Next Article in Journal
Micropropagation Protocols for Three Elite Genotypes of Stevia rebaudiana Bertoni
Previous Article in Journal
Description of Phenological Events of Persian Walnut (Juglans regia L.) according to the Extended BBCH Scale and Historical Scales
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 4
10.3390/horticulturae10040403
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Fine Mapping and Candidate Gene Validation of Tomato Gene Carpelloid Stamen and Parthenocarpy (CSP)

by
Shanshan Li
,
Kai Wei
,
Li Zhang
,
Yu Ning
,
Feifei Lu
,
Xiaoxuan Wang
,
Yanmei Guo
,
Lei Liu
,
Xin Li
,
Can Zhu
,
Yongchen Du
,
Junming Li
and
Zejun Huang
*
State Key Laboratory of Vegetable Biobreeding, Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(4), 403; https://doi.org/10.3390/horticulturae10040403
Submission received: 11 March 2024 / Revised: 6 April 2024 / Accepted: 7 April 2024 / Published: 16 April 2024
(This article belongs to the Section Genetics, Genomics, Breeding, and Biotechnology (G2B2))
Browse Figures
Versions Notes

Abstract

:
Parthenocarpy and male sterility are highly desirable traits in tomato breeding and molecular study. The stamen carpelloid mutant generally displays male sterility. A natural mutant displaying carpelloid stamen and parthenocarpy (csp) was identified in our research group. In this study, the csp locus was finely mapped to a 65 kb interval, which contained six putative genes. One of them, Solyc04g081000, encodes the tomato class B MADS box gene TAP3 (syn. SlDEF). Sequencing data revealed that a copia long terminal repeat retrotransposon was inserted in the first intron of the TAP3 gene of the csp mutant. qRT-PCR showed that the expression of TAP3 was significantly down-regulated in the petals and stamens of the csp mutant. A phenotypic analysis of the TAP3 gene-edited mutants and allelism tests indicated that TAP3 was the gene underlying csp, and csp was a novel allelic mutation of TAP3. The results of this study will lay the foundation for a further analysis of the function of TAP3 and provide materials and a basis for a further study of the functional differentiation of tomato B-class genes.

1. Introduction

A carpelloid stamen means that the stamen is transformed into a carpel-like organ [1]. This transformation may result from genetic mutations [2,3,4] or special environmental conditions [5]. A stamen carpelloid mutant can not only be used to study the genetic basis of floral organ determination, but also serve as a female parent in hybrid seed production due to male sterility [6,7]. Many studies have revealed that mutations in B-class genes are the major cause of the stamen carpelloid mutant [8]. Arabidopsis has two B-class genes, APETALA3 (AP3) and PISTILLATA (PI). Mutants ap3 and pi both exhibit stamen carpelloid [9]. Tomato contains four B-class genes: Tomato APETALA3 (TAP3), Tomato MADS-box gene 6 (TM6), Solanum lycopersicum GLOBOSA 1 (SlGLO1), and SlGLO2 (also known as Tomato PISTILLATA, TPI) [10]. Tomato mutants male sterile-15 (ms-15), ms-26, ms-30, ms-33, ms-47, succulent stamens 2 (sus2), stamenless (sl), sl-2, and 7B-1 display carpelloid stamens and male sterility. ms-15, ms-26, and ms-47 are allelic. There is a single-nucleotide polymorphism (SNP) in the coding region of the TM6 gene in ms-15, which led to a missense mutation (G to W). Additionally, both ms-26 and ms-47 have a 12.7 kb deletion, resulting in the absence of the promoter and first four exons of the TM6 gene [11]. The sus2 mutant has a single base deletion in the first exon of the TM6 gene, causing a frameshift and a shortened protein [12]. Regarding the two alleles of stamenless (sl), sl-Pr contains a base pair (bp) deletion in the TAP3 coding sequence, while sl-LA0269 has a chromosomal rearrangement in the TAP3 promoter [13]. A Ds insertion mutant [14] and two EMS mutants [15] of the TAP3 gene also display carpelloid stamens. It is worth noting that ms-30, ms-33, sl-2, and 7B-1 are allelic and contain sequence variations in the SlGLO2 gene. Specifically, ms-30 carries a transversion (G to T) causing a missense mutation (S to I), ms-33 exhibits a transition (A to T) leading to alternative splicing, and 7B-1 and sl-2 mutants show the insertion of a retrotransposon approximately 4.8 kb in size [16,17].
Parthenocarpy is a phenomenon in which fruit set and growth occur without the fertilization of ovules. Parthenocarpy is a desirable agricultural trait because it can not only mitigate fruit yield losses caused by environmental stresses but also improve fruit quality by inducing the development of seedless fruit [18,19]. Several natural sources for parthenocarpy in tomato have been identified and characterized, and the genes underlying some of them have been cloned. Parthenocarpic fruit (pat) encodes an HDIII zip transcription factor called SlHB1 [20,21]. Pat-2 encodes a zinc finger–homeodomain (ZHD) protein [22]. Pat-k encodes an E-class MADS-box gene, SlAGAMOUS-LIKE6 (SLAGL6) [23]. A parthenocarpic mutant Line 2012 from the EMS-mutagenized M82 cultivar also contains a mutation in the SlAGL6 gene [24]. procera is a putative DELLA mutant [25], while entire contains a mutation in SlAux/IAA9 [26,27]. However, the genes for some parthenocarpic fruit mutants in tomato are still unknown.
Carpelloid stamens and parthenocarpy sometimes occur within the same tomato plant. For example, the pat mutant also exhibits carpelloid stamens and exserted ovule-type stamens [28]. sl-Pr and sl-LA0269 develop a variable percentage of parthenocarpic fruits made up of the carpels of whorls 3 and 4, depending on the growing conditions [13]. Furthermore, the parthenocarpic phenotype is observed in two EMS mutant lines of the TAP3 gene, E7821, and E6483 [15]. Our group found a natural mutant, which displayed carpelloid stamen and parthenocarpy (csp), from a backcross recombinant inbred line (BIL) derived from a cross between tomato line Heinz1706 and KR2R144. In this study, the csp locus was mapped to a 65 kb region on chromosome 4. Sequencing data revealed that the first intron of the TAP3 gene (Solyc04g081000) had a 5 kb retrotransposon insertion, potentially causing TAP3 to lose function. Additionally, qRT-PCR showed a significant down-regulation of TAP3 expression in the petals and stamens of the csp mutant. A phenotypic analysis of the TAP3 gene-edited mutants and allelism tests indicated that TAP3 is the gene responsible for csp, and csp is a new mutation of TAP3. These findings will support a future analysis of TAP3’s function and provide materials for studying the differentiation of tomato B-class genes.

2. Materials and Methods

2.1. Plant Materials

csp is a natural mutant that was found in a backcross recombinant inbred line (BIL). The BIL was derived from a cross between the tomato line Heinz1706 (used as recurrent parent) and KR2R144, an inbred line developed by our research group. Its corresponding normal BIL was named wild type (WT). For the genetic analysis and fine mapping of the csp locus, an F2 population consisting of 1162 plants was derived from a cross between csp and Solanum pimpinellifolium LA1589 (TGRC accession number). The F2 population was grown in an open field in Shunyi District, Beijing, China, during the spring and summer of 2020. The outcross seed number assay was performed using the tomato line Micro-Tom. The tomato cultivar Ailsa Craig (AC) was employed for the gene editing of the TAP3 gene.

2.2. A Phenotypic Analysis of the csp Mutant

The morphology of the flowers of the WT and the csp mutant was observed at the anthesis stage using the methods that have been previously described [16]. The entire flower was photographed with a camera (Canon EOS 70D, Canon Inc., Tokyo, Japan). The anther cones and dissected stamens were observed using a stereomicroscope (Carl Zeiss Micro Imaging GmbH, Gottingen, Germany). Pollen viability was tested as described by Sinha and Rajam [29]. Pollen was collected from the WT and the csp mutant, stained with 2% aceto-carmine, and examined using a microscope (BX51, Olympus Corporation, Tokyo, Japan). Fruit set data were collected after self-pollination or outcrossing with Micro-Tom.

2.3. Molecular Marker Development and Genotyping

Insertions and deletions (InDels) were identified by comparing the sequences of tomato lines Heinz 1706 and LA1589, whose whole-genome sequences were published and released on the Sol Genomics Network (SGN, https://solgenomics.net/, accessed on 10 March 2024). PCR primers matching the flanking regions of these InDels were designed using the Primer-BLAST tool available from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/tools/primer-blast/). These primers were used to test the sequence polymorphisms between the csp mutant and LA1589. The CSP candidate gene-specific marker, csp-LTR, was developed based on the sequence alteration within the CSP candidate gene. General information about these markers can be found in Table S1. The PCR conditions were as follows: 94 °C for 3 min; followed by 35 cycles of 94 °C for 30 s, 52 °C for 30 s, and 72 °C for 30–60 s; and 72 °C for 5 min. The PCRs were performed on a PCR instrument (Bio-Rad, Hercules, CA, USA), and the PCR products of these markers were separated on a 3.0% agarose gel.

2.4. The Genetic Analysis and Fine Mapping of the csp Locus

The genetic analysis of the csp locus was performed using the Chi-square test on 270 plants of the F2 population. For the preliminary mapping of the csp locus, 35 male sterile plants in the F2 population were genotyped using the available markers in our research group. For the fine mapping of the csp locus, 1162 plants from the entire F2 population were genotyped using InDel markers located between HP619 and HP621 (Table S1).

2.5. Candidate Gene Analysis

The putative genes in the region harboring the csp locus were identified by searching the tomato genome annotation database (ITAG release 4.0) on the SGN website. The candidate gene of CSP was amplified with the primers listed in Table S2 and sequenced at BGI TechSolutions Co., Ltd. (Beijing, China). To discover the structural variation in the csp mutant, it was re-sequenced at Beijing Biomarker Technologies Co., Ltd. (Beijing, China). The fragment containing the retrotransposon insertion in the csp mutant was amplified using 2× Phanta Max Master Mix (Dye Plus) (Cat. No. P525-03, Vazyme, Nanjing, China) and sequenced at BGI TechSolutions Co., Ltd. (Beijing, China) (see Tables S3 and S5).

2.6. RNA Extraction, cDNA Synthesis, and qPCR Analysis

The sepals, petals, stamens, and carpels of young flower buds measuring approximately 3–5 mm in length [30] were collected from the WT and the csp mutant and rapidly frozen in liquid nitrogen. Each tissue sample comprised three biological replicates, and each replicate contained samples from at least three plants. Total RNA was isolated using the RNA extraction kit (Cat. No. RP3401; Bioteke, Beijing, China), and cDNA was synthesized from 1 μg of total RNA using GoScript™ Reverse Transcriptase (Cat. No. A5003; Promega, Madison, WI, USA). The qPCR was performed using the methods previously described [31]. The primers for qPCR are provided in Table S4. The 2−ΔΔCT method was used to calculate relative gene expression, which was determined from qPCR experiments [32]. The data were analyzed using IBM SPSS Statistics 20.0 software, and a t-test was used to assess statistically significant differences.

2.7. CRISPR/cas9 Gene Editing Vector Construction, Plant Transformation, and Mutant Phenotypic Analysis

The CDS sequence of the TAP3 gene was obtained from the SGN website. The candidate CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) target sequence was identified using the website http://skl.scau.edu.cn/, accessed on 10 March 2024. Two sequences in the first exon of the TAP3 gene Target-1 (AAGAAATGGGCTATTCAAGAAGG) and Target-2 (ATTGTTATGATTTCTAGTACTGG) were selected for the gene editing of TAP3. The two target sequences were ligated into the vector pMGET (Tables S5–S7), a vector for multi-gene editing made in our research group, to construct the vector pCSPDC [33]. The vector was then transferred into Agrobacterium tumefaciens (GV3101) using the freeze–thaw method. The agrobacterium mediated genetic transformation method was previously described by Van Eck [34].
Positive transgenic seedlings were identified using the primers Cas9-909F and Cas9-2450R (Table S5). The DNA fragments containing the TAP3 target sites Target-1 and Target-2 were amplified with the primers CX-F and CX-R and ligated into a pEASY-Blunt Zero Cloning vector (pEASY-Blunt Zero Cloning Kit, Cat. No. CB501-02; TransGen Biotech, Beijing, China). Twelve single clones per PCR product were picked and sequenced at BGI TechSolutions Co., Ltd. (Beijing, China).
The T0 generation gene-edited plants were grown in a greenhouse in Haidian District, Beijing, China. The morphology of the flowers and pollen was observed at anthesis using the methods that have been previously described [16]. For the allelism test, the homologous null mutant of the T0 generation of the TAP3 gene-edited line was crossed with CSP/csp heterozygous plants. Non-transgenic seedlings were chosen to be cultivated in a greenhouse located in the Haidian District of Beijing, China, in order to conduct a subsequent analysis of their phenotypic and genotypic characteristics.

3. Results

3.1. A Phenotypic Analysis of the csp Mutant

csp is a natural mutant that was found in a BIL in our research group. The flowers of the csp mutant exhibited sepaloid petals and carpelloid stamens (Figure 1b,d,f,g). Up to ninety-four percent of the stamens were completely transformed into carpels (Table 1), and all stamens did not produce pollen (Figure 1i). Some carpelloid stamens developed fruit-like organs, and most of the carpels produced seedless fruits when they were not pollinated (Figure 1k,m,o). Seeds could develop when the flowers of the csp mutant were manually crossed with wild-type pollen (Figure 1q). However, the number of seeds per fruit of the csp mutant was about one-third of that of the WT (Figure 1r).

3.2. A Genetic Analysis of the csp Locus

The F1 plants derived from a cross between csp and LA1589 displayed normal stamens. A total of 270 plants from an F2 population, which was derived from the above F1 plants, were investigated on the phenotype of stamens. A total of 196 plants showed normal stamens, and 74 plants produced carpelloid stamens. This result was in agreement with the expected segregation ratio of 3:1 using the Chi-square test (χ2 = 0.835, less than χ2 0.05 = 3.84), indicating that the csp phenotype was controlled by a single recessive gene.

3.3. The Fine Mapping of the csp Locus

For the preliminary mapping of the csp locus, 35 mutant plants from the F2 population were genotyped using InDel markers on the chromosomes containing the B-class genes. This was conducted because the carpelloid stamens of the csp mutant were similar to the phenotype of B-class gene mutants. The results indicated that the csp locus was linked to the molecular markers on chromosome 4 that contained the TAP3 gene. Furthermore, it was located within a 1.3 Mb region between the molecular markers HP619 and HP621 (Figure 2a).
To fine map the csp locus, 1162 plants from the entire F2 population were genotyped with markers HP619 and HP621. A total of 29 recombinants, which were determined to be homozygous for the csp mutant for only one of these two markers, were selected for further genotyping using an additional five markers (see Table S1). Subsequently, the csp locus was finally localized within a 65 kb interval flanked by markers LP3 and LP8 (Figure 2b).

3.4. Candidate Gene Analysis

Six predicted genes were identified in the 65 kb region containing the csp locus by searching the tomato genome annotation database (ITAG release 4.0) on the SGN website (Figure 2c, Table 2). Among them, Solyc04g081000 encodes TAP3 (syn. SlDEF, Table 2). A functional analysis of group B genes has shown that TAP3 regulates the development of stamens and petals in the tomato [35]. Therefore, it is hypothesized that TAP3 may be a candidate gene for CSP.
To discover sequence alteration within the TAP3 gene in the csp mutant, six pairs of primers (Table S2) were designed according to its full-length genomic sequence in the tomato reference genome (version SL4.0). PCR was performed using these primers, and a band was not amplified with the second pair of primers (LS2) in the csp mutant, but it was amplified in the WT (Figure 3a). The PCR bands amplified with the other five pairs of primers were sequenced (Figure 3a), and no sequence polymorphism was found between the csp mutant and the WT. An analysis of the re-sequencing data revealed a potential transposon insertion in the TAP3 gene of the csp mutant at position SL4.0ch04: 63,033,062 (Figure 3b). This conclusion was drawn based on the observation that the sequence of the paired reads of some reads near SL4.0ch04: 63,033,062 in the csp mutant appeared to be derived from transposable elements (TEs). To confirm this finding, a pair of primers was designed around SL4.0ch04: 63,033,062 for the PCR amplification of the long strand. The WT and the csp mutant produced bands of approximately 800 bp and 5 kb, respectively (Figure 3c). The 5 kb PCR band was then ligated into a blunt-zero vector and sequenced. The sequencing results indicated that a copia long terminal repeat (LTR) retrotransposon [36] was inserted in the first intron of the TAP3 gene of the csp mutant (Figure 3d and Figure S1). This insertion may lead to a loss-of-function of the TAP3 gene.
Based on the sequence of the retrotransposon inserted in the TAP3 gene of the csp mutant, an InDel marker named csp-LTR was developed in this study (Figure 3d). This marker could accurately distinguish the csp mutant, homozygous WT (CSP/CSP), and heterozygous plants (CSP/csp) (Figure 3e).

3.5. Expression Analysis of Floral Organ Identity Genes, Pollen Development Marker Genes, and Pistil-Specific Genes

Given that the csp mutant contained an insertion in the B-class gene TAP3 and displayed carpelloid stamens (Figure 1 and Figure 3d), the transcriptional expression of TAP3 and the other floral organ identity genes, as well as the marker genes of pollen and pistil development, was examined in the csp mutant and the WT. The B-class genes TAP3 and SlGLO2 were significantly down-regulated in the stamens of the csp mutant. However, there was no significant difference in the expression of B-class genes TM6 and SlGLO1 between the stamens of the csp mutant and the WT. The C-class gene TAG1 was significantly down-regulated in stamens, while the E-class gene TM5 was significantly up-regulated in petals (Figure 4). The pollen development marker gene Aspartic proteinase was significantly down-regulated in the stamens of the csp mutant. In contrast, the pistil-specific gene SITTS was significantly up-regulated in both the stamens and pistils of the csp mutant.

3.6. Validation of Candidate Gene by Gene Editing and Allelism Test

The TAP3 gene was knocked out using CRISPR-Cas9 technology (Figure 5a). Twelve T0 plants contained mutations in the TAP3 gene, and most of these mutations were chimeric and multiple allelic (Figure S2). Three T0 plants, AT−4 (also named tap3cr4), AT−5, and AT−23, were selected for phenotypic observation. AT−4 and AT−5 were null mutants of the TAP3 gene (Figure 5b). They exhibited sepaloid petals and carpelloid stamens and produced seedless fruits, which were similar to the csp mutant (Figure 5). AT−23 was heterozygous (Figure 5b). It looked as normal as the WT (Figure 5). An allelism test showed that tap3cr4 is allelic to csp (Figure S3). These results indicate that csp is a novel mutation of the TAP3 gene.

4. Discussion

Male sterility and parthenocarpy are two attractive traits in tomato breeding [37,38]. The stamen carpelloid mutant usually displays male sterility [8]. The genes underlying some carpelloid stamen mutants or parthenocarpic fruit mutants have been cloned, but many are still unknown. Carpelloid stamens and parthenocarpy usually occur independently. Our group found a natural mutant, csp, whose phenotype differed to some extent from the reported tomato B-class gene mutants. The csp mutant showed stronger stamen deformities compared to ms-15, ms-26, ms-30, ms-33, ms-47, 7B-1, and sl-2, as it had a higher percentage of stamens completely transformed into carpels [11,16,17]. Additionally, csp may also have a higher percentage of parthenocarpic fruits compared to the loss-of-function mutants of the tomato B-class gene (Figure 1, Table 1). However, the petals of csp only exhibited slight transformation into petals, whereas the petals of sl-Pr and tap3 were completely transformed into sepals [13,14,15]. The csp locus was fine mapped to a 65 kb interval that contained six putative genes (Figure 2b, Table 2). Thereinto, Solyc04g081000 encodes the tomato class B MADS box gene TAP3 (Figure 2c, Table 2). A sequencing data analysis showed that a retrotransposon of approximately 5 kb was inserted in the first intron of the TAP3 gene of the csp mutant (Figure 3), resulting in an almost absent expression of the TAP3 gene in petals and stamens of the csp mutant (Figure 4). A phenotypic analysis of the TAP3 gene-edited mutants (Figure 5) and an allelism test (Figure S3) indicated that TAP3 was the gene underlying the csp mutant. TAP3 has been reported to be the gene responsible for sl-Pr and sl-LA0269 [13]. This means that csp was a novel allele of the TAP3 gene. The reason for the different phenotype of these mutants needs further study.
Tomato possesses four B-class genes, namely TAP3, TM6, SlGLO1, and SlGLO2 (TPI). TAP3 and TM6 are identified as duplicate orthologs, as are SlGLO1 and SlGLO2 (TPI). These genes are known to play conserved roles in determining petal and stamen identities while also undergoing subfunctionalization [10,39]. Notably, they exhibit distinct expression patterns within floral organs. Specifically, TAP3, SlGLO1, and SlGLO2 (TPI) are found to be expressed predominantly in petals and stamens, whereas TM6 shows high expression levels in petals, stamens, and carpels, as illustrated in Figure 4 of this study and previous research [11,17,39]. The mutants of the four B-class genes exhibit varying effects on the expression of floral identity genes. Specifically, in the TM6 gene mutant ms-1526, all four B-class genes and one C-class gene TAG1 show down-regulation in stamens [11]. In the SlGLO2 (TPI) gene mutant ms-30, three B-class genes (SlGLO2 (TPI), TAP3, SlGLO1), one C-class gene TAG1, and one E-class gene TAGL2 are down-regulated in stamens [17]. Conversely, in SlGLO1 RNAi lines, TM6, TAG1, and the E-class gene TM5 exhibit up-regulation in stamens [39]. Furthermore, in the TAP3 gene mutant csp, TAP3, SlGLO2 (TPI), and TAG1 are down-regulated in stamens, as shown in Figure 4 of this study. The mutants of each of the B-class genes in tomato exhibit distinct phenotypes. Specifically, mutants of TM6 and SlGLO2 (TPI) genes predominantly display carpelloid stamens and male sterility [11,17], whereas mutants of the TAP3 gene exhibit sepalloid petals, carpelloid stamens, male sterility, and parthenocarpy (Figure 1 and Figure 5) [14,15]. Further investigation is required to elucidate the molecular mechanisms underlying the subfunctionalization of the B-class genes in tomato.
TEs are important sources of phenotypic variation and evolution in plants [40,41,42]. Approximately two-thirds of the tomato genome is composed of TE sequences [43,44]. The tomato reference genome (Solanum lycopersocum cv. Heinz 1706, release SL2.5) contains 665,122 annotated TE sequences belonging to 818 families [43]. Domínguez et al. identified 6906 TE insertion polymorphisms (TIPs) from 602 cultivated and wild tomato accessions. They also identified at least 40 TIPs robustly that are associated with extreme variation in major agronomic traits or secondary metabolites using genome-wide association studies (GWASs) [45]. Several studies have also revealed that tomato phenotypic variations or mutants result from the insertion of TEs [23]. In this study, a part of the TAP3 gene could not be amplified from the csp mutant using normal elongation time (Figure 4a). Through paired-end whole-genome re-sequencing data analysis and long PCR amplification, an approximately 5 kb long terminal sequence repeat retrotransposon, CopiaSL-37 (LTR retrotransposon CopiaSL-37), was found in the first intron of the TAP3 gene in the csp mutant (Figure 3d). This resulted in an almost absent expression of the TAP3 gene in the petals and stamens of the csp mutant (Figure 4a). It was hypothesized that 7B-1 and sl-2 contained a structural variation in the SlGLO2 gene [16]. Recently, a retrotransposon of approximately 4.8 kb was found in the SlGLO2 gene in the 7B-1 and sl-2 mutant through long PCR amplification in our group [17]. Therefore, long PCR amplification might be tried first when a hypothesized structural variation needs to be revealed, because TEs are known to be one of the major sources of structural variations [43,44].

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/horticulturae10040403/s1, Figure S1: The sequence of the copia LTR retrotransposon in the csp mutant; Figure S2: Sequence variations of the TAP3 gene-edited T0 generation plants; Figure S3: An allelism test between the csp mutant and TAP3 gene-edited mutant tap3cr4; Table S1: General information of InDel markers for mapping CSP; Table S2: General information of primers for amplification and sequencing of TAP3 gene; Table S3: The primers for sequencing the copia LTR retrotransposon in the csp mutant; Table S4: The primers used in real-time PCR; Table S5: The primers for CRISPR/Cas9 gene editing; Table S6: PCR amplification system; Table S7: Golden Gate reactions system.

Author Contributions

Conceptualization, X.W., Y.G., L.L., X.L., C.Z., Y.D., J.L. and Z.H.; methodology, S.L., K.W. and Z.H.; validation, formal analysis, investigation, and data curation, S.L., K.W., L.Z., Y.N., F.L. and Z.H.; writing—original draft preparation, S.L.; writing—review and editing, S.L., K.W., L.Z. and Z.H.; visualization, S.L.; supervision, X.W., Y.G., L.L., X.L., C.Z., Y.D., J.L. and Z.H.; project administration, Z.H.; funding acquisition, X.W. and Z.H. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by grants from the National Key Research and Development Program of China (No. 2022YFD1200500), the National Natural Science Foundation of China (Nos. 31872949 and 31672154), and the China Agriculture Research System (No. CARS-23-A06).

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Shu, J.; Liu, Y.; Li, Z.; Zhang, L.; Fang, Z.; Yang, L.; Zhuang, M.; Zhang, Y.; Lv, H. Organelle simple sequence repeat markers help to distinguish carpelloid stamen and normal cytoplasmic male sterile sources in Broccoli. PLoS ONE 2015, 10, e0138750. [Google Scholar] [CrossRef] [PubMed]
  2. Kramer, E.M.; Dorit, R.L.; Irish, V.F. Molecular evolution of genes controlling petal and stamen development: Duplication and divergence within the APETALA3 and PISTILLATA MADS-box gene lineages. Genetics 1998, 149, 765–783. [Google Scholar] [CrossRef]
  3. Jack, T. Relearning our ABCs: New twists on an old model. Trends Plant Sci. 2001, 6, 310–316. [Google Scholar] [CrossRef] [PubMed]
  4. Kim, S.; Yoo, M.J.; Albert, V.A.; Farris, J.S.; Soltis, P.S.; Soltis, D.E. Phylogeny and diversification of B-function MADS-box genes in angiosperms: Evolutionary and functional implications of a 260-million-year-old duplication. Am. J. Bot. 2004, 91, 2102–2118. [Google Scholar] [CrossRef]
  5. Murai, K.; Takumi, S.; Koga, H.; Ogihara, Y. Pistillody, homeotic transformation of stamens into pistil-like structures, caused by nuclear-cytoplasm interaction in wheat. Plant J. 2002, 29, 169–181. [Google Scholar] [CrossRef]
  6. Kang, L.; Li, P.; Wang, A.; Ge, X.; Li, Z. A novel cytoplasmic male sterility in Brassica napus (inap CMS) with carpelloid stamens via protoplast fusion with Chinese woad. Front. Plant Sci. 2017, 8, 529. [Google Scholar] [CrossRef]
  7. Wang, A.; Kang, L.; Yang, G.; Li, Z. Transcriptomic and iTRAQ-Based quantitative proteomic analyses of inap CMS in Brassica napus L. Plants 2022, 11, 2460. [Google Scholar] [CrossRef] [PubMed]
  8. Pucci, A. Characterization of Tomato (Solanum lycopersicum L.) Male Sterile Mutants Putatively Affected in Class B MADS-Box Transcription Factors; Università Degli Studi Della Tuscia—Viterbo: Viterbo, Italy, 2015; Available online: http://hdl.handle.net/2067/2946 (accessed on 10 March 2024).
  9. Weigel, D.; Meyerowitz, E.M. The ABCs of floral homeotic genes. Cell 1994, 78, 203–209. [Google Scholar] [CrossRef]
  10. Geuten, K.; Irish, V. Hidden variability of floral homeotic B Genes in solanaceae provides a molecular basis for the evolution of novel functions. Plant Cell 2010, 22, 2562–2578. [Google Scholar] [CrossRef]
  11. Cao, X.; Liu, X.; Wang, X.; Yang, M.; van Giang, T.; Wang, J.; Liu, X.; Sun, S.; Wei, K.; Wang, X.; et al. B-class MADS-box TM6 is a candidate gene for tomato male sterile-1526. Theor. Appl. Genet. 2019, 132, 2125–2135. [Google Scholar] [CrossRef]
  12. Fonseca, R.; Capel, C.; Lebrón, R.; Ortiz-Atienza, A.; Yuste-Lisbona, F.J.; Angosto, T.; Capel, J.; Lozano, R. Insights into the functional role of tomato TM6 as transcriptional regulator of flower development. Hortic. Res. 2024, 11, uhae019. [Google Scholar] [CrossRef] [PubMed]
  13. Quinet, M.; Bataille, G.; Dobrev, P.I.; Capel, C.; Gómez, P.; Capel, J.; Lutts, S.; Motyka, V.; Angosto, T.; Lozano, R. Transcriptional and hormonal regulation of petal and stamen development by STAMENLESS, the tomato (Solanum lycopersicum L.) orthologue to the B-class APETALA3 gene. J. Exp. Bot. 2014, 65, 2243–2256. [Google Scholar] [CrossRef]
  14. De Martino, G.; Pan, I.; Emmanuel, E.; Levy, A.; Irish, V.F. Functional analyses of two tomato APETALA3 genes demonstrate diversification in their roles in regulating floral development. Plant Cell 2006, 18, 1833–1845. [Google Scholar] [CrossRef]
  15. Okabe, Y.; Yamaoka, T.; Ariizumi, T.; Ushijima, K.; Kojima, M.; Takebayashi, Y.; Sakakibara, H.; Kusano, M.; Shinozaki, Y.; Pulungan, S.I.; et al. Aberrant stamen development is associated with parthenocarpic fruit set through up-regulation of gibberellin biosynthesis in tomato. Plant Cell Physiol. 2018, 60, 38–51. [Google Scholar] [CrossRef]
  16. Pucci, A.; Picarella, M.E.; Mazzucato, A. Phenotypic, genetic and molecular characterization of 7B-1, a conditional male-sterile mutant in tomato. Theor. Appl. Genet. 2017, 130, 2361–2374. [Google Scholar] [CrossRef] [PubMed]
  17. Wei, K.; Li, X.; Cao, X.; Li, S.; Zhang, L.; Lu, F.; Liu, C.; Guo, Y.; Liu, L.; Zhu, C.; et al. Candidate gene identification and transcriptome analysis of tomato male sterile-30 and functional marker development for ms-30 and its alleles, ms-33, 7B-1, and stamenless-2. Int. J. Mol. Sci. 2024, 25, 3331. [Google Scholar] [CrossRef]
  18. Fayaz, Z.; Nazir, G.; Masoodi, U.; Afroza, B.; Asma, S.; Rashid, M. Parthenocarpy: “A potential trait to exploit in vegetable crops”. Environ. Ecol. 2021, 39, 1332–1346. [Google Scholar]
  19. Sharif, R.; Su, L.; Chen, X.; Qi, X. Hormonal interactions underlying parthenocarpic fruit formation in horticultural crops. Hortic. Res. 2022, 9, uhab024. [Google Scholar] [CrossRef]
  20. Beraldi, D.; Picarella, M.E.; Soressi, G.P.; Mazzucato, A. Fine mapping of the parthenocarpic fruit (pat) mutation in tomato. Theor. Appl. Genet. 2004, 108, 209–216. [Google Scholar] [CrossRef] [PubMed]
  21. Selleri, L. Positional Cloning of the Parthenocarpic Fruit (Pat) Mutant Gene and Identification of New Parthenocarpic Sources in Tomato (Solanum lycopersicum, L.); Università degli studi della Tuscia—Viterbo: Viterbo, Italy, 2011. [Google Scholar]
  22. Nunome, T. Map-based cloning of tomato parthenocarpic pat-2 gene. J-STAGE 2016, 51, 37–40. [Google Scholar] [CrossRef]
  23. Takisawa, R.; Nakazaki, T.; Nunome, T.; Fukuoka, H.; Kataoka, K.; Saito, H.; Habu, T.; Kitajima, A. The parthenocarpic gene Pat-k is generated by a natural mutation of SlAGL6 affecting fruit development in tomato (Solanum lycopersicum L.). BMC Plant Biol. 2018, 18, 72. [Google Scholar] [CrossRef] [PubMed]
  24. Klap, C.; Yeshayahou, E.; Bolger, A.M.; Arazi, T.; Gupta, S.K.; Shabtai, S.; Usadel, B.; Salts, Y.; Barg, R. Tomato facultative parthenocarpy results from SlAGAMOUS-LIKE 6 loss of function. Plant Biotechnol. J. 2017, 15, 634–647. [Google Scholar] [CrossRef]
  25. Bassel, G.W.; Mullen, R.T.; Bewley, J.D. procera is a putative DELLA mutant in tomato (Solanum lycopersicum): Effects on the seed and vegetative plant. J. Exp. Bot. 2008, 59, 585–593. [Google Scholar] [CrossRef]
  26. Saito, T.; Ariizumi, T.; Okabe, Y.; Asamizu, E.; Hiwasa-Tanase, K.; Fukuda, N.; Mizoguchi, T.; Yamazaki, Y.; Aoki, K.; Ezura, H. Tomatoma: A novel tomato mutant database distributing micro-tom mutant collections. Plant Cell Physiol. 2011, 52, 283–296. [Google Scholar] [CrossRef] [PubMed]
  27. Mazzucato, A.; Cellini, F.; Bouzayen, M.; Zouine, M.; Mila, I.; Minoia, S.; Petrozza, A.; Picarella, M.E.; Ruiu, F.; Carriero, F. A TILLING allele of the tomato Aux/IAA9 gene offers new insights into fruit set mechanisms and perspectives for breeding seedless tomatoes. Mol. Breed. 2015, 35, 22. [Google Scholar] [CrossRef]
  28. Mazzucato, A.; Taddei, A.R.; Soressi, G.P. The parthenocarpic fruit (pat) mutant of tomato (Lycopersicon esculentum Mill.) sets seedless fruits and has aberrant anther and ovule development. Development 1998, 125, 107–114. [Google Scholar] [CrossRef] [PubMed]
  29. Sinha, R.; Rajam, M.V. RNAi silencing of three homologues of S-adenosylmethionine decarboxylase gene in tapetal tissue of tomato results in male sterility. Plant Mol. Biol. 2013, 82, 169–180. [Google Scholar] [CrossRef] [PubMed]
  30. Brukhin, V.; Hernould, M.; Gonzalez, N.; Chevalier, C.; Mouras, A. Flower development schedule in tomato Lycopersicon esculentum cv. sweet cherry. Sex. Plant Reprod. 2003, 15, 311–320. [Google Scholar] [CrossRef]
  31. Cao, X.; Qiu, Z.; Wang, X.; Van Giang, T.; Liu, X.; Wang, J.; Wang, X.; Gao, J.; Guo, Y.; Du, Y.; et al. A putative R3 MYB repressor is the candidate gene underlying atroviolacium, a locus for anthocyanin pigmentation in tomato fruit. J. Exp. Bot. 2017, 68, 5745–5758. [Google Scholar] [CrossRef]
  32. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using Real-Time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  33. Yang, M.X.; Liu, X.L.; Cao, C.; Wei, K.; Ning, Y.; Yang, P.; Li, S.S.; Chen, Z.Y.; Wang, X.X.; Guo, Y.M.; et al. Construction and application of a CRISPR/Cas9 system for multiplex gene editing in tomato. Acta Hortic. Sin. 2023, 50, 1215–1229. (In Chinese) [Google Scholar]
  34. Van Eck, J.; Keen, P.; Tjahjadi, M. Agrobacterium tumefaciens-mediated transformation of tomato. Methods Mol. Biol. 2019, 1864, 225–234. [Google Scholar] [CrossRef]
  35. Vekemans, D.; Viaene, T.; Caris, P.; Geuten, K. Transference of function shapes organ identity in the dove tree inflorescence. New Phytol. 2012, 193, 216–228. [Google Scholar] [CrossRef]
  36. Paz, R.C.; Kozaczek, M.E.; Rosli, H.G.; Andino, N.P.; Sanchez-Puerta, M.V. Diversity, distribution and dynamics of full-length Copia and Gypsy LTR retroelements in Solanum lycopersicum. Genetica 2017, 145, 417–430. [Google Scholar] [CrossRef] [PubMed]
  37. Medina, M.; Roque, E.; Pineda, B.; Cañas, L.; Rodriguez-Concepción, M.; Beltrán, J.P.; Gómez-Mena, C. Early anther ablation triggers parthenocarpic fruit development in tomato. Plant Biotechnol. J. 2013, 11, 770–779. [Google Scholar] [CrossRef] [PubMed]
  38. Roque, E.; Gómez-Mena, C.; Hamza, R.; Beltrán, J.P.; Cañas, L.A. Engineered male sterility by early anther ablation using the pea anther-specific promoter PsEND1. Front. Plant Sci. 2019, 10, 819. [Google Scholar] [CrossRef]
  39. Guo, X.; Hu, Z.; Yin, W.; Yu, X.; Zhu, Z.; Zhang, J.; Chen, G. The tomato floral homeotic protein FBP1-like gene, SlGLO1, plays key roles in petal and stamen development. Sci. Rep. 2016, 6, 20454. [Google Scholar] [CrossRef]
  40. Alseekh, S.; Scossa, F.; Fernie, A.R. Mobile transposable elements shape plant genome diversity. Trends Plant Sci. 2020, 25, 1062–1064. [Google Scholar] [CrossRef]
  41. Catlin, N.S.; Josephs, E.B. The important contribution of transposable elements to phenotypic variation and evolution. Curr. Opin. Plant Biol. 2022, 65, 102140. [Google Scholar] [CrossRef] [PubMed]
  42. Pulido, M.; Casacuberta, J.M. Transposable element evolution in plant genome ecosystems. Curr. Opin. Plant Biol. 2023, 75, 102418. [Google Scholar] [CrossRef] [PubMed]
  43. Jouffroy, O.; Saha, S.; Mueller, L.; Quesneville, H.; Maumus, F. Comprehensive repeatome annotation reveals strong potential impact of repetitive elements on tomato ripening. BMC Genom. 2016, 17, 624. [Google Scholar] [CrossRef] [PubMed]
  44. Li, N.; He, Q.; Wang, J.; Wang, B.; Zhao, J.; Huang, S.; Yang, T.; Tang, Y.; Yang, S.; Aisimutuola, P.; et al. Super-pangenome analyses highlight genomic diversity and structural variation across wild and cultivated tomato species. Nat. Genet. 2023, 55, 852–860. [Google Scholar] [CrossRef] [PubMed]
  45. Domínguez, M.; Dugas, E.; Benchouaia, M.; Leduque, B.; Jiménez-Gómez, J.M.; Colot, V.; Quadrana, L. The impact of transposable elements on tomato diversity. Nat. Commun. 2020, 11, 4058. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 10 00403 g001
Figure 1. Phenotype of natural mutant csp. (a) WT flower; (b) csp flower; white bar is 1 cm. (c) WT anther cone; (d) csp anther cone; (e) WT stamen; (f) csp stamen completely transformed into carpel; (g) csp stamen with naked external ovules on adaxial surface; white bar is 0.5 cm. (h) WT pollen; (i) csp pollen; red bar is 50 μm. (j) Fruit setting of WT; (k) fruit setting of csp, white bar is 20 cm. (l) WT fruit; (m) csp fruit; (n) cross-section of WT self-pollinated fruit; (o) cross-section of csp self-pollinated fruit; (p) cross-section of WT outcrossed fruits; (q) cross-section of csp outcrossed fruits; white bar is 2 cm. (r) Seed number of self-pollinated fruits and outcrossed fruits with Micro-Tom. Asterisks indicate a signifcant diference (*, p < 0.05) between WT and csp; WT × Micro-Tom and csp × Micro-Tom.
Figure 1. Phenotype of natural mutant csp. (a) WT flower; (b) csp flower; white bar is 1 cm. (c) WT anther cone; (d) csp anther cone; (e) WT stamen; (f) csp stamen completely transformed into carpel; (g) csp stamen with naked external ovules on adaxial surface; white bar is 0.5 cm. (h) WT pollen; (i) csp pollen; red bar is 50 μm. (j) Fruit setting of WT; (k) fruit setting of csp, white bar is 20 cm. (l) WT fruit; (m) csp fruit; (n) cross-section of WT self-pollinated fruit; (o) cross-section of csp self-pollinated fruit; (p) cross-section of WT outcrossed fruits; (q) cross-section of csp outcrossed fruits; white bar is 2 cm. (r) Seed number of self-pollinated fruits and outcrossed fruits with Micro-Tom. Asterisks indicate a signifcant diference (*, p < 0.05) between WT and csp; WT × Micro-Tom and csp × Micro-Tom.
Horticulturae 10 00403 g001
Horticulturae 10 00403 g002
Figure 2. The fine mapping of the csp locus. (a) The preliminary mapping of the csp locus. n = 35 presents the first 35 mutant plants in the F2 population; (b) the fine mapping of the csp locus, N represents the number of recombinants; the black box presents the mutant homozygous segments, and the gray box presents the heterozygous segments; (c) the predicted genes from ITAG release 4.0 in the region encompassing the csp locus. The arrows indicate the direction of the transcription of the predicted genes, and the white arrow presents the most likely candidate gene for CSP.
Figure 2. The fine mapping of the csp locus. (a) The preliminary mapping of the csp locus. n = 35 presents the first 35 mutant plants in the F2 population; (b) the fine mapping of the csp locus, N represents the number of recombinants; the black box presents the mutant homozygous segments, and the gray box presents the heterozygous segments; (c) the predicted genes from ITAG release 4.0 in the region encompassing the csp locus. The arrows indicate the direction of the transcription of the predicted genes, and the white arrow presents the most likely candidate gene for CSP.
Horticulturae 10 00403 g002
Horticulturae 10 00403 g003
Figure 3. The structural variation in the TAP3 gene of the csp mutant. (a) The agarose gel electrophoresis of PCR fragments amplified from both the WT and the csp mutant using primers specific to the TAP3 gene. (b) The browser displayed that the re-sequencing reads of the csp mutant were aligned to the Heinz 1706 reference genome assembly. (c) The agarose gel electrophoresis of PCR fragments amplified from both the WT and the csp mutant using the primers located around the insertion site. (d) The sequence polymorphism of the TAP3 gene in the csp mutant. Black squares and black lines represent the exons and introns of Solyc04g081000, respectively. The gray triangle represents the insertion of the CopiaSL-37 retrotransposon. csp-LTR-F, csp-LTR-R, and csp-LTR-R1 are the primers used in generating the csp-LTR marker, and arrows indicate the position and direction of these primers. (e) The agarose gel electrophoresis of PCR fragments amplified from the WT, LA1589, csp, F1, and F2 plants using the csp-LTR marker.
Figure 3. The structural variation in the TAP3 gene of the csp mutant. (a) The agarose gel electrophoresis of PCR fragments amplified from both the WT and the csp mutant using primers specific to the TAP3 gene. (b) The browser displayed that the re-sequencing reads of the csp mutant were aligned to the Heinz 1706 reference genome assembly. (c) The agarose gel electrophoresis of PCR fragments amplified from both the WT and the csp mutant using the primers located around the insertion site. (d) The sequence polymorphism of the TAP3 gene in the csp mutant. Black squares and black lines represent the exons and introns of Solyc04g081000, respectively. The gray triangle represents the insertion of the CopiaSL-37 retrotransposon. csp-LTR-F, csp-LTR-R, and csp-LTR-R1 are the primers used in generating the csp-LTR marker, and arrows indicate the position and direction of these primers. (e) The agarose gel electrophoresis of PCR fragments amplified from the WT, LA1589, csp, F1, and F2 plants using the csp-LTR marker.
Horticulturae 10 00403 g003
Horticulturae 10 00403 g004
Figure 4. An expression analysis of the genes related to floral organ identity, pollen, and pistil development in flower buds in the csp mutant and the WT. (a) TAP3; (b) TM6; (c) SlGLO2; (d) SlGLO1; (e) MC; (f) TAG1; (g) TAGL2; (h) TM5; (i) Aspartic proteinase; (j) Sister chromatid cohesion; (k) SITTS; (l) TAGL11; the experimental data were subjected to a t-test, and a significance level of p < 0.05 was considered significant. An asterisk (*) indicated significant differences in gene expression. The floral organs were labeled as follows: SE for sepals, PE for petals, ST for stamens, and CA for carpels.
Figure 4. An expression analysis of the genes related to floral organ identity, pollen, and pistil development in flower buds in the csp mutant and the WT. (a) TAP3; (b) TM6; (c) SlGLO2; (d) SlGLO1; (e) MC; (f) TAG1; (g) TAGL2; (h) TM5; (i) Aspartic proteinase; (j) Sister chromatid cohesion; (k) SITTS; (l) TAGL11; the experimental data were subjected to a t-test, and a significance level of p < 0.05 was considered significant. An asterisk (*) indicated significant differences in gene expression. The floral organs were labeled as follows: SE for sepals, PE for petals, ST for stamens, and CA for carpels.
Horticulturae 10 00403 g004
Horticulturae 10 00403 g005
Figure 5. CRISPR/Cas9-engineered mutations and phenotypes of the tap3cr mutants. (a) A schematic illustration of the two targeting sequences (red arrows) of TAP3 (Solyc04g081000). (b) tap3cr mutant alleles identified from three T0 plants. WT represents the wild type, Ho represents the homozygous mutation, Mu represents the multi-allele mutation, and He represents the heterozygous mutation. The red letters represent the target sequence of the TAP3 gene, the blue letters indicate the protospacer-adjacent motif (PAM), the green letter indicates the insertion sequence, and the green hyphens mark the deletion sequences. The number on the right indicates the number of bases inserted or deleted. A flower of AC (c), AT−4 (d), AT−5 (e), and AT−23 (f). The white bar is 1 cm. An anther cone of AC (g), AT−4 (h), AT−5 (i), and AT−23 (j). The white bar is 0.5 cm. Stamens of AC (k), AT−4 (l), AT−5 (m), and AT−23 (n). The white bar is 0.5 cm. Pollens of AC (o), AT−4 (p), AT−5 (q), and AT−23 (r). The red bar is 50 μm. Fruits of AC (s), AT−4 (t), AT−5 (u), and AT−23 (v). The white bar is 1 cm.
Figure 5. CRISPR/Cas9-engineered mutations and phenotypes of the tap3cr mutants. (a) A schematic illustration of the two targeting sequences (red arrows) of TAP3 (Solyc04g081000). (b) tap3cr mutant alleles identified from three T0 plants. WT represents the wild type, Ho represents the homozygous mutation, Mu represents the multi-allele mutation, and He represents the heterozygous mutation. The red letters represent the target sequence of the TAP3 gene, the blue letters indicate the protospacer-adjacent motif (PAM), the green letter indicates the insertion sequence, and the green hyphens mark the deletion sequences. The number on the right indicates the number of bases inserted or deleted. A flower of AC (c), AT−4 (d), AT−5 (e), and AT−23 (f). The white bar is 1 cm. An anther cone of AC (g), AT−4 (h), AT−5 (i), and AT−23 (j). The white bar is 0.5 cm. Stamens of AC (k), AT−4 (l), AT−5 (m), and AT−23 (n). The white bar is 0.5 cm. Pollens of AC (o), AT−4 (p), AT−5 (q), and AT−23 (r). The red bar is 50 μm. Fruits of AC (s), AT−4 (t), AT−5 (u), and AT−23 (v). The white bar is 1 cm.
Horticulturae 10 00403 g005
Table 1. Proportion of stamens with different phenotypes in csp and WT.
Table 1. Proportion of stamens with different phenotypes in csp and WT.
Phenotypic StatisticsWTcsp
No. of observed stamens228198
Normal stamens (NOs)2280
Carpelloid structures (CSs)00
Naked external ovules on the adaxial surface (EOs)012 (6%)
Complete transformation into carpels (TC)0186 (94%)
Table 2. Predict genes in the csp locus.
Table 2. Predict genes in the csp locus.
GenePositionFunction
Solyc04g080980.2SL4.0ch04: 63,014,916…63,020,499 (−)Coatomer subunit alpha
Solyc04g080990.2SL4.0ch04: 63,025,202…63,027,315 (+)S-type anion channel SLAH1
Solyc04g081000.3SL4.0ch04: 63,032,681…63,036,255 (+)TAP3, Tomato locus SlDEF (Deficiens),
MADS box transcription factor
Solyc04g081010.2SL4.0ch04: 63,041,514…63,042,316 (+)Unknown protein
Solyc04g081020.3SL4.0ch04: 63,056,424…63,057,867 (+)B-box zinc finger protein 24
Solyc04g081030.3SL4.0ch04: 63,064,187…63,069,499 (+)Protein disulfide-isomerase 5-3
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, S.; Wei, K.; Zhang, L.; Ning, Y.; Lu, F.; Wang, X.; Guo, Y.; Liu, L.; Li, X.; Zhu, C.; et al. Fine Mapping and Candidate Gene Validation of Tomato Gene Carpelloid Stamen and Parthenocarpy (CSP). Horticulturae 2024, 10, 403. https://doi.org/10.3390/horticulturae10040403

AMA Style

Li S, Wei K, Zhang L, Ning Y, Lu F, Wang X, Guo Y, Liu L, Li X, Zhu C, et al. Fine Mapping and Candidate Gene Validation of Tomato Gene Carpelloid Stamen and Parthenocarpy (CSP). Horticulturae. 2024; 10(4):403. https://doi.org/10.3390/horticulturae10040403

Chicago/Turabian Style

Li, Shanshan, Kai Wei, Li Zhang, Yu Ning, Feifei Lu, Xiaoxuan Wang, Yanmei Guo, Lei Liu, Xin Li, Can Zhu, and et al. 2024. "Fine Mapping and Candidate Gene Validation of Tomato Gene Carpelloid Stamen and Parthenocarpy (CSP)" Horticulturae 10, no. 4: 403. https://doi.org/10.3390/horticulturae10040403

APA Style

Li, S., Wei, K., Zhang, L., Ning, Y., Lu, F., Wang, X., Guo, Y., Liu, L., Li, X., Zhu, C., Du, Y., Li, J., & Huang, Z. (2024). Fine Mapping and Candidate Gene Validation of Tomato Gene Carpelloid Stamen and Parthenocarpy (CSP). Horticulturae, 10(4), 403. https://doi.org/10.3390/horticulturae10040403

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop