Next Article in Journal
Counterfeit Detection of Iranian Black Tea Using Image Processing and Deep Learning Based on Patched and Unpatched Images
Previous Article in Journal
Morphological Characterization of Opuntia Accessions from Tenerife (Canary Islands, Spain) Using UPOV Descriptors
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 7
10.3390/horticulturae10070664
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development and Evaluation of a Trichoderma-Based Bioformulation for Enhancing Sustainable Potato Cultivation

by
Angelo Napolitano
1,
Mauro Senatore
1,
Simone Coluccia
2,3,
Francesca Palomba
1,
Margherita Castaldo
1,4,
Teresa Spasiano
1,
Alessio Giovanni Avino
1,
Andrea Vitale
5,
Antonello Bonfante
5,
Adriana Sacco
1,* and
Michelina Ruocco
1
1
Institute for Sustainable Plant Protection (IPSP), National Research Council of Italy (CNR), Piazzale Enrico Fermi 1, 80055 Portici, Italy
2
Department of Biological Sciences, University of Naples Federico II, Complesso Universitario di Monte Sant’Angelo, Via Cinthia 7, 80126 Naples, Italy
3
Centro Ricerche & Sviluppo Centro Direzionale, Oasis s.r.l., 80143 Naples, Italy
4
Department of Chemical Sciences, University of Naples Federico II, Complesso Universitario di Monte Sant’Angelo, Via Cinthia 21, 80126 Naples, Italy
5
Institute for Mediterranean Agricultural and Forest Systems, National Research Council of Italy (CNR), ISAFOM, 80055 Portici, Italy
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(7), 664; https://doi.org/10.3390/horticulturae10070664
Submission received: 20 May 2024 / Revised: 14 June 2024 / Accepted: 18 June 2024 / Published: 22 June 2024
Browse Figures
Review Reports Versions Notes

Abstract

:
The potato (Solanum tuberosum) is one of the most widespread and cultivated Solanaceae in the world. To overcome the increasing problems of intensive cultivation and climate change, finding new strategies to guarantee the needs of today and future generations has become mandatory. The use of biostimulants based on Trichoderma spp. can be an excellent alternative to reduce the use of pesticides, as well as to mitigate the effects of biotic and abiotic stresses. In this study we evaluated the effects of a new bioformulation containing two Trichoderma strains on potato growth and yield. Trichoderma strains were characterised morphologically and molecularly. Application of the new bioformulate was able to promote potato plant growth and caused a significant increase in plant fresh (+107%) and dry weight (+74%), and potato tuber fresh weight (+37%) and number (+41%), and it also improved potato yield (+36%). These findings suggest that the bioformulation is a viable alternative to reduce pesticide use and mitigate biotic and abiotic stress in potato cultivation.

1. Introduction

The potato (Solanum tuberosum) is one of the most widespread and cultivated Solanaceae in the world due to its nutritional properties and its wide adaptability to new growing environments as well as its easy affordability [1]. Although the potato is of South American origin, the continent with the highest potato production between 2012 and 2019 was Asia with 51.1% of world production, followed by Europe (29%) and the Americas (12.2%) [2]. As one of the most widespread intensive crops in the world, the effects and consequences of its intensive cultivation cannot be overlooked, such as loss of organic matter, soil erosion, pollution caused by using synthetic pesticides (such as insecticides fungicides or fertilisers), acidification or salinisation of soils, and loss of genetic biodiversity.
The damage caused by this type of intensive cultivation has already occurred in some places on the planet [3,4]. To contain these problems, in line with the European Green Deal, the sustainable management of environmental resources poses the basis for sustainable economic development, placing the agricultural sector at the centre of the ecological transition of the European continent [5]. Therefore, preserving biodiversity, ecosystems and natural resources while at the same time ensuring food safety and sustainability has become mandatory today [6]. Furthermore, the potato is one of the most vulnerable crops in changing climates, with events such as long-lasting droughts, extreme heat, and unanticipated frosts [7,8]. Although crop management practices cause about 67% of the variations in potato yields, climate change is a significant challenge faced by the agricultural sector [9]. Potato development stages, such as sprouting, emergence, and leaf area development, are temperature sensitive. Temperature thresholds and photoperiod sensitivity are vital in determining the development of potatoes and initiating potato tuber induction, and vary with potato varieties. When the temperature exceeds 30 °C, it can cause slow tuber initiation and development and physical damage to the tubers [10]. Meanwhile, the elevation of CO2 increases the rate of potato susceptibility to pests and diseases and yields phenology, causing interferences between implemented and natural biological processes [8,11]. Finding new strategies to guarantee the needs of today and future generations is now a key point of agricultural research [12]. The use of biostimulants based on a Biocontrol Agent (BCA) such as Trichoderma spp. can be an excellent alternative to reduce the use of pesticides, as well as to mitigate the effects of biotic and abiotic stress. Several Trichoderma spp. are registered as microbial biological control agents in Plant Protection Products commercialized for the control of a broad-spectrum plant diseases [13,14]. In nature, Trichoderma spp. are ubiquitous, and are capable of surviving in the rhizosphere as a skilled competitor towards other phytopathogens. Numerous studies have demonstrated a biocontrol activity of the Trichoderma genus against Fusarium spp. and Rizoctonia solani which can cause huge losses in potato cultivation [15]. The adaptive behaviour of the Trichoderma genus is due to its ability to modify the rhizosphere conditions in its favour producing siderophores for iron chelation, or competing for the main source of carbohydrates in soil, limiting factors for the growth of other microorganisms [16]. Competition is only one mode of survival implemented by the Trichoderma genus. In fact, its properties of producing antibiotic substances (antibiosis), such as metabolites of a volatile or non-volatile nature which limit the growth of other phytopathogens, are also known. The production of these secondary metabolites is specific to each species and includes compounds such as arzianic acid, alameticins, tricolines, antibiotic peptaibols, 6-penthyl-α-pyrone, massoylactone, viridine, gliovirine, glisoprenins, and heptelidic acid [15,16,17]. Mycoparasitisation occurs when Trichoderma spp. comes into contact with the host, after anchoring through the formation of appressoria on the surface of the target. In the anchoring sites of the appressoria there will be the formation of hyphae which produce hydrolytic enzymes (chitinases) that are necessary for the degradation of the host’s cell wall [18]. Some species of Trichoderma, interacting with the host plant, influence the physiology, morphology, and metabolomics of the plants. Studies relating to the impact of Trichoderma interaction with plants have highlighted a significant effect on many horticultural crops such as melon, tomato, cucumber, eggplant, pea, lettuce, rocket, beans, and ornamental plants [18,19,20,21,22,23,24]. Also, Trichoderma spp. promotes the absorption of nitrogen and the solubilisation of phosphorus, increasing the yield even in the absence of fertilization [25], such as increasing the efficiency of use of water, reducing the stomatal opening of plants, and increasing chlorophyll photosynthesis [26]. Defined as an avirulent opportunistic plant symbiont, Trichoderma spp. manages to penetrate and colonize the roots, establishing a symbiotic relationship. Its ability to split sucrose through invertase and therefore to use the products deriving from hydrolysis as a carbon source favours its capacity as a colonizer [27]. One of the main effects due to the plant colonisation of Trichoderma spp. is the induction of Induced Systemic Resistance (ISR), an indirect defence mechanism activated by genes that encode the production of proteins linked to the production of hormones such as Salicylic Acid (SA) or Jasmonic Acid (JA) and Ethylene (ET) as a primary signal of host resistance following the production of antimicrobial metabolites [18,28]. In addition, an integrated approach combining BCAs with fungicides is put forward to reduce the fungicide doses to manage plant diseases and thereby their residue on harvested crops. However, to allow large-scale implementation of the use of a new bioformulate, further knowledge is needed, comprising the timing, number, and interval of repeated BCA applications and their compatibility with fungicides [29].
The goal of the present study was to evaluate the effects of a mix of two new selected strains of Trichoderma in the sustainable management of potato cultivation evaluating the impact of the bioformulation on the quality and quantity of production.

2. Materials and Methods

2.1. Trichoderma spp. Evaluation and Bioformulation

Two strains of Trichoderma from the collection of CNR-IPSP were characterised at the morphological and molecular levels. Strains (1A and 1B) were grown on petri dishes with Potato Dextrose Agar (PDA) and then placed at 25 °C for about 7 days to allow mycelial development and sporulation.

2.1.1. Morphological Characterisation of Trichoderma Isolates

The morphological traits (mycelium structure, conidiophores, and conidia) were observed directly by a ZEISS Axiovert 5 digital inverted light microscope (ZEISS, Jena, Germany), equipped with fluorescence, brightfield, and phase-contrast vision. The structures, in both observation modes, were described by comparing them with those reported in appropriate taxonomic keys [30,31]. Conidia and conidiophores lengths were recorded using ImageJ v 1.53, a Sun-Java-based digital image processing computer program. The spores of each strain were collected in 50 mL tubes using distilled water. Counting was performed using Burker’s chamber (depth 0.100 mm), and 10 µL of the spore suspension was loaded onto the counting chamber and visualised under a 40× magnification. Spore concentration was calculated by the following formula (specific to the counting chamber used):
S t o t N × 2.5 × 10 5 × dilution factor
N = number of cells observed; Stot = total number of spores observed.

2.1.2. Molecular Analysis of Trichoderma Isolates

The genomic DNA of the two fungal isolates was obtained using Qiagen’s DNeasy® Plant Pro kit (Qiagen, Hilden, Germany, EU) following the manufacturer’s instructions. The DNA was quantified with a Thermo Fisher Scientific’s Nanodrop 2000 spectrophotometer (ThermoFisher scientific, Waltham, MA, USA) and then amplified by PCR, using the Promega GoTaq® G2 DNA Polymerase kit (Promega, Madison, WI, USA) in a total volume of 25 µL. Reactions were subjected to an initial denaturation of 3 min at 95 °C, followed by 40 cycles of 45 s at 95 °C, 45 s at 58 °C, and 1 min at 72 °C, with a final extension of 10 min at 72 °C in a MiniAmp thermal cycler (ThermoFisher scientific, Waltham, MA, USA). For the molecular identification we used ITS, TEF1, and TRI-ACT genes. Primer sequences are reported in Table 1. The presence of the amplificated fragments was verified by electrophoresis on 1% agarose gel. Purification of the PCR products was performed using the Bioline ISOLATE II PCR and Gel Kit (Bioline, Memphis, TN, USA) following the supplier’s protocol. The obtained DNA was quantified by both Qubit fluorometer and NanoDrop 2000 spectrophotometer (ThermoFisher scientific, Waltham, MA, USA). The samples were sequenced by the company Eurofins Genomics LLC (Ebersberg, Germany, EU) through Sanger sequencing. The GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to compare the obtained sequences with those in the GenBank database.

2.1.3. Dual-Plate Bioassay

In vitro antagonism tests were set up to evaluate the mycoparasitic activity of the two Trichoderma strains against four different fungal pathogens (Sclerotinia sclerotiorum, Fusarium oxysporum, Aspergillus sp. and Botrytis cinerea). Biocontrol assays were established by inoculating 10 µL of spore suspension (1 × 105 spores⋅mL−1) of the selected pathogen (except for S. sclerotiorum for which sclerotia were used) in the middle of the half-circle of the PDA petri dish. After 24 h, 10 µL of spore suspension (1 × 105 spores⋅mL−1) of each Trichoderma strain were inoculated at diametrically opposite points of the same plates.
Biocontrol assays were followed according to the different growth requirements of the selected pathogen. The fungal growths were measured with a ruler (mm) every 24 h, up to the day of contact between the mycelium of the pathogen and the antagonist. The experiment was conducted in independent triplicates. Single cultures of the pathogens were used as control plates. The inhibitory effect of Trichoderma isolates was assessed by estimating the percentage (%) reduction on pathogen growth in the presence of the antagonist, according to the following formula: (D − d)/D × 100, where D is the estimate of radial growth of a pathogen in the control sample and d is the estimate of radial growth of a pathogen in the bi-culture [32].

2.1.4. Trichoderma–Fungicide Interaction

In vitro studies were conducted to test the resistance of the two Trichoderma isolates against three commercial fungicides: Talendo® (Proquinazid, Corteva Agriscience™, Indianapolis, IN, USA); Lidal® (Tetraconazole, Corteva Agriscience™); and Biomic (Tannins, Nuovo Mondo Bio s.n.c., Soriano nel Cimino, Italy). Briefly, 10 µL of a spore suspension 1 × 105 spores mL−1 were inoculated in the centre of the petri dish containing PDA mixed with the single fungicide according to the label dose. Control samples were made, inoculating Trichoderma isolates on PDA plate. The experiment was conducted in independent triplicates. Following the inoculations, the plates were incubated at 25 °C and the radial growth of the various species was measured every 24 h for 7 days using a ruler (mm). The percentage of growth inhibition by the fungicide was calculated as previously reported for the dual-plate bioassay.

2.1.5. Bioformulation of Trichoderma Isolates

For the preparation of the new bioformulate (SOSTATA W), the two Trichoderma strains (1A and 1B) were inoculated into flasks containing Potato Dextrose Broth (PDB) and left to grow in a rotating incubator at 25 °C for 7 days at 150 rpm. The liquid suspension was used to inoculate rice (Oryza spp.), used as carrier previously autoclaved in a polypropylene zipper filter bag. The bags were incubated for at least one month at 25 °C in the dark. Rice completely covered with spores was distributed in the field as previously described in Section 2.1.

2.2. Experimental Field

During the seasons 2022 and 2023, three experimental Italian fields located in Cervinara (AV), Maddaloni (CE), and Avezzano (AQ) were cultivated with different potato cultivars. Also, in 2023 two more fields located at Acerra (NA) and Airola (BN) were included in the trials (Table 2).
The experimental study was designed to compare three treatments: (i) cultivation usually adopted by the farmer, Control (C); (ii) cultivation using a commercial Trichoderma product, Micosat (CCS Aosta srl) (O); and (iii) cultivation using a new Trichoderma formulation, SOSTATA (W). A repeated blocks design was used for the experiment. The new bioformulate was made using two Trichoderma strains selected from the collection of the Institute for Sustainable Plant Protection (IPSP) of the National Research Council (CNR). The bioformulate was distributed at 30 kg⋅ha−1 along the furrow near the tuber contemporary to the sowing, while Micosat was used following the instructions on the label. The potato cultivars evaluated for the purpose of the experimental design were: Inova, Colomba, Agata, and Cicero in ascending order of maturity or relative earliness of the ripening cycle. The experimental fields located in the Campania region (Airola, Cervinara, Maddaloni, and Acerra) had sandy loam soil, while the Avezzano field from the Abruzzo region was a clayey soil. The weather conditions were variable not only among the different sites but even more between the two years of the trial (Table 2).

2.3. Plant Response Evaluation

To evaluate the effectiveness of treatments, at the phenological stage of tuber swelling, five plants randomly collected from each thesis with their respective tubers were harvested to assess (i) plant fresh weight, (ii) potato tuber number, (iii) potato tuber fresh weight, and (iv) plant dry weight. Production was recorded at the end of the potato cultivation cycle.
Furthermore, in the experimental field of Cervinara, we assessed the plants’ response to different treatments using a UAV multispectral flight (DJI Phantom multispectral, five bands: blue, green, red, red edge, and near-infrared (NIR)) conducted during the growing season on 20 June 2023. The images collected were processed with PIX4DMapper software v. 1.58.2 to calculate vegetative indices (such as NDVI and GNDVI) and to measure the crop elevation in each experimental plot.
The Normalized Difference Vegetation Index (NDVI) measures the amount of live green vegetation in an area, calculated from the visible and near-infrared light reflected by vegetation. The index ranges from −1 to 1, with higher values indicating denser and healthier vegetation, and it is calculated as follows:
NDVI = (NIR − red)/(NIR + red)
The Green Normalized Difference Vegetation Index (GNDVI) is a measure of a plant’s “greenness” or photosynthetic activity. It utilises the near-infrared (NIR) and green bands of the electromagnetic spectrum. The index ranges from −1 to 1, with higher values indicating denser and healthier vegetation, and it is calculated as follows:
GNDVI = (NIR − green)/(NDVI + green)

2.4. Statistical Analysis

All data were subjected to statistical analysis. Statistical analysis was performed using the IBM® SPSS® Statistics software (SPSS 28.0). The significance of the bioformulation application (Control (C); Micosat (O); and SOSTATA (W)) over two consecutive field trials (2022 and 2023) was determined by comparing mean levels among treatments using a One-Way Analysis of Variance (ANOVA) with Tukey’s HSD post hoc test at p = 0.05.

3. Results

3.1. Morphological and Molecular Characterisation of Trichoderma Isolates

A pure culture of the two Trichoderma isolates 1A and 1B was obtained on PDA petri dishes. The 1A isolate shows as white mycelium of spongy consistency and irregular growth with granule conidiation and scattered conidial masses (Figure 1a); the 1B isolate exhibits a concentric ring structure with a dark green pustular central zone bordering a light green ring, a light intermediate zone, and a light green peripheral ring (Figure 1d). The morphological analysis aligns with characteristics typical of the Trichoderma genus. Several Trichoderma isolates have exhibited abundant fluffy mycelium, with two to three distinct concentric rings of white mycelium and green conidia [33]. Other characteristics that define the genus Trichoderma are a fast growth in culture medium and development of conidia with a green-yellow colour [34]. These characteristics are similar to several Trichoderma species, so it was difficult to identify the isolates based only on morphological data [35]. The microscopic observation of isolate 1A showed branched and elongated conidiophores placed at different angles, on which 8 µm flask-like phialides were inserted, and ellipsoidal conidia (3.8 L–2.4 L µm) were highlighted (Figure 1b,c); meanwhile, the isolate 1B had compact, broad-branched conidiophores that assumed a pyramidal structure with 8 µm flask-like phialides. Conidia varied from globose (1.4 d µm) to sub-globose (1.9 D–1.3 d µm) (Figure 1e,f).
As a result of the molecular analysis using the three gene markers (ITS; EF1; and ACT), we classified the two isolates at the species level as Trichoderma asperelloides (1A) and Trichoderma harzianum (1B). In Figure 2a neighbour-joining tree constructed with MEGA X software v. 10.2.4 is shown.

3.2. Dual-Plate Bioassay

The mycoparasitic effect of T. asperelloides (1A) and T. harzianum (1B) was carried out with a dual-plate technique against agriculturally important plant pathogens such as Sclerotinia sclerotiorum, Fusarium oxysporum, Aspergillus sp., and Botrytis cinerea. As shown in Figure 3, the pathogen inhibition effect of T. asperelloides isolate 1A ranged from 21% against Asperigillus sp. to a maximum of 36% when competing with F. oxysporum. The T. harzianum isolate 1B instead showed a more variable mycoparasitic behaviour with inhibition percentages ranging from a minimum of 0% in competition with B. cinerea to a maximum of 100% against Aspergillus sp.

3.3. Trichoderma–Fungicide Interaction

Of the three fungicides tested at label doses, Lidal (Tetraconazole) proved to be the most effective in inhibiting the growth of the two Trichoderma strains leading, after 7 days, to 100% and 54% of growth inhibition of T. asperelloides (1A) and T. harzianum (1B), respectively. Talendo (Proquinazid) and Biomic (Tannins) proved not to be effective in inhibiting growth of the two Trichoderma strains, recording a percentage of inhibition equal to 0% for both (Table 3).

3.4. Evaluation of Morphological Plant Parameters and Yield

The parameters analysed were (i) plant fresh weight, (ii), potato tuber fresh weight (iii) plant dry weight, and (iv) potato tuber numbers. Significant differences among the treatments were found. Figure 4 reports the means of five plants per treatment in three different fields over two consecutive years of the experiment. In the 2023 season, two more fields located at Acerra (NA) and Airola (BN) were included in the trials. Comprehensively, our results showed that the treatment with the new bioformulate (SOSTATA W) had positively increased the parameters observed while the commercial biostimulant Micosat (O) had no significant impact on crop development. Field blocks treated with the new bioformulates had higher canopies and more vigorous plants.
In particular, for plant fresh weight, the SOSTATA (W) treatment showed an average weight of 598.2 (±5.07) g/plant, significantly different from the farm Control (C) which was 288.4 (±2.68) g/plant. The potato tuber fresh weight of the SOSTATA (W) treatment (1059.5 ± 6.13) g/plant) was significantly greater than the Control (744.6 ± 10.75 g/plant) and interestingly also with respect to the Micosat (O) treatment (732.8 ± 4.9 g/plant).
Looking at the plant dry weight values, the difference between SOSTATA (W) treatment (57.3 ± 0.38 g/plant) and the farm Control (C) (32.8 ± 0.35 g/plant) was significant as well as for the number of potatoes obtained, with an average of 14.4/plant and of 10.16/plant tubers for SOSTATA (W) and farm Control (C) treatment, respectively.
Figure 5 shows the collected data related to the two-year production of the three experimental fields. Also, in this case the SOSTATA (W) treatment was able to increase production by 20% and 36% compared to Micosat (O) and Control (C), respectively.

4. Discussion

To evaluate the potential of Trichoderma spp. as possible BCAs to promote plant growth and production in potato cultivation, two new Trichoderma strains were identified and used to treat experimental potato fields. The two Trichoderma strains were previously tested in vitro for their mycoparasitic activity and resistance to fungicides. The results of the in vitro competition assays against four selected pathogens showed different results in relation to the strains tested and the pathogen used. Even variation within one species was reported by Metz and Hausladen [36]; Consolo et al. [37]; and El-gamal et al. [38]. They tested the inhibitory effect of several T. harzianum strains against Alternaria solani isolates from potato and tomato, respectively. Also, the ability to inhibit the growth of pathogens such as F. oxysporum, B. cinerea and Aspergillus spp., which were used in our research, was reported by Bhale and colleagues [39] even with different fates, underlining the fact that the inhibition capacity is strictly dependent on the strain of Trichoderma tested. For example, Zhang et al. [40] reported 75% and 82% in vitro mycelial growth inhibition of B. cinerea and R. solani respectively, caused by T. longibrachiatum. Qualhato et al. [41] also found good results of mycelial growth inhibition of S. sclerotiorum, R. solani, and Fusarium solani when using different Trichoderma species. Additionally, Amin et al. [42] reported that Tricoderma viride highly inhibited the mycelial growth of R. solani, Sclerotium rolfsii, and S. sclerotiorum in comparison with T. harzianum. These findings underline the importance of a broad approach to evaluating the growth inhibition potential of different Trichoderma species on plates. In general, the results from the comparison vary with the Trichoderma isolate and with the phytopathogen accordingly, with results shown in this work.
To inhibit fungal pathogens, fungicides have been developed to target different components or mechanisms of the fungal cell, including respiration, nucleic acid metabolism, cell membrane integrity, protein synthesis, signal transduction, and cell mitosis [43]. However, most fungicides perform without distinguishing between harmful pathogens and nontarget organisms such as beneficial micro-organisms [44]. As such, fungicides could impact the growth of BCAs or reduce their population size, making biocontrol treatment ineffective. Previous studies have reported that fungicides combined with biocontrol agents can inhibit pathogens or improve the disease resistance of plants [45]. Myresiotis et al. [46] reported that the combination of plant growth-promoting rhizobacteria and hymexazol could effectively control Fusarium crown and root rot on tomatoes. Our findings on the compatibility of the two Trichoderma strains (1A and 1B) with three fungicides showed a complete inhibition from Lidal (Tetraconazole), while Talendo (Proquinazid) and Biomic (Tannins) were ineffective. Selvakumar et al. [47] also demonstrated the limited inhibitory effects of tannins. They found that T. virescens and T. reesii were able to tolerate up to 3000 ppm of crude tannins extracted in water and acetone without experiencing any growth inhibition. Progressive growth inhibition of T. virescens and T. reesii occurred as the tannins themselves increased. Hence, the resistance of the strains employed in this study to specific fungicides could aid in comprehending the optimal utilization of the antagonistic capabilities of T. harzianum 1B and T. asperelloides 1A. However, new studies must be conducted in planta to better establish the limits of each strain and to enable their use in integrated disease management.
Trichoderma spp. can even exert positive effects on plants with an increase in plant growth (biofertilization) and the stimulation of plant-defence mechanisms [17]. The use of biostimulants based on Trichoderma spp. is widespread due to Trichoderma‘s ability to promote plant growth in most agroecosystems with positive effects on the plant biomass, both epigeal and hypogeal [48]. For example, a study conducted on passion fruit showed that plants treated with Trichoderma had a greater leaf surface, greater biomass, and a greater commercial yield [49], as well as Trichoderma treatment having positive effects on tests carried out on wheat, in which a greater plant height, leaf length, root length, and tip length were recorded [50]. To assess the beneficial effects of Trichoderma treatment on plant growth and production, we collected data on morphological parameters such as plant fresh weight, plant dry weight, tuber dry weight, number of tubers per plant, and yield expressed in kg⋅ha−1. From the obtained results, the treatment with the SOSTATA (W) bioformulate showed significant differences compared to the control for all the morphological traits analysed. Application of the new bioformulate was able to promote potato plant growth, and caused a significant increase in plant fresh (+107%) and dry weight (+74%), potato tuber fresh weight (+37%) and number (+41%). In addition, for potato fresh weight, significant differences between the SOSTATA (W) treatment and Micosat (O) were found. Furthermore, the plants treated with SOSTATA (W) showed an increased production of 20% and 36% compared to Micosat (O) and Control (C) treatments, respectively. The data obtained are in line with other studies carried out both in a protected environment and in the open field. In fact, as reported by Contreras-Liza et al. [51], the inoculation of Trichoderma both in vitro and in the greenhouse promoted the growth of potato seedlings in vitro and significantly improved the height of the potato plant, increasing the size, calibre, and weight of seed tubers and plant biomass. Similar results were obtained by M. Rakibuzzaman et al. [48] where the ability to promote the growth of potato plants was evaluated in vivo, using different concentrations of Trichoderma compared to the control. The increase in production compared to untreated plants was 11.33% and 23.82% depending on the concentration of the treatment, and was due to an improvement in the dry matter content. The beneficial effects of the interaction of T. harzianum with S. tuberosum phureja was also evaluated in South America by Galindo et al. [52] where an increase in biomass of 30% to 38% compared to the control was highlighted. Application of a select microbial product composed of a consortium of Bacillus subtilis and T. harzianum effectively suppressed common scab disease and increased tuber yield by establishing a high relative abundance of beneficial bacteria in the rhizosphere as reported by Wang et al. [53]. An increase in potato tuber number and weight was also reported by J. Constantia and colleagues (2023) [54] using the commercial bioformulation TrichoPowder (Trichoderma sp.) and plant growth promoting rhizobacteria (PGPR). Ommati et al., [55] tested six species of Trichoderma inoculated together with F. oxysporum to evaluate the combined effect on the potato yield. The results showed that plants co-inoculated with Trichoderma and Fusarium had higher production compared to plants inoculated only with the pathogen. Lastly, the results obtained from vegetation indices (NDVI and GNDVI) computed from spectral UAV data show a spatial variability that is in good agreement with the production variability observed with treatments. As shown in Figure 6, both average NDVI and GNDVI showed the highest values for the SOSTATA treatment (0.73 ± 0.09 and 0.57 ± 0.07 respectively), with similar but lower values for the Micosat (0.72 ± 0.09 and 0.56 ± 0.06 respectively) and Control (0.70 ± 0.09 and 0.54 ± 0.06 respectively). Regarding the crop elevation variability, we estimated 0.24 ± 0.07 m for the control, 0.27 ± 0.08 m for the Micosat treatment, and 0.24 ± 0.09 m for the SOSTATA treatment.
Today, we can assert that there is sufficient scientific evidence confirmed with this research to prove that through the symbiosis between potato plants and microorganisms, it is possible to reduce the use of high energy consumption inputs with a negative environmental impact, such as fertilizers and agrochemicals, mitigating their harmful effects on the ecosystem [47]. A huge barrier in the study of potential biopesticides is the precise understanding and determination of their modes of action, i.e., their interactions in dynamic systems, composed of antagonistic organisms, pathogens, and plants [56,57,58]. In addition to climatic conditions, interactions with autochthonous microorganisms present in an environment may adversely affect the efficacy of microorganisms included in biopreparations [59]. According to Kubiak et al. [60], the main environmental factors affecting the activity and survival of beneficial microorganisms, including their sporulation processes, include temperature, humidity, acidification of the substrate, and availability of nutrients. The main challenge here is to select microbes that will show high tolerance to changing climatic conditions [58] and resistance to chemical pesticides.

5. Conclusions

The results of this study suggest the beneficial potential of two new Trichoderma strains in the sustainable management of potato cultivation. Through morphological and molecular analyses, the new Trichoderma isolates were identified as T. asperelloides (1A) and T. harzianum (1B). The in vitro trials both for antagonist capacity and fungicide resistance showed that these isolates can be good biocontrol agent candidates to be used in field application and also in integrated management. Moreover, the application of SOSTATA (W) bioformulate was able to promote potato plant growth and caused a significant increase in fresh and plant dry weight, and potato tuber fresh weight and number, improving overall potato yield. Our findings demonstrate how useful it is to exploit biodiversity in terms of species and strains of beneficial microorganisms for providing new solutions with low environmental impact in intensive cultivation.

Author Contributions

Conceptualization, A.S. and M.R.; methodology, A.N., M.S. and F.P.; software, A.N., S.C. and M.C.; validation, A.N., A.V. and A.B.; formal analysis, A.N. and A.S.; investigation, A.N.; A.G.A. and T.S.; writing—original draft preparation, A.N.; writing—review and editing, A.S.; visualization, A.N. and A.S.; supervision, A.S. and M.R.; project administration, M.R.; funding acquisition, M.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by: H2020—PON 2020/2023, D.M. 1 June 2016 e D.D. 4/08/2016 (MISE, 2020-2023): Development of new technologies in precision agriculture for the sustainable production of potato genotypes with high nutritional qualities (SOS-TATA) (CUP B71B19000680008) and the National Recovery and Resilience Plan (NRRP), Mission 4 Component 2 Investment 1.3—Call for proposals No. 341 of 15 March 2022 of Italian Ministry of University and Research funded by the European Union—NextGenerationEU; Award Number: Project code PE00000003, Concession Decree No. 1550 of 11 October 2022 adopted by the Italian Ministry of University and Research, CUP D93C22000890001, Project title “ON Foods—Research and innovation network on food and nutrition Sustainability, Safety and Security—Working ON Foods”.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author

Acknowledgments

We thank Ettore Magaldi and Salvatore Cristadoro for the administrative support and the Coppola patate srl company.

Conflicts of Interest

Author Simone Coluccia was employed by the company Oasis s.r.l. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Devaux, A.; Goffart, J.P.; Petsakos, A.; Kromann, P.; Gatto, M.; Okello, J.; Suarez, V.; Hareau, G. Global Food Security, Contributions from Sustainable Potato Agri-Food Systems. In The Potato Crop, 1st ed.; Campos, H., Ortiz, O., Eds.; Springer Nature: Cham, Switzerland, 2020; Volume 1, pp. 3–35. [Google Scholar] [CrossRef]
  2. Soare, E.; Chiuciu, I.A. Study on the Dynamics of potato Production and worldwide trading during the period 2012–2019. Sci. Pap. Ser. Manag. Econ. Eng. Agric. Rural Dev. 2021, 21, 1–5. [Google Scholar]
  3. Ramankutty, N.; Mehrabi, Z.; Waha, K.; Jarvis, L.; Kremen, C.; Herrero, M.; Rieseberg, L.H. Trends in Global Agricultural Land Use: Implications for Environmental Health and Food Security. Annu. Rev. Plant Biol. 2019, 69, 789–815. [Google Scholar] [CrossRef] [PubMed]
  4. Kopittke, P.M.; Menzies, N.W.; Wang, P.; McKenna, B.A.; Lombi, E. Soil and the intensification of agriculture for global food security. Environ. Int. 2019, 132, 105078. [Google Scholar] [CrossRef] [PubMed]
  5. Szpilko, D.; Ejdys, J. European green deal—Research directions. a systematic literature review. Econ. Environ. 2021, 81, 8–38. [Google Scholar]
  6. Gustavsen, G.W. Sustainability and Potato Consumption. Potato Res. 2021, 64, 571–586. [Google Scholar] [CrossRef]
  7. Jennings, S.A.; Koehler, A.K.; Nicklin, K.J.; Deva, C.; Sait, S.M.; Challinor, A.J. Global Potato Yields Increase Under Climate Change with Adaptation and CO2 Fertilisation. Front. Sustain. Food Syst. 2020, 4, 519324. [Google Scholar] [CrossRef]
  8. Quiroz, R.; Ramírez, D.A.; Kroschel, J.; Andrade-Piedra, J.; Barreda, C.; Condori, B.; Mares, V.; Monneveux, P.; Perez, W. Impact of Climate Change on the Potato Crop and Biodiversity in Its Center of Origin. Open Agric. 2018, 3, 273–283. [Google Scholar] [CrossRef]
  9. Maqsood, J.; Farooque, A.A.; Wang, X.; Abbas, F.; Acharya, B.; Afzaal, H. Contribution of Climate Extremes to Variation in Potato Tuber Yield in Prince Edward Island. Sustainability 2020, 12, 4937. [Google Scholar] [CrossRef]
  10. Raymundo, R.; Asseng, S.; Cammarano, D.; Quiroz, R. Potato, Sweet Potato, and Yam Models for Climate Change: A Review. Field Crops Res. 2014, 166, 173–185. [Google Scholar] [CrossRef]
  11. Haverkort, A.J.; Verhagen, A. Climate Change and Its Repercussions for the Potato Supply Chain. Potato Res. 2008, 51, 223–237. [Google Scholar] [CrossRef]
  12. Jhariya, M.K.; Banerjee, A.; Meena, R.S.; Yadav, D.K. Agriculture, Forestry and Environmental Sustainability: A Way Forward, 1st ed.; Springer Nature: Singapore, 2019; pp. 1–29. [Google Scholar]
  13. Woo, S.; Ruocco, M.; Vinale, F.; Nigro, M.; Marra, R.; Lombardi, N.; Pascale, A.; Lanzuise, S.; Manganiello, G.; Lorito, M. Trichoderma-based products and their widespread use in agriculture. Open Mycol. J. 2014, 8, 71–126. [Google Scholar] [CrossRef]
  14. Harman, G.E. Overview of mechanisms and uses of Trichoderma spp. Phytopathology 2006, 96, 190–194. [Google Scholar] [CrossRef] [PubMed]
  15. Bhandari, S.; Pandey, K.; Roshi, Y.R.; Lamichhane, S.K. An overview of multifaceted role of Trichoderma spp. for sustainable agriculture. Arch. Agric. Environ. Sci. 2021, 6, 72–76. [Google Scholar] [CrossRef]
  16. Waghunde, R.R.; Shelakea, R.M.; Sabalpara, A.N. Trichoderma: A significant fungus for agriculture and environment. Afr. J. Agric. Res. 2016, 11, 1952–1965. [Google Scholar]
  17. Benítez, T.; Rincón, A.M.; Limón, M.C.; Codón, A.C. Biocontrol mechanisms of Trichoderma strains. Int. Microbiol. 2004, 7, 249–260. [Google Scholar]
  18. Harman, G.E.; Howell, C.R.; Viterbo, A.; Chet, I.; Lorito, M. Trichoderma species—Opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2004, 2, 43–56. [Google Scholar] [CrossRef] [PubMed]
  19. Rouphael, Y.; Carillo, P.; Colla, G.; Fiorentino, N.; Sabatino, L.; El-Nakhel, C.; Giordano, M.; Pannico, A.; Cirillo, V.; Shabani, E.; et al. Appraisal of Combined Applications of Trichoderma Virens and a Biopolymer-Based Biostimulant on Lettuce Agronomical, Physiological, and Qualitative Properties under Variable N Regimes. Agronomy 2020, 10, 196. [Google Scholar] [CrossRef]
  20. Martínez-Medina, A.; del Mar Alguacil, M.; Pascual, J.A.; van Wees, S.C.M. Phytohormone Profiles Induced by Trichoderma Isolates Correspond with Their Biocontrol and Plant Growth-Promoting Activity on Melon Plants. J. Chem. Ecol. 2014, 40, 804–815. [Google Scholar] [CrossRef]
  21. Gravel, V.; Antoun, H.; Tweddell, R.J. Growth Stimulation and Fruit Yield Improvement of Greenhouse Tomato Plants by Inoculation with Pseudomonas Putida or Trichoderma Atroviride: Possible Role of Indole Acetic Acid (IAA). Soil. Biol. Biochem. 2007, 39, 1968–1977. [Google Scholar] [CrossRef]
  22. MacKenzie, A.J.; Starman, T.W.; Windham, M.T. Enhanced Root and Shoot Growth of Chrysanthemum Cuttings Propagated with the Fungus Trichoderma harzianum. HortScience 1995, 30, 496–498. [Google Scholar] [CrossRef]
  23. Ousley, M.A.; Lynch, J.M.; Whipps, J.M. Potential of Trichoderma spp. as Consistent Plant Growth Stimulators. Biol. Fertil. Soils 1994, 17, 85–90. [Google Scholar] [CrossRef]
  24. Yedidia, I.; Benhamou, N.; Chet, I. Induction of Defense Responses in Cucumber Plants (Cucumis sativus L.) by the Biocontrol Agent Trichoderma Harzianum. Appl. Environ. Microbiol. 1999, 65, 1061–1070. [Google Scholar] [CrossRef] [PubMed]
  25. Caruso, G.; El-Nakhel, C.; Rouphael, Y.; Comite, E.; Lombardi, N.; Cuciniello, A.; Woo, S.L. Diplotaxis tenuifolia (L.) DC. Yield and Quality as Influenced by Cropping Season, Protein Hydrolysates, and Trichoderma Applications. Plants 2020, 9, 697. [Google Scholar] [CrossRef]
  26. Visconti, D.; Fiorentino, N.; Cozzolino, E.; Woo, S.L.; Fagnano, M.; Rouphael, Y. Can Trichoderma-Based Biostimulants Optimize N Use Efficiency and Stimulate Growth of Leafy Vegetables in Greenhouse Intensive Cropping Systems. Agronomy 2020, 10, 121. [Google Scholar] [CrossRef]
  27. Abdullah, N.S.; Doni, F.; Mispan, M.S.; Saiman, M.Z.; Yusuf, Y.M.; Oke, M.A.; Suhaimi, N.S.M. Harnessing Trichoderma in Agriculture for Productivity and Sustainability. Agronomy 2021, 11, 2559. [Google Scholar] [CrossRef]
  28. Amuza, A.C.; Zaharia, R. Trichoderma spp. Mechanisms of action in the control of storage pathogens review. Horticulture 2022, 66, 781–790. [Google Scholar]
  29. Risoli, R.; Cotrozzi, L.; Sarrocco, S.; Nuzzaci, M.; Pellegrini, E.; Vitti, E. Trichoderma-Induced Resistance to Botrytis cinerea in Solanum Species: A Meta-Analysis. Plants 2022, 11, 180. [Google Scholar] [CrossRef]
  30. Ons, L.; Bylemans, D.; Thevissen, K.; Cammue, B.P.A. Combining Biocontrol Agents with Chemical Fungicides for Integrated Plant Fungal Disease Control. Microorganisms 2020, 8, 1930. [Google Scholar] [CrossRef]
  31. Gams, W.; Bissett, J. Morphology and Identification of Trichoderma. Trichoderma and Gliocladium. In Basic Biology, Taxonomy and Genetics, 1st ed.; Kubicek, C.P., Harman, G.E., Taylor & Francis Ltd., Eds.; Gunpowder Square: London, UK, 2002; pp. 3–31. [Google Scholar]
  32. Siddiquee, S. Morphology-Based Characterization of Trichoderma Species. In Practical Handbook of the Biology and Molecular Diversity of Trichoderma Species from Tropical Regions, 1st ed.; Gupta, V.K., Tuohy, M.G., Eds.; Springer International Publishing: Cham, Switzerland, 2017; pp. 41–69. [Google Scholar] [CrossRef]
  33. Błaszczyk, L.; Basińska-Barczak, A.; Ćwiek-Kupczyńska, H.; Gromadzka, K.; Popiel, D.; Stępień, Ł. Suppressive effect of Trichoderma spp. on toxigenic Fusarium Species. Pol. J. Microbiol. 2017, 66, 85–100. [Google Scholar] [CrossRef]
  34. García Núñez, H.G.; Martínez Campos, Á.R.; Hermosa Prieto, M.R.; Vázquez, E.M.; Aguilar Ortigoza, C.J.; González Esquivel, C.E. Morphological and molecular characterization of native isolates of Trichoderma and its potential biocontrol against Phytophthora infestans. Rev. Mex. Fitopatol. 2017, 35, 58–79. [Google Scholar]
  35. Chaverri, P.; Branco Rocha, F.; Jaklitsch, W.; Gazis, R.; Degenkolb, T.; Samuels, G.J. Systematics of the Trichoderma harzianum species complex and the re-identification of commercial biocontrol strains. Eur. PMC Funders Group Mycol. 2015, 107, 558–590. [Google Scholar]
  36. Metz, N.; Hausladen, H. Trichoderma spp. As potential biological control agent against Alternaria solani in potato. Biol. Control 2022, 166, 104820. [Google Scholar] [CrossRef]
  37. Consolo, V.F.; Monaco, C.I.; Cordo, C.A.; Salerno, G.L. Characterization of novel Trichoderma spp. isolates as a search for effective biocontrollers of fungal diseases of economically important crops in Argentina. World J. Microbiol. Biotechnol. 2012, 28, 1389–1398. [Google Scholar] [CrossRef] [PubMed]
  38. El-gamal, N.; Atalla, S.M.M.; El-Mohamedy, R.R.S. Improvement in potential of enzymes from Chaetomium globosum and Trichoderma harzianum using different agricultural wastes and its applications. Biosci. Res. 2018, 15, 3977–3987. [Google Scholar]
  39. Bhale, U.N.; Rajkonda, J.N. Compatibility of Fungicides and Antagonistic Activity of Trichoderma spp. against Plant Pathogens. Biosci. Methods 2015, 6, 1–9. [Google Scholar]
  40. Zhang, S.; Xu, B.; Zhang, J.; Gan, Y. Identification of the antifungal activity of Trichoderma longibrachiatum T6 and assessment of bioactive substances in controlling phytopathgens. Pestic. Biochem. Physiol. 2018, 147, 59–66. [Google Scholar] [CrossRef] [PubMed]
  41. Qualhato, T.F.; Lopes, F.A.C.; Steindorff, A.S.; Brandão, R.S.; Jesuino, R.S.A.; Ulhoa, C. Mycoparasitism studies of Trichoderma species against three phytopathogenic fungi. Evaluation of antagonism and hydrolytic enzyme production. Biotechnol. Lett. 2013, 35, 1573–6776. [Google Scholar] [CrossRef] [PubMed]
  42. Amin, F.; Razdan, V.K. Potential of Trichoderma species as biocontrol agents of soil borne fungal propagules. J. Phytol. 2010, 2, 38–41. [Google Scholar]
  43. Russell, P.E. Sensitivity baselines in fungicide resistance research and management. In Frac Monograph, 1st ed.; Crop Life International: Brussels, Belgium, 2002; pp. 3–54. [Google Scholar]
  44. Yang, C.; Hamel, C.; Vujanovic, V.; Gan, Y. Fungicide: Modes of Action and Possible Impact on Non target microorganisms. Int. Sch. Res. Netw. 2011, 2011, 130289. [Google Scholar] [CrossRef]
  45. Meyer, S.L.F.; Roberts, D.P. Combinations of Biocontrol Agents for Management of Plant-Parasitic Nematodes and Soilborne Plant-Pathogenic Fungi. J. Nematol. 2002, 34, 1–8. [Google Scholar]
  46. Myresiotis, C.K.; Karaoglanidis, G.S.; Vryzas, Z.; Papadopoulou-Mourkidou, E. Evaluation of plant-growth-promoting rhizobacteria, acibenzolar-S-methyl and hymexazol for integrated control of Fusarium crown and root rot on tomato. Pest. Manag. Sci. 2012, 68, 404–411. [Google Scholar] [CrossRef] [PubMed]
  47. Selvakumar, G.; Saha, S.; Kundu, S. Inhibitory activity of pine needle tannin extracts on some agriculturally resourceful microbes. Indian J. Microbiol. 2007, 47, 70–267. [Google Scholar] [CrossRef] [PubMed]
  48. Rakibuzzaman, M.; Akand, M.; Siddika, M.; Uddin, A. Impact of Trichoderma application as bio-stimulator on disease suppression, growth and yield of potato. J. Biosci. Agric. Res. 2021, 27, 2252–2257. [Google Scholar] [CrossRef]
  49. Şesan, T.E.; Oancea, A.O.; Ştefan, L.M.; Mănoiu, V.S.; Ghiurea, M.; Răut, I.; Constantinescu-Aruxandei, D.; Toma, A.; Savin, S.; Bira, A.F.; et al. Effects of Foliar Treatment with a Trichoderma Plant Biostimulant Consortium on Passiflora caerulea L. Yield and Quality. Microorganisms 2020, 8, 123. [Google Scholar] [CrossRef] [PubMed]
  50. Aljboori, Q.H.; Babenko, A.; Gulik, E.; Kurovsky, A.V.; Mikhailova, S. Effect Trichoderma spp on Wheat (Triticum aestivum). In Proceedings of the IOP Conference Series: Earth and Environmental Science, Bandung, Indonesia, 7–8 March 2023; Volume 1158, p. 072020. [Google Scholar] [CrossRef]
  51. Contreras Liza, S.E.; Ramírez, R.J.M.; Olivas, D.B.L. Production of potato seed tubers under the effect of Trichoderma sp. and rhizobacteria in greenhouse conditions. Rev. Ciências Agroveterinárias 2022, 21, 419–427. [Google Scholar] [CrossRef]
  52. Galindo, M.; Rueda, D.; Romero, P.; Medina, M.; Bangeppagari, M.; Gangireddygari, V.S.R.; Mulla, S.I. Evaluation of the interaction of arbuscular mycorrhizal fungi and Trichoderma harzianum in the development and nutrition of potato plants. Asian J. Agric. Biol. 2018, 6, 403–416. [Google Scholar]
  53. Wang, Z.; Li, Y.; Zhuang, L.; Yu, Y.; Liu, J.; Zhang, L.; Gao, Z.; Wu, Y.; Gao, W.; Ding, G.C.; et al. A Rhizosphere-Derived Consortium of Bacillus subtilis and Trichoderma harzianum Suppresses Common Scab of Potato and Increases Yield. Comput. Struct. Biotechnol. J. 2019, 17, 645–653. [Google Scholar] [CrossRef]
  54. Constantia, J.; Jannah, S.N.; Wijanarka, W.; Purwantisari, S. The Potential Of Potato Cultivation (Solanum tuberosum L.) With the application of plant growth promoting rhizobacteria (PGPR) And Tricho Powder commercial on medium land. Agric 2023, 35, 133–148. [Google Scholar] [CrossRef]
  55. Ommati, F.; Zaker, M.; Mohammadi, A. Biological control of Fusarium wilt of potato (Fusarium oxysporum f. sp. tuberosi) by Trichoderma isolates under field condition and their effect on yield. J. Crop Prot. 2013, 2, 435–442. [Google Scholar]
  56. Manzar, N.; Kashyap, A.S.; Goutam, R.S.; Rajawat, M.V.S.; Sharma, P.K.; Sharma, S.K.; Singh, H.V. Trichoderma: Advent of Versatile Biocontrol Agent, Its Secrets and Insights into Mechanism of Biocontrol Potential. Sustainability 2022, 14, 12786. [Google Scholar] [CrossRef]
  57. Tyśkiewicz, R.; Nowak, A.; Ozimek, E.; Jaroszuk-Ściseł, J. Trichoderma: The Current Status of Its Application in Agriculture for the Biocontrol of Fungal Phytopathogens and Stimulation of Plant Growth. Int. J. Mol. Sci. 2022, 23, 2329. [Google Scholar] [CrossRef] [PubMed]
  58. Lahlali, R.; Ezrari, S.; Radouane, N.; Kenfaoui, J.; Esmaeel, Q.; El Hamss, H.; Belabess, Z.; Barka, E.A. Biological Control of Plant Pathogens: A Global Perspective. Microorganisms 2022, 10, 596. [Google Scholar] [CrossRef] [PubMed]
  59. Pertot, I.; Puopolo, G.; Giovannini, O.; Angeli, D.; Sicher, C.; Perazzolli, M. Advantages and limitations involved in the use of microbial biofungicides for the control of root and foliar phytopathogens of fruit crops. Italus Hortus 2016, 23, 3–12. [Google Scholar]
  60. Kubiak, A.; Wolna-Maruwka, A.; Niewiadomska, A.; Pilarska, A.A. The Problem of Weed Infestation of Agricultural Plantations vs. the Assumptions of the European Biodiversity Strategy. Agronomy 2022, 12, 1808. [Google Scholar] [CrossRef]
Horticulturae 10 00664 g001
Figure 1. Morphological characterisation of Trichoderma isolates. (a) Micelium growth of the isolate 1A on PDA petri dish; (b) microscopic observation of conidiophores and (c) conidia of isolate 1A; (d) micelium growth of the isolate 1B on PDA petri dish; (e) microscopic observation of conidiophores and (f) conidia of isolate 1B.
Figure 1. Morphological characterisation of Trichoderma isolates. (a) Micelium growth of the isolate 1A on PDA petri dish; (b) microscopic observation of conidiophores and (c) conidia of isolate 1A; (d) micelium growth of the isolate 1B on PDA petri dish; (e) microscopic observation of conidiophores and (f) conidia of isolate 1B.
Horticulturae 10 00664 g001
Horticulturae 10 00664 g002
Figure 2. Phylogenetic neighbour-joining tree of two isolates of Trichoderma inferred by the analysis of ITS1, EF1, and ACT genes using MEGA 11 software. Phytophthora infestans was used as the outgroup.
Figure 2. Phylogenetic neighbour-joining tree of two isolates of Trichoderma inferred by the analysis of ITS1, EF1, and ACT genes using MEGA 11 software. Phytophthora infestans was used as the outgroup.
Horticulturae 10 00664 g002
Horticulturae 10 00664 g003
Figure 3. The mycoparasitic effect of Trichoderma asperelloides (1A) and Trichoderma harzianum (1B) in dual-plate assay against the plant pathogens Sclerotinia sclerotiorum, Fusarium oxysporum, Aspergillus sp., and Botrytis cinerea. The graph shows the percentage of growth inhibition of individual pathogens by the two Trichoderma isolates. An asterisk indicates that differences are statistically significant for Tukey’s HSD post hoc test at p = 0.05. *: 0.001 < p < 0.01; ***: p < 0.0001.
Figure 3. The mycoparasitic effect of Trichoderma asperelloides (1A) and Trichoderma harzianum (1B) in dual-plate assay against the plant pathogens Sclerotinia sclerotiorum, Fusarium oxysporum, Aspergillus sp., and Botrytis cinerea. The graph shows the percentage of growth inhibition of individual pathogens by the two Trichoderma isolates. An asterisk indicates that differences are statistically significant for Tukey’s HSD post hoc test at p = 0.05. *: 0.001 < p < 0.01; ***: p < 0.0001.
Horticulturae 10 00664 g003
Horticulturae 10 00664 g004
Figure 4. Mean values of five plants per treatment in three different fields over two consecutive years of experiment. The parameters observed were (i) plant fresh weight, (ii), potato fresh weight (iii) plant dry weight, and (iv) potato numbers. Differences are statistically significant for Tukey’s HSD post hoc test at p = 0.05. *: 0.001 < p < 0.01; **: p < 0.001; comparing SOSTATA (W) vs. Control (C); and §§: p < 0.001; comparing SOSTATA (W) vs. Micosat (O).
Figure 4. Mean values of five plants per treatment in three different fields over two consecutive years of experiment. The parameters observed were (i) plant fresh weight, (ii), potato fresh weight (iii) plant dry weight, and (iv) potato numbers. Differences are statistically significant for Tukey’s HSD post hoc test at p = 0.05. *: 0.001 < p < 0.01; **: p < 0.001; comparing SOSTATA (W) vs. Control (C); and §§: p < 0.001; comparing SOSTATA (W) vs. Micosat (O).
Horticulturae 10 00664 g004
Horticulturae 10 00664 g005
Figure 5. Average yield of five experimental fields over two consecutive years of the experiment. The graph bars represent three different treatments: Control = C; Micosat = O; and SOSTATA = W.
Figure 5. Average yield of five experimental fields over two consecutive years of the experiment. The graph bars represent three different treatments: Control = C; Micosat = O; and SOSTATA = W.
Horticulturae 10 00664 g005
Horticulturae 10 00664 g006
Figure 6. Vegetation indices NDVI and GNDVI and crop elevation for the study area, obtained by UAV DJI Phantom Multispectral flight. The letters in the area represent the different treatments: (a) SOSTATA, (b) Micosat, and (c) control.
Figure 6. Vegetation indices NDVI and GNDVI and crop elevation for the study area, obtained by UAV DJI Phantom Multispectral flight. The letters in the area represent the different treatments: (a) SOSTATA, (b) Micosat, and (c) control.
Horticulturae 10 00664 g006
Table 1. Nucleotide sequences of primer pairs used in this study.
Table 1. Nucleotide sequences of primer pairs used in this study.
Primer Name Gene Primer Direction Sequence (5′-3′)
Internal Transcribed SpacerITSITS1TCCGTAGGTGAACCTGCGG
ITS4TCCTCCGCTTATTGATATGC
Translation elongation factor 1 alphaTef-1EF1-728 CATCGAGAAGTTCGAGAAGG
TEF1R GCCATCCTTGGGAGATACCAGC
Beta-actinβ-actinTRI-ACT1TGGCACCACACCTTCTACAATGA
TRI-ACT2TCTCCTTCTGCATACGGTCGGA
Table 2. Experimental fields conducted for two consecutive years in southern Italy. Table shows the site of cultivation with GPS coordinates, the extension of cultivated area in hectares, and the potato cultivar name.
Table 2. Experimental fields conducted for two consecutive years in southern Italy. Table shows the site of cultivation with GPS coordinates, the extension of cultivated area in hectares, and the potato cultivar name.
Experimental Fields
SiteAirola CervinaraMaddaloni AcerraAvezzano
(41°03′10.2″ N 14°35′05.8″ E)(41°01′49.1″ N 14°37′05.0″ E)(41°01′03.6″ N 14°21′42.4″ E)(40°56′20.2″ N 14°24′25.8″ E) (42°03′53.5″ N 13°31′54.2″ E)
Cultivated area4 ha4 ha2 ha2 ha2 ha
CultivarAgataAgataInovaColombaColomba & Cicero
Table 3. Percentage of growth inhibition of Trichoderma strains 1A and 1B after 7 days on a PDA petri dish containing the three fungicides: Lidal (Tetraconazole) 1500 µL⋅L−1; Talendo (Proquinazid) 250 µL⋅L−1; and Biomic (Tannins) 4000 µL⋅L−1.
Table 3. Percentage of growth inhibition of Trichoderma strains 1A and 1B after 7 days on a PDA petri dish containing the three fungicides: Lidal (Tetraconazole) 1500 µL⋅L−1; Talendo (Proquinazid) 250 µL⋅L−1; and Biomic (Tannins) 4000 µL⋅L−1.
% of Growth Inhibition
Lidal (Tetraconazole)Talendo (Proquinazid)Biomic (Tannins)
% inhib. 7 dpiSD% inhib. 7 dpiSD% inhib. 7 dpiSD
Trichoderma asperelloides (1A)10000000
Trichoderma harzianum (1B)54.42.80000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Napolitano, A.; Senatore, M.; Coluccia, S.; Palomba, F.; Castaldo, M.; Spasiano, T.; Avino, A.G.; Vitale, A.; Bonfante, A.; Sacco, A.; et al. Development and Evaluation of a Trichoderma-Based Bioformulation for Enhancing Sustainable Potato Cultivation. Horticulturae 2024, 10, 664. https://doi.org/10.3390/horticulturae10070664

AMA Style

Napolitano A, Senatore M, Coluccia S, Palomba F, Castaldo M, Spasiano T, Avino AG, Vitale A, Bonfante A, Sacco A, et al. Development and Evaluation of a Trichoderma-Based Bioformulation for Enhancing Sustainable Potato Cultivation. Horticulturae. 2024; 10(7):664. https://doi.org/10.3390/horticulturae10070664

Chicago/Turabian Style

Napolitano, Angelo, Mauro Senatore, Simone Coluccia, Francesca Palomba, Margherita Castaldo, Teresa Spasiano, Alessio Giovanni Avino, Andrea Vitale, Antonello Bonfante, Adriana Sacco, and et al. 2024. "Development and Evaluation of a Trichoderma-Based Bioformulation for Enhancing Sustainable Potato Cultivation" Horticulturae 10, no. 7: 664. https://doi.org/10.3390/horticulturae10070664

APA Style

Napolitano, A., Senatore, M., Coluccia, S., Palomba, F., Castaldo, M., Spasiano, T., Avino, A. G., Vitale, A., Bonfante, A., Sacco, A., & Ruocco, M. (2024). Development and Evaluation of a Trichoderma-Based Bioformulation for Enhancing Sustainable Potato Cultivation. Horticulturae, 10(7), 664. https://doi.org/10.3390/horticulturae10070664

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop