simultaneous validation screening of new reference genes or using multiple reference genes has become an effective strategy to solve the drawbacks [12]. Before using the qRT-PCR technique for quantitative analysis, a stable and suitable candidate reference gene should be validated and screened based on test materials and set conditions as the best and stable quantitative reference applicable for further study.
Zizania latifolia is an aquatic herb of the genus Zizania. The stem of Z. latifolia infected by Ustilago esculenta expands to form a part that can be used as a vegetable, which is called Jiaobai. Jiaobai is one of the most important aquatic vegetables in China [13]. It has been reported that Z. latifolia is rich in protein, amino acids, polysaccharides, dietary fiber, and other nutrients, and it has a crunchy and fresh taste, which is why it is consumed by many Chinese people [14]. In recent years, due the wide range of products, diverse patterns, excellent quality, and outstanding benefits of Z. latifolia, it has been flourishing in Chinese bazaars, exhibiting a good scaling developmental pattern, industrialization, and branding. The product organ of Z. latifolia is the enlarged flesh stem infected and formed by Ustilago esculenta. U. esculenta is an endophytic fungus, which proliferates in the stem of Z. latifolia. U. esculenta prevents the formation of flowering organs and stimulates the plant to secrete growth hormones to form edible product organs, which is quite different from the effects caused by other pathogenic bacteria infesting the plant [15]. Therefore, it is important to study the formation mechanism of the fleshy stem expansion in Z. latifolia and extract relevant functional genes from it to reveal the adaptive evolution mechanism and trait improvement of Z. latifolia after infestation by U. esculenta. The transcriptome sequencing work of Z. latifolia has already been completed, based on which several differentially expressed genes related to stress responses and hormone syntheses have been mined [16].
In the present study, ACT1, H2B, UBI, EF-1α, GAPDH, β-actin, 60S, SKIP, and AQP were selected as candidate reference genes for qRT-PCR using fleshy stem tips at different developmental stages during the gestation period of Z. latifolia. The expression stability of the relevant genes was analyzed using reference gene evaluation software GeNorm v 3.5 and Normfinder v 0.953 [17]. The YUCCA gene is a rate-limiting enzyme-coding gene for IAA biosynthesis, which plays an important role in IAA biosynthesis and regulation [18]. ZlNPR1 is a key regulatory gene in the salicylate-mediated SAR pathway, which initiates the expression of the downstream disease-resistant gene ZlPR1 [19]. ZlLEA3 is an important gene for plant resistance to osmotic stresses, which is mainly induced by water stress and ABA [20]. The expression patterns of the key genes ZlYUCCA, ZlNPR1, ZlPR1, and ZlLEA3 during the occurrence of a fleshy stem expansion in Z. latifolia were analyzed by using the best reference genes that were validated and screened, and their reliability was also verified to ensure that the mechanism of Zizania formation could be studied and to lay a theoretical foundation for the future directed breeding of new Z. latifolia varieties.
2. Materials and Methods
2.1. Test Materials
Z. latifolia cultivator ‘Zhejiao 10’, a double season Jiaobai, selected by Jinhua Agricultural Science Research Institute, was used as the experimental material. The material was planted in the field at the National Aquatic Vegetable Breeding Innovation Base (Jinhua). Sample collection was conducted in May 2021 during the critical period of the occurrence of Jiaobai seedling (3 days before and 1, 5, 9, and 13 days after pregnancy) (Figure 1). After cleaning the fleshy stems with 75% anhydrous ethanol, a blade was used to remove the tip of the stem. Each experiment was completed with three replicates. All collected samples were immediately frozen in liquid nitrogen and stored at −80 °C until analysis.
2.2. RNA Extraction, Quality Testing, and cDNA Reverse Transcription
Total RNA was extracted from frozen samples using the Trizol kit (TaKaRa, Shiga, Japan). The integrity and purity of the extracted RNA were evaluated by 2% agarose gel electrophoresis and Nanodrop ND2000 ultraviolet spectrophotometer (Thermo, Waltham, MA, USA). Only the A260/280 value of the total RNA of each sample ranging between 1.8 and 2.1 met the requirements of subsequent experiments. The above RNA samples (1 μg) were used as a template for cDNA synthesis using a full gold reverse transcription kit (AE311-03, TransGen Biotech Company, Beijing, China). The cDNAs were stored at −20 °C until analyzed.
2.3. Primer Design of Candidate Reference Genes and Pregnancy-Related Genes in Jiaobai
Referring to the research results of reference genes in rice [6], wheat [7], Chinese cabbage [4], dandelion [8], and eggplant [9], nine commonly used candidate reference genes were selected from the transcriptomes of Z. latifolia (Table 1): actin1 (ACT1), histone (H2B), polyubiquitin (UBI), protein translation elongation factor (EF-1α), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, 60S rRNA 60S, ask-interacting protein (SKIP), and aquaporin (AQP). At the same time, key genes—ZlYUCCA, ZlNPR1, ZlPR1, and ZlLEA3—which play key roles for fleshy Jiaobai stem development, were selected as the target genes for identifying and screening the reliability of reference genes (Table 2). The target gene sequences were obtained by blast analysis with the previous transcriptome data of the research group. All primers were designed with Premier 5.0 online tool and were synthesized by Sheng-gong Biotechnology Co., Ltd. (Shanghai, China).
2.4. Stability Analysis of Candidate Reference Genes and Identification of Optimal Reference Genes
The cycle threshold (Ct) value was recorded for each qRT-PCR experiment using geNorm and NormFinder analyses to analyze the stability of the reference genes [17]. Using the 2−∆∆Ct method, we converted the Ct value to the relative expression value for their respective analysis. The data analysis was conducted using SPSS 26.0 software.
3. Results
3.1. Total RNA Quality Determination and Primer Specificity Analysis
All the RNAs samples from the five periods were analyzed with 2% agarose gel electrophoresis. The results showed that the 18S and 28S RNA bands were bright and clear without obvious trailing, indicating that all the extracted RNA had suitable integrity. The picture of the RNA agarose gel electrophoresis can be found in Supplementary Figure S1. RNA concentration and quality were determined (Table 3). Moreover, the A260/280 and A260/230 of RNA were between 1.85 and 1.96 and were lower than 2.0, indicating that the extracted RNA was of high purity, free from protein or inorganic salt contamination, and could be used for cDNA synthesis. At the same time, the melting curve of the nine reference genes displayed a single peak, with no primer dimers and secondary bands being present, indicating that the selected genes could be used in subsequent experiments (Figure 2).
3.2. Abundance Analysis of Candidate Reference Genes
The expression levels of candidate reference genes could be reflected by measuring the cycle threshold (Ct) values based on qRT-PCR, and the lower Ct value corresponded to higher gene expression. The Ct values of the nine candidate reference genes in the shoot tips of fleshy stems in different development stages of Jiaobai were between 17.61 and 32.07 (Figure 3). The Ct value of H2B were between 17.61 and 21.78, while the Ct values of GAPDH were between 30.13 and 30.40. The Ct value of H2B was low, indicating that it had the highest expression. Moreover, the Ct value of GAPDH was high, indicating that the expression of GAPDH was low.
3.3. Expression Stability of Candidate Reference Genes during Pregnancy of Z. latifolia
3.3.1. geNorm Analysis
The geNorm software determines the expression stability of reference genes by calculating the M value (expression stability), and the lower M value corresponds to higher stability. The strong expression stability of the nine candidate reference genes was ACT1 = UBI > SKIP > β-actin > H2B > EF-1α > GAPDH > 60S > AQP during the pregnancy of Z. latifolia. The results indicated that the expression levels of ACT1 and UBI were the most stable, while the stability of AQP’s expression level was generally the worst in the shoots during pregnancy.
geNorm determined the optimal number of candidate reference genes by calculating the Vn/n + 1 = 0.15 value to obtain more accurate and reliable results. The program applied Vn/n + 1 = 0.15 as a threshold value. When Vn/n + 1 < 0.15, this means that the reference genes have reached the expression requirement of the target gene for correction; otherwise, an n + 1 target gene is required for correction. B, V2/3 > 0.15. The results indicated that three genes were the most suitable reference genes for the gall development of Jiaobai (Figure 4). Therefore, ACT1 and UBI were selected as the reference genes in the gall stages of Jiaobai and verified with SKIP.
3.3.2. NormFinder Analysis
NormFinder determines the stability of a reference gene by the value of gene expression’s stability, with lower stability representing a more suitable reference gene. The expression level’s stability of the nine candidate reference genes was as follows: ACT1 > UBI > H2B > SKIP > β-actin > EF-1α > GAPDH > AQP > 60S (Table 4). The reference gene with the highest stable expression among the nine candidate genes was ACT1, the worst expression stability was seen in 60S and AQP, and the expression stability of UBI and H2B was moderate.
3.4. Analysis of Key Genes during Gall Development of Jiaobai
ACT1 was selected as the reference gene to analyze the expression of four target genes during the fleshy stem enlargement of Z. latifolia. The results showed that the expression of auxin synthesis rate-limiting enzyme gene ZlYUCCA was downregulated at the early stage and significantly upregulated at the middle stage. During the late stage, ZlYUCCA’s expression level decreased and gradually stabilized (Figure 5). The expression level of ZlLEA3 significantly decreased in the early stage and then increased gradually. ZlPR1 and ZlNPR1 showed similar expression patterns during the fleshy stem enlargement of Z. latifolia, both of which were significantly upregulated to more than ten times the initial expression level at the middle stage of growth (5 d) and then downregulated to the initial expression level. The results were consistent with the transcriptome analysis in the early stage of Jiaobai development.
4. Discussion
Jiaobai is the product of the symbiosis of the Z. latifolia plant and U. esculenta. The expansion of the plant’s base to form a fleshy stem during the pregnancy stage is a typical feature of Z. latifolia. With continued research in the field of molecular biology, the mechanism of Z. latifolia will be further revealed through the study of the difference in its functional genes’ expression, which will become a hot spot in the future. At present, qRT-PCR is one of the common technical methods used to detect gene expression in molecular biology research, and screening suitable reference genes is the key to detecting the expression level of target genes at different developmental stages or different tissue sites. Actin is an important skeleton protein of cells, as a traditional reference gene for many developments of plants. Actin is widely distributed in the cytoplasm and has a high copy number. It is highly conserved between different species and has a relatively constant expression in various tissues and cells. So, Actin has often been used as a reference gene for gene expression analysis, including being applied to the period related to the synthesis of blunt anemone anthocyanin [21], walnut adventitious root stage [22], as well as the germination stages of various organs and seeds of rice [10]. In addition, in the study of Solanum aculeatissimum, a wild relative of eggplant, it was also found that the expression level and stability of Actin were less affected by the treatment of different plant growth regulators [23]. By monitoring the expression of Actin in different parts of Abelmoschus esculentus, different developmental stages, and under different treatment conditions, Li Yongping also confirmed that Actin is expressed in a stable manner and can be used as a suitable reference gene for A. esculentus [24]. ACT1 was expressed stably under the conditions of this study and was the most suitable reference gene for the occurrence stage of gall formation in Z. latifolia.
The YUCCA gene, which encodes flavin monooxygenase, was originally identified clonally from Arabidopsis mutants with reduced IAA levels [18]. As a rate-limiting enzyme-coding gene for IAA biosynthesis, YUCCA plays an important role in IAA biosynthesis and regulation. Overexpression of YUCCA can significantly increase the content of IAA in Arabidopsis, rice, potato, and other plants, and produce the phenotype of IAA oversynthesis. Rice expressing the antisense OsYUCCA1 exhibited a defective phenotype similar to that of rice IAA-insensitive mutants [25]. Endogenous hormones played crucial roles in the development stage of Z. latifolia gall, in which IAA was thought to play the major role. In the early stage of succulent stem expansion, the IAA content of the stem tip increases rapidly and remains high during the expansion process. The results of the present study demonstrated that the expression level of ZlYUCCA was decreased on the first day of the white fleshy stem’s expansion and peaked on the fifth day. However, it decreased slightly in the following days but remained at a high level, which was consistent with the trend of how IAA content varied [26]. The expression level of ZlYUCCA continuously increased. This signifies that it may participate in the expansion process of white fleshy stems by regulating the biosynthesis of IAA. As an important gene for plant resistance to osmotic stress, the expression level of ZlLEA3 was mainly induced by water stress and ABA, which was closely related to plant stress resistance [20]. During the expansion of fleshy stems, the expression of ZlLEA3 decreased and then increased, but ABA content remained almost unchanged [26]. It was speculated that it may maintain the water content in Jiaobai by adjusting the osmotic pressure during the expansion of the fleshy stems. ZlNPR1 is a key regulatory gene in the salicylate-mediated SAR pathway, and it initiates the expression of the downstream disease-resistant gene ZlPR1. In the present study, ZlPR1 and ZlNPR1 were significantly upregulated to more than ten times the initial expression level in the middle stage of succulent stem expansion (5 d), which reflected the dynamics of the rapid expansion of U. esculenta in the middle stage of positive stem expansion well, being consistent with the results of previous research [19].
In the present study, qRT-PCR was used to verify and screen the candidate reference genes during gall formation in Z. latifolia. The most suitable reference gene, ACT1, was determined, which laid a theoretical foundation for the subsequent gene expression analysis in Z. latifolia.
5. Conclusions
In this study, we evaluated the expression stability of nine candidate reference genes (ACT1, H2B, UBI, EF-1α, GAPDH, β-actin, 60S, SKIP, and AQP) by qRT-PCR, and we analyzed the data using GeNorm and NormFinder software. The results showed that ACT1 was the classic reference gene for the analysis of correlative genes in all of the gall development stages of Z. latifolia.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae10070759/s1, Figure S1: The picture of the RNA agarose gel electrophoresis of the five periods.
Author Contributions
M.Y. and S.Z. designed this research study; Y.L., H.Y. and Q.G. performed the research experiments; Y.L. and M.Z. analyzed the data and wrote this manuscript; M.Y., S.Z., Z.Z. and X.Z. revised this manuscript. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the earmarked fund for CARS (CARS-24-A-13), the Zhejiang Provincial Major Agricultural Science and Technology Projects of New Varieties Breeding (2021C02065), and the Jinhua Science and Technology Program (2021-2-002d).
Data Availability Statement
The authors confirm that the data supporting the findings of this study are available within this article.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Bustin, S.A.; Benes, V.; Nolan, T.; Pfaffl, M.W. Quantitative real-time RT-PCR–a perspective. J. Mol. Endocrinol. 2005, 34, 597–601. [Google Scholar] [CrossRef] [PubMed]
- Ginzinger, D.G. Gene quantification using real-time quantitative PCR: An emerging technology hits the mainstream. Exp. Hematol. 2002, 30, 503–512. [Google Scholar] [CrossRef] [PubMed]
- Derveaux, S.; Vandesompele, J.; Hellemans, J. How to do successful gene expression analysis using Real-time PCR. Methods 2010, 50, 227–230. [Google Scholar] [CrossRef] [PubMed]
- Cui, F.; Meng, C.; Wang, Y.; Zhao, J.; Chen, X.; Shen, S. Reference Genes Selection for Quantitative Real-time PCR in Chinese Cabbage-Cabbage Translocation Lines. Acta Agric. Boreali-Sin. 2018, 33, 60–67. [Google Scholar]
- Nolan, T.; Hands, R.E.; Bustin, S.A. Quantification of mRNA using Real-time RT-PCR. Nat. Protoc. 2006, 1, 1559–1582. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Wang, G.; Lu, Y.; Yang, Y.; Zheng, X.; Tian, J. Screening of internal reference genes of Chilo suppressalis by real-time fluorescence quantitative PCR and evaluation of expression stability. Chin. Rice Sci. 2019, 33, 75–84. [Google Scholar]
- Wan, H.; Zhao, Z.; Qian, C.; Sui, Y.; Malik, A.A.; Chen, J. Selection of appropriate reference genes for gene expression studies by quantitative real-time polymerase chain reaction in cucumber. Anal. Biochem. 2010, 399, 257–261. [Google Scholar] [CrossRef] [PubMed]
- Qiao, Y.; Wang, Y.; Cao, Y.; He, J.; Jia, M.; Li, Z. Reference genes selection and related genes expression analysis under low and high temperature stress in Taraxacum officinale. Acta Hortic. Sin. 2020, 47, 1153–1164. [Google Scholar]
- Pang, Q.; Li, Z.; Luo, S.; Chen, R.; Jin, Q.; Li, Z. Selection and stability analysis of reference gene for qRT-PCR in eggplant under high temperature stress. Acta Hortic. Sin. 2017, 44, 475–486. [Google Scholar]
- Li, Q.; Sun, S.; Yuan, D.; Yu, H.; Gu, M.; Liu, Q. Validation of candidate reference genes for the accurate normalization of real-time quantitative RT-PCR data in rice during seed development. Plant Mol. Biol. Report. 2010, 28, 49–57. [Google Scholar] [CrossRef]
- Song, X.; Yang, S.; Zhong, Q.; Wang, L.; Zhao, M.; Li, L. Selection of reference genes for quantitative RT-PCR analysis of Helianthus tuberosus. Mol. Plant Breed. 2018, 16, 1190–1196. [Google Scholar]
- Jiang, T.; Gao, Y.; Tong, Z. Selection of reference genes for quantitative real-time PCR in Lycoris. Acta Hortic. Sin. 2015, 42, 1129–1138. [Google Scholar]
- Ke, W.; Zhou, G.; Peng, J.; Huang, X.; Liu, Y.; Li, S. Systematic cluster analysis and comprehensive evaluation of water bamboo resources. Chin. Veg. 2000, 1, 18–21. [Google Scholar]
- Wang, L.; Yang, M.; Li, Y.; Zhang, S.; Zheng, Z. Genetic diversity of Zizania latifolia germplasm resourcesbased on ISSR technology. Zhejiang Agric. Sci. 2019, 60, 732–735. [Google Scholar]
- Guo, L.; Qiu, J.; Han, Z.; Ye, Z.; Chen, C.; Liu, C. A host plant genome (Zizania latifolia) after a century-long endophyte infection. Plant J. 2015, 83, 600–609. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Lu, Z.; Yang, Y.; Hou, J.; Yuan, L.; Chen, G. Transcriptome analysis reveals the symbiotic mechanism of Ustilago esculenta-induced gall formation of Zizania latifolia. Mol. Plant-Microbe Interact. 2021, 34, 168–185. [Google Scholar] [CrossRef]
- Wu, J.; He, B.; Du, Y.; Li, W.; Wei, Y. Analysis method of systematically evaluating stability of reference qenes using geNorm, NormFinder and BestKeeper. Mod. Agric. Sci. Technol. 2017, 5, 278–281. [Google Scholar]
- Mashiguchi, K.; Tanaka, K.; Sakai, T. The main auxin biosynthesis pathway in Arabidopsis. Proc. Natl. Acad. Sci. USA 2011, 108, 18512–18517. [Google Scholar] [CrossRef] [PubMed]
- Kang, L. Cloning and Functional Analysis of NPR1 Gene in Zizania latifolia. Master’s Thesis, China Jiliang University, Hangzhou, China, 2017. [Google Scholar]
- Yu, L.; Tang, X.; Wu, X.; Yan, B. Segregate cloning and sequence analysis of lea3 gene complete cDNA in Zizania caduciflora. China Veg. 2010, 6, 14–18. [Google Scholar]
- Ma, L.; Duan, Q.; Cui, G.; Du, W.; Jia, W.; Wang, X. Screening of qRT-PCR internal reference genes related to anthocyanidin synthesis in Anemone crassifolia. Acta Hortic. Sin. 2021, 48, 377–388. [Google Scholar]
- Song, X.; Chang, Y.; Liu, H.; Xu, H.; Pei, D. Reference gene selection and genes expression analysis during adventitious root formation in walnut. Acta Hortic. Sin. 2019, 46, 1907–1918. [Google Scholar]
- Zhou, X.; Liu, J.; Zhuang, Y. Selection of appropriate reference genes in Solanum aculeatissimum for quantitative gene expression studies under different experimental conditions. Acta Hortic. Sin. 2014, 41, 1731–1738. [Google Scholar]
- Li, S.; Ye, X.; Wang, B.; Chen, M.; Liu, J.; Zhu, H. Cloning and screening evaluation of real-time fluorescence quantitative PCR reference gene of okra. J. Nucl. Agron. 2021, 35, 60–71. [Google Scholar]
- Ye, X. YUCCA Cloned and Transgenosis Analysis in Rice. Master’s Thesis, Zhejiang Normal University, Jinhua, China, 2012. [Google Scholar]
- Jiang, J.; Cao, B.; Huang, K.; Zhang, Q.; Han, X.; Zhu, Q. Changes of NSC, enzymes and endogenous hormones during Zizania Gall’s Swelling. Acta Hortic. Sin. 2005, 32, 134–137. [Google Scholar]
Figure 1.
Different stages of gall formation in Z. latifolia.
Figure 2.
Melting curves of candidate reference genes.
Figure 3.
CT value distribution of nine candidate reference genes.
Figure 4.
Expression stabilities of nine candidate reference genes (A) and optimal number of reference genes (B) analyzed by GeNorm.
Figure 4.
Expression stabilities of nine candidate reference genes (A) and optimal number of reference genes (B) analyzed by GeNorm.
Figure 5.
Gene expression analysis of the stage of gall formation in Z. latifolia with ACT1 as reference gene (Different lowercase letters represent significant differences).
Figure 5.
Gene expression analysis of the stage of gall formation in Z. latifolia with ACT1 as reference gene (Different lowercase letters represent significant differences).
Table 1.
Primers used for qRT-PCR.
| Reference Gene | Primer Sequence | Product Length (bp) | Tm (°C) |
|---|---|---|---|
| ACT1 | F: GTCAAGGCAGGTTTTGCTGG R: CACCCACGTAGGCATCCTTT | 118 | 60 |
| H2B | F: AAGAAGGCGAAGAAGAGCGT R: GGCGAGCTTCTCGAAGATGT | 141 | 60 |
| UBI | F: GCACAGATCCTCCCTCTTCG R: CGTCCATCCCAAGCTCAAGT | 143 | 60 |
| EF-1α | F: TTCCGATACCGCCGATCTTG R: GTCTCCGGTAAGACCCTCCT | 115 | 60 |
| GAPDH | F: TGCTGCCTTCTTCTTCCCTG R: GGACATGAAGTCGTCGGAGG | 161 | 60 |
| β-actin | F: GGATTGGGCCTCATCACCAA R: TGGAACCGGAATGGTCAAGG | 145 | 60 |
| 60S | F: AGCTTTTCCCTGGCCTTTGT R: TCTGTTCTGTGCCTGACCAC | 170 | 60 |
| SKIP | F: CAGGTCATATTCCTCCCCGC R: TGAGACACAGTCATGGGCAC | 145 | 60 |
| AQP | F: TGGACCTGGGACTCATTTGC R: CGAGCAGGGTAGGCATGATT | 141 | 60 |
Table 2.
The key genes primer information of gall development in Z. latifolia.
| Pregnancy-Related Gene | Primer Sequence | Product Length (bp) | Tm (°C) |
|---|---|---|---|
| ZlYUCCA | F: CCTAGAAGGTAGCAAGCAGA R: TAAACCCAGTGAAAAAAACG | 179 | 60 |
| ZlNPR1 | 1F: GCTTTGGCAAGGATAATGTTTC 1R: GTTTCCCGAGTTCCACTGTTT | 214 | 56 |
| ZlPR1 | 1F: CACTACACGCAGATCGTGTGG 1R: GTAGTAGTTGCAGGTCATGAAG | 96 | 56 |
| ZlLEA3 | 1F: GCCGGCGAGRCCAAGGSMC 1R:GSCGGWYTTGTCCTTGCCGG | 300 | 58 |
Table 3.
Spectrophotometer test results of total RNA.
| Sampling Time (Day) | A260/A280 | A260/A230 |
|---|---|---|
| −3 | 2.13 | 2.02 |
| 1 | 2.08 | 1.83 |
| 5 | 2.14 | 1.96 |
| 9 | 2.13 | 1.93 |
| 13 | 2.11 | 1.88 |
Table 4.
Expression stabilities of nine candidate reference genes analyzed by NormFinder.
| Reference Gene | Stability Value | Ranking |
|---|---|---|
| ACT1 | 0.255 | 1 |
| UBI | 0.333 | 2 |
| H2B | 0.414 | 3 |
| SKIP | 0.442 | 4 |
| β-actin | 0.623 | 5 |
| EF-1α | 0.813 | 6 |
| GAPDH | 1.621 | 7 |
| AQP | 1.970 | 8 |
| 60S | 1.973 | 9 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Li, Y.; Yi, H.; Gu, Q.; Zheng, Z.; Zhu, M.; Zha, X.; Zhang, S.; Yang, M. Reference Gene Selection and Gene Expression Analysis during Gall Development of Zizania latifolia. Horticulturae 2024, 10, 759. https://doi.org/10.3390/horticulturae10070759
AMA Style
Li Y, Yi H, Gu Q, Zheng Z, Zhu M, Zha X, Zhang S, Yang M. Reference Gene Selection and Gene Expression Analysis during Gall Development of Zizania latifolia. Horticulturae. 2024; 10(7):759. https://doi.org/10.3390/horticulturae10070759
Chicago/Turabian StyleLi, Yipeng, Huan Yi, Qing Gu, Zhaisheng Zheng, Mingxing Zhu, Xiaojun Zha, Shangfa Zhang, and Mengfei Yang. 2024. "Reference Gene Selection and Gene Expression Analysis during Gall Development of Zizania latifolia" Horticulturae 10, no. 7: 759. https://doi.org/10.3390/horticulturae10070759
APA StyleLi, Y., Yi, H., Gu, Q., Zheng, Z., Zhu, M., Zha, X., Zhang, S., & Yang, M. (2024). Reference Gene Selection and Gene Expression Analysis during Gall Development of Zizania latifolia. Horticulturae, 10(7), 759. https://doi.org/10.3390/horticulturae10070759
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
