Next Article in Journal
Melatonin Application Induced Physiological and Molecular Changes in Carnation (Dianthus caryophyllus L.) under Heat Stress
Next Article in Special Issue
Botanical Biometrics: Exploring Morphological, Palynological, and DNA Barcoding Variations in White Kwao Krua (Pueraria candollei Grah. ex Benth. and P. mirifica Airy Shaw & Suvat.)
Previous Article in Journal
Genetic Diversity and Population Structure Analysis of Excellent Sugar Beet (Beta vulgaris L.) Germplasm Resources
Previous Article in Special Issue
Floral Biology of Aquilaria sinensis (Lour.) Spreng
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 2
10.3390/horticulturae10020121
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Developing EST-SSR Markers for Identifying and Evaluating Asparagus Germplasm Resources Based on Transcriptome Sequences

by
Dan Liu
1,2,†,
Feili Yan
1,†,
Changmei Liu
3,
Aimeng Chen
1,
Jiahui Wu
1,
Ma Yu
2,* and
Xiangyang Lyu
1,*
1
Neijiang Academy of Agricultural Sciences of Sichuan Province, Neijiang 641000, China
2
School of Life Science and Engineering, Southwest University of Science and Technology, Mianyang 621010, China
3
School of Biotechnology, Jiangnan University, Wuxi 214122, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2024, 10(2), 121; https://doi.org/10.3390/horticulturae10020121
Submission received: 10 December 2023 / Revised: 11 January 2024 / Accepted: 19 January 2024 / Published: 26 January 2024
(This article belongs to the Special Issue Breeding, Cultivation, and Metabolic Regulation of Medicinal Plants)
Browse Figures
Versions Notes

Abstract

:
Radix asparagi is the dried root tuber of the Liliaceae plant Asparagus cochinchinensis (Lour.) Merr., which is a major Chinese medicinal herb with high medicinal and edible value in China. The planting area of A. cochinchinensis is extensive, and there is blind introduction in various regions, leading to confusion the origin of Radix asparagi and impure germplasm. This study conducted morphological and karyotype analyses on cultivated Asparagus resources from seven main production areas in China and developed SSR molecular markers suitable for the identification of Asparagus germplasm resources based on the transcriptome sequencing results. The morphological results indicate that in addition to A. cochinchinensis (Lour.) Merr., recorded in the Pharmacopoeia of the People’s Republic of China, there are also A. taliensis Wang et Tang and A. lycopodineus (Baker) Wang et Tang cultivated in China. All the tested Asparagus resources were diploid and had 20 chromosomes. A total of 8841 single genes containing SSR loci were identified using transcriptome sequencing of Neijiang Asparagus, including 761 SSR loci with trinucleotide repeat units. One hundred pairs of SSR primers were randomly designed from the trinucleotide repeat loci for PCR and polymorphism verification, and ten pairs were selected for identification of Asparagus germplasm resources. The genetic diversity results of ten pairs of primers in seven Asparagus-producing regions were consistent with the morphological identification. This study provides technical support for the comprehensive evaluation and utilization of Asparagus germplasm resources.

1. Introduction

Asparagus cochinchinensis (Lour.) Merr (A. cochinchinensis). is a perennial vine plant in the Liliaceae family. In traditional Chinese medicine (TCM), its root tubers have the effects of nourishing Yin, moistening dryness, clearing the lungs, and promoting fluid production. It is commonly used to treat dry cough, sticky phlegm, whooping cough, dry throat, thirst, and intestinal dryness with constipation [1]. Asparagus contains a large number of chemical components, with more than 90 isolated and identified. These components mainly include carbohydrates, saponins, sterols, lignans, and various other chemical substances [2], which have significant therapeutic effects on asthma, tumors, Alzheimer’s disease, gut diseases, inflammatory diseases, and others [3,4,5]. In addition, Asparagus has various applications in health products, food, and cosmetics [6]. The extract of Asparagus has whitening and anti-aging effects and can be used as a raw material for fermentation and brewing [7,8], which has great development prospects and research value.
Asparagus plants are distributed in tropical and temperate regions, including China, Japan, South Korea, and Vietnam [9,10]. There are more than 30 Asparagus species in China, mainly including A. cochinchinensis, A. meioclados, A. filicinus, A. munitus, A. lycopodineus, etc. [11] (http://www.cn-flora.ac.cn/ (accessed on 11 May 2021.)). Currently, the identification of Asparagus germplasm mainly relies on morphological methods, which are subjective and uncertain. Experts have not reached an agreement on the identification of the same germplasm, leading to confusion in the cultivation and use of Asparagus seeds, arbitrary introduction in some production areas, rampant cultivation of non-pharmacopoeia species, and insufficient promotion of genuine species. Systematically conducting comprehensive identification and evaluation of “morphology cell molecular biology” can effectively reduce the confusion regarding Asparagus seeds’ cultivation. Cell karyotype and molecular marker identification, as cutting-edge technologies, have played an important role in the systematic identification and evaluation of crop germplasm and are of great significance in ensuring germplasm purity. However, there are currently no mature and effective identification tools applied to the actual research of Asparagus resources.
SSR microsatellite markers, also known as simple sequence repeats (SSRs), are abundant short tandem repeat sequences (STRs) that are scattered throughout the genome, representing genomic repeat regions [12,13]. SSR fragments are abundant in the nuclear genome and the organelle genome, and due to their stability and transferability, they have been widely used in systematic germplasm identification and population genetic analysis [14]. SSR molecular marker technology has been widely used for genetic diversity research in plants such as Lonicera japonica, Dendrobium nobile, Astragalus membranaceus, Hedysarum polybotrys, Houpoea officinalis, and Ligusticum sinense [15,16,17,18,19]. In the study of Asparagus, Zeng et al. [20] conducted genetic diversity analysis on Asparagus in different ecological environments and found that it had rich genetic diversity. Ou et al. [21] established the Inter Simple Sequence Repeat PCR (ISSR-PCR) genetic diversity analysis for Asparagus, in which the universal unidirectional primers were utilized; most of them were dominant markers, which cannot distinguish between dominant homozygous and heterozygous genotypes. So far, there have been no reports on the SSR markers of Asparagus, and there is a lack of research on its genetic diversity, which has led to serious constraints on the evaluation, identification, protection, and utilization of Asparagus resources. Therefore, research on SSR markers and genetic diversity in Asparagus is of great significance.
Responding to the current situation of confusing germplasm resources and deficient molecular marker identification technology for Asparagus, our study was carried out to develop stable and effective SSR primers for the identification of germplasm resources of Asparagus through transcriptome sequencing of A. cochinchinensis (the species specified in the Chinese Pharmacopoeia) and to identify and evaluate the resources of Asparagus in different regions by combining morphological, pharmacological, and chromosomal analyses to reveal the genetic diversity of Asparagus. The results of this study will be useful for the identification and evaluation of Asparagus species in different regions. This study will provide a molecular basis and technical support for the identification of the germplasm of Asparagus, genetic diversity analysis, and the production and promotion of genuine Asparagus.

2. Materials and Methods

2.1. Plant Materials and DNA Extraction

The Asparagus materials used in this study were locally cultivated from seven areas in five provinces of China. They were staminiferous plants that have been domesticated for more than 20 years. They were uniformly planted in the resource nursery of the Academy of Agricultural Sciences in Neijiang City, Sichuan Province using asexual ramets propagation. Through long-term phenological observation, we found that they had distinct morphological characteristics (Table 1). The root tips used for chromosome observation were collected as needed to ensure the activity of the root tip cells.
The young stem tips of the A. cochinchinensis plant line TD-1 were used for the transcriptome sequencing, which. had good traits, with abundant anthocyanins in its tender stems; normal growth of tissue materials; and no disease, pest, or mechanical damage. Three replicates were sampled, slam-frozen in liquid nitrogen, and stored at −80 °C for subsequent RNA extraction and transcriptome sequencing.
The tender stems of Asparagus germplasms were used for SSR screening and genetic diversity evaluation. The Plant DNA Extraction Kit (TSINGKE TSP101-200, Beijing, China) was used to extract DNA from seven tender stems of A. cochinchinensis. The concentration and purity of the genomic DNA were quantified using NanoDrop 2000 ultra-micro spectrophotometer (Thermo, Dalawie, MA, USA). The qualified genomic DNA was diluted to 20 ng/µL and stored at −20 °C.

2.2. Morphological Examination

With Flora of China [11] as the reference, the morphological characteristics of the Asparagus plants were examined. The main indicators were plant type, stem length, stem characteristics, number of leafy branches, leafy branch morphology, hard thorn length, pedicel length, flower color, filament attachment, root length to thickness ratio, etc., which were recorded using a Canon EOS R8 digital camera to identify the Asparagus plants from different origins. The characteristics of medicinal materials were described in accordance with the provisions of the Pharmacopoeia of the People’s Republic of China [22], and the root traits, length, thickness, organoleptic, stone cells, and calcium oxalate needle crystals of the different germplasm resources were compared. The cross sections, stone cells, and needle crystal bundles of calcium oxalate of Radix asparagi was observed under an optical photographic microscope (OLYMPUS, BX51, Olympus Inc., Tokyo, Japan).

2.3. Examination of Root Tip Chromosomes

The chromosome preparation and observation was conducted as previously described [23,24]. A 1–2 cm sample of the meristem tissue was taken from the root tip of plant material and put into a moist 5 mL Eppendorf tube. It was treated with nitrous oxide (N2O) for 2 h, fixed with glacial acetic acid for 5–10 min, and then stored in 70% alcohol at −20 °C. The fixed and preserved root tips were rinsed 1–2 times in dd H2O, and a 2–3 mm portion of the front end was cut off and put into 10 μL of enzyme solution (cellulase:pectinase = 4:2), which was subject to a 37 °C water bath for 40 min. The root tips were rinsed once with dd H2O and then twice with anhydrous ethanol. After rinsing, 20–30 μL of glacial acetic acid was added to prepare a cell suspension. A 10 μL sample of the cell suspension was dropped onto a clean glass slide each time; after air-drying, cells were examined with an electron microscope (Leica, DM3000, Leica Camera AG, Wetzlar, Germany ) for imaging.

2.4. RNA Extraction and Transcriptome Sequencing

The tender stems of TD-1 were used to extract RNA with the RNAprep Pure Plant Total RNA Extraction Kit (TSINGKE TSP411, Beijing, China); the extracted RNA was subject to DNase digestion. The cDNA library was prepared as previously described [25]; firstly, the eukaryotic mRNA was enriched with Oligo (dT), then the mRNA was decomposed into short fragments by adding interruption reagents, and the interrupted mRNA was used as a template to synthesize single-stranded cDNA using 6-base random primers. The purified double-stranded cDNA was subjected to end repair and A-tailing, fragment size selection, and PCR amplification to construct a sequencing library. Unreferenced transcriptome sequencing was performed in Qingke Biotechnology Co., Ltd. (Beijing, China) to complete the de novo assembly and related analysis of transcriptome data.

2.5. SSR Marker Development and PCR Primers

After obtaining transcriptome data, MISA (Microsatellite Identification Tool) software was used (http://pgrc.ipk-gatersleben.de/misa/misa.html (accessed on 8 July 2021 ) to perform expressed sequence tag (EST)-SSR loci screening on the Unigene sequence of the A. cochinchinensis transcriptome, with screening criteria set as: mononucleotide repeats ≥10 times and di-, tri-, tetra-, penta-, and hexanucleotide repeats ≥5 times. Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA) was used for PCR primer design. In order to obtain better PCR amplification, the following MusaKavas parameters [26] were adopted: PCR product length was 100–300 bp, primer length was 18–23 bp, GC content was 40–60%, annealing temperature was 52–60 °C, and the difference in annealing temperature between forward and reverse primers was <2 °C. The designed primers were subjected to BLAST analysis in the NCBI database to determine target specificity. A total of 100 pairs of primers were designed and synthesized by the Qingke Biotechnology Company (Beijing, China).

2.6. SSR-PCR and Polymorphism Analysis

One hundred pairs of synthesized fluorescent primers were used for PCR amplification of TD-1. The components of the amplification system are shown in Table 2. The amplification procedure followed the previous laboratory research: pre-denaturation at 98 °C for 3 min; 98 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s, for a total of 39 cycles; extend at 72 °C for 5 min; and store at 4 °C. The PCR products were separated with 1% agarose gel electrophoresis, and the specificity of PCR products was investigated using a DL100 DNA marker (Tiangen Biotechnology Co., Ltd., Beijing, China) as the size standard of PCR products. The recovery, purification, and sequencing of the running gel products were performed to verify reproducibility. SSR primers with good specificity and repeatability were selected and synthesized into fluorescent primers. A second round of fluorescence PCR reaction was conducted, with primers containing the adaptor, modified primers of the adaptor, and corresponding reverse primers. The three primers could be used in multiplex PCR to achieve the goal. The final amplified fluorescent PCR products were subject to 3730xl sequencing, and the obtained data were analyzed using Genemapper 5.0 software. Based on the analysis results, whether different primers led to specific fragment polymorphism was judged. Finally, primers with good polymorphism, repetitive sequences, and high specificity were selected for SSR-PCR amplification of seven individuals.

2.7. Data Analysis

After screening the SSR primers for polymorphism, the SSR results were evaluated as previously described [27]. The specific bands of each individual were counted as either 0 (absent) or 1 (present). The polymorphic bands generated with different primers present in the sample were recorded as “1” at a polymorphic site, while those that were absent were recorded as “0”, thus constructing a matrix of 0 and 1. The data were edited and formatted using GenAlEx version 6.51 software [28]; various genetic diversity indicators of the SSR loci were calculated using Popgen1.32 software, including observed alleles (Na), effective alleles (Ne), heterozygosity (H), Shannon index (I), etc. In the NTSYS 2.1 software, based on the similarity matrix, the unweighted pair group method with arithmetic means (UPGMA) was used to establish individual clustering trees . Finally, based on Nei’s genetic distance, principal coordinate analysis (PCoA) was performed on all samples [29].

3. Results

3.1. Plant Morphology

The morphological results indicate that the samples collected from Neijiang (TD-1), Yulin (TD-3), Chuxiong (TD-5), Kaiyang (TD-6), and Enshi (TD-7) were A. cochinchinensis (Lour.) Merr. Its stem is smooth, with angular branches and clusters of 3–6 leafy branches, forming an acute triangular shape. The length of the hard thorns on the stem is 2.5–3.5 mm; every two flowers are axillary, light green. The pedicel is 2–4 mm long, and the joints are generally located in the middle. The filaments are not attached to the perianth segments. The plants collected from Wuchuan (TD-2) and Honghe (TD-4) were A. taliensis Wang et Tang (Table 3, Figure 1).

3.2. Microscopic Characteristics of Asparagus Medicinal Materials

The characteristics of the medicinal parts of Asparagus medicinal materials are shown in Table 4 and Figure 2. Among all the tested samples, there is a significant difference in the shape of the dry root tubers. The root tubers of TD-2 and TD-4 were longer and larger than those of other materials, which complies with the description of 5–18 cm in the Pharmacopoeia; stone cells and calcium oxalate needle crystals were found in all samples under a microscope. In TD-2 and TD-4, the large columns were eye-catching, with a bitter taste and no sweet taste.

3.3. Root Tip Chromosomes

The chromosomes of the Asparagus plants were examined under an electron microscope (Figure 3); there were 10 pairs (20) of chromosomes in samples from all producing regions, which were generally very short (2.2–5.6 μm). All samples were diploid.

3.4. Transcriptome and Microsatellite Characteristics of Asparagus

In transcriptome sequencing of A. cochinchinensis, approximately 6.83 G transcriptome data were obtained. In the MISA search, 8841 Unigenes containing SSR loci were identified, in which 1057 Unigenes had different base repeat units, with a frequency of 11.96%. Among the SSR loci, the trinucleotide repeats the most, i.e., 761 (71.99%), with CGG/CCG (44) and CCG/CGG (32) predominant; dinucleotide repeats took second place with 218 (20.62%), in which AG/CT (39) and AT/AT (31) were predominant. There were 18 tetranucleotide repeats, 20 pentanucleotide repeats, and 40 hexanucleotide repeats, in which no prolific repeating elements were found (Table 5).

3.5. Development of SSR Primers for Asparagus

To carry out germplasm resource identification and genetic diversity analysis of Asparagus, 100 pairs of SSR primers were randomly designed from the SSR loci identified from the transcriptome data of TD-1. The first round of PCR amplification showed that 74 of the 100 pairs of primers had specificity (Figure 4), and the sequencing results suggested that 41 PCR products contained SSR sequences. A second round of fluorescence PCR was conducted on seven Asparagus samples, and 10 out of 41 pairs of primers displayed high specificity, repeatability, and polymorphism (Figure 5 and Table 6).

3.6. SSR Primer Diversity

The genetic diversity evaluation results of 10 SSR loci are shown in Table 7. A total of 71 allele loci were detected in 7 samples using 10 pairs of primers. Among them, the primers Asp.-34 and Asp.-95 led to the minimum number of alleles, i.e., 5; Asp.-61 and Asp.-87 led to the maximum number of alleles (9); and the average number of alleles per locus was 7.1000. The total number of effective alleles (Ne) was 13.7362, with a range of 1.2499 (Asp.-87) to −1.5544 (Asp.-99). The average number of Ne per locus was 1.3714. The Shannon index (I) ranged from 0.3337 (Asp.-87) to −0.5191 (Asp.-99), with an average value of 0.4040. The average observed heterozygosity (H) of the loci ranged from 0.1908 (Asp.-87) to −0.3405 (Asp.-99), with an average of 0.2486. These results showed that the 10 selected pairs of SSR primers of Asparagus had relatively rich polymorphism.

3.7. Genetic Structure of Asparagus Populations

The cluster analysis was conducted on seven populations of Asparagus to construct a UPGMA tree (Figure 6). The genetic distance and correlation of Asparagus resources were analyzed using PCoA (Figure 7). When K = 2, SSR markers that can be amplified with 10 pairs of PCR primers divided 7 Asparagus germplasms into 2 groups. The first group mainly consisted of TD-2 (Wuchuan, Guizhou) and TD-4 (Honghe, Yunnan), with significantly longer stems. Their flowers were yellow, with reflexes; there were clusters of 5–7 leaves and large, thick root tubers. The second group included TD-1 (Neijiang, Sichuan), TD-3 (Yulin, Guangxi), TD-5 (Chuxiong, Yunnan), TD-6 (Kaiyang, Guizhou), and TD-7 (Enshi, Hubei). They were low plants, with semi-erect or creeping stems, light yellow-green flowers, clusters of 3–6 leaves, and short root tubers. Among them, TD-7 can be distinguished from other resources and is a separate subgroup. Its leafy branches were flattened and no flowering was observed. The cluster analysis and genetic structure analysis indicated that its genetic background and morphological traits were related to environmental factors.

4. Discussion

Asparagus is a high-yield economic crop with medicinal and health values. Radix asparagi was first recorded in the “Shennong Materia Medica Classic” [30] and is listed as a top-grade herb. It has been recorded in the Materia Medica of various dynasties and is now one of the commonly used Chinese medicinal herbs. China has a wide variety of Asparagus germplasm and a large planting area, but there are also problems such as name confusion, variety degradation, poor quality, and low yield. According to textual research on this herb, there are many cases of mistakenly recognizing Asparagus meioclados as “Little Asparagus” (Xiao Tian Dong in Chinese) and Asparagus filicinus as “Indigenous Radix stemonae” (Tubaibu in Chinese) [31]. In the medicinal research on Asparagus, it has been found in various regions. Closely related species of the same genus are used as Radix asparagi for medicine, and even plants from other families are used as Radix asparagi [32]. Therefore, conducting systematic identification and evaluation of Asparagus plants is an important means to ensure the purity of germplasm resources and drug safety. This study provides a more accurate identification and classification of Asparagus germplasm through the morphological description, cytological examination, and development of transcriptome-based SSR markers, laying a foundation for the identification and evaluation of Asparagus germplasm resources, germplasm improvement, resource protection, and sustainable utilization.

4.1. Morphological Examination

This study conducted a morphological investigation of Asparagus resources from different production areas based on the Flora of China. Three different germplasm types were identified, i.e., A. cochinchinensis, A. taliensis, and A. lycopodineus, and the latter two were non-pharmacopeial resources. The tuber root yield and size of A. taliensis in Yunnan and Guizhou provinces are superior to those of A. cochinchinensis. The indigenous people prefer local varieties that grow well and are superior in shape and yield for local cultivation. Production process, could be reasonable despite the phenomenon of chaotic planting of Asparagus.

4.2. Chromosome Examination

The predominant chromosome number of Asparagus is x = 10, and in some cases x = 8, 9, 15. This aneuploidy phenomenon is mainly manifested at the intraspecific level [33], such as x = 9, 10 in A. dauricus and x = 8, 9, 10 in A. filicinus. This phenomenon has also been observed in other genera such as Polygonatum [34] and Cyananthus [35]. In this study, all seven Asparagus resources had ten pairs of diploid chromosomes (n/2n = 10/20), which is consistent with previous studies [36]. However, further analysis is needed to study their karyotype formula.

4.3. SSR Markers

There are a large number of genetic variations in the Asparagus populations, which control traits such as flowering, leaf shape, flower color, stem color, and tuber morphology. The analysis of genetic structure and diversity is crucial for understanding the medicinal properties of Asparagus. In genetic feature research, DNA markers can help researchers understand the structure and degree of variation within plant species [37]. The detection of EST-SSR depends on many factors, such as genome structure, tools, and methods [38]. In the transcriptome of A. cochinchinensis, 8841 SSRs were detected, containing 1057 different base repeat units, with dinucleotides and trinucleotides being the most common motifs. The analysis results of the SSR sequences are similar to those of Asparagus officinalis [39]. In addition, the frequency of SSRs in A. cochinchinensis was 11.96%, lower than in A. officinalis (13.07%) [40], Raphanus sativus (23.8%) [41], and castor (28.4%) [42], but higher than in sesame (8.9%) [43] and Chrysanthemum morifolium (2.84%) [44]. The frequency of SSR loci in dicotyledonous plants is generally between 2.65% and 16.82% [38], with an average value of 9.73%. Hence, the transcriptome and SSR data obtained in this study have high research value. In addition, the repeat sequence length of the SSR loci in this study was mainly between 14 and 24 bp. When the repeat sequence length in SSR loci is greater than or equal to 20 bp [45], there is high polymorphism; there is moderate polymorphism when it is between 12 and 19 bp and low polymorphism when it is below 12 bp. The length of the repeat sequences amplified using SSR primers developed in this study is 15–24 bp, and most of them are greater than 20 bp, indicating that the polymorphism of the SSR markers developed in this study is at a high level.

4.4. Genetic Diversity of SSR in Asparagus

Genetic diversity is the most fundamental condition for the long-term survival and evolution of species [46]. The higher the genetic diversity, the stronger the ability of a species to adapt to the environment [47]. The use of SSR markers to evaluate genetic diversity leads to more accurate analysis within species [48], which is illustrated in wheat [49] and safflower [50], but relevant literature on Asparagus is lacking. In genetic diversity research, Ne is a measure of the uniformity of allele distribution in a population. In this study, the number of different alleles for 10 SSRs was 71, with an average of 7.1000 alleles per locus and Ne of 1.3714, which is lower than that of Quercus acutissima (4.014) [51]. The average number of alleles per locus is influenced by the number of samples and detection sites, and different values can be obtained in different analyses [52]. Therefore, the low Ne values of Asparagus resources in this study may be due to the small sample size and different analysis methods used in the study.
Ho is the proportion of heterozygous individuals in the analysis sample, and expected heterozygosity (He) represents the percentage of the population that belongs to heterozygotes when unexpected hybridization occurs between individuals [52]. The average observed heterozygosity (H) and Shannon information index (I) are the main indicators for measuring the level of genetic diversity of a species [53], and their values are positively correlated with the richness of genes [40]. In this study, I was 0.4040, higher than that of Festuca arundinacea (0.401) [54] and lower than that of A. officinalis (0.37) [40], Quercus acutissima (1.338) [51], and alfalfa (0.553) [55]. In terms of heterozygosity, H of each locus in A. cochinchinensis is 0.2486, which is lower than that of A. officinalis (0.37) [40] and higher than that of Melia azedarach [56] and Toona ciliata [57]. The genetic diversity of the Asparagus resources in this study is moderate, which may be related to the small sample size of this study and the asexual reproduction of Asparagus, such as ramet propagation and root tuber propagation.

4.5. Genetic Structure of Asparagus Resources

Genetic variation generates genetic differentiation in spatial distribution, creating the genetic structure of a species population [58]. The genetic structure of the population is largely influenced by human activities, such as artificial cultivation, domestication, and pollination [59]. This study used cluster analysis and PCoA to divide the Asparagus populations into two groups and three subgroups, which were consistent with the morphological results. The Asparagus resources in Neijiang, Sichuan (TD-1); Yulin, Guangxi (TD-3); Chuxiong, Yunnan (TD-5); and Kaiyang, Guizhou (TD-6) were clustered into one group, mainly distributed in low mountains and hilly areas below 500 m. They were identified as the same species, A. cochinchinensis, according to the Chinese Pharmacopoeia. Notably, their flowers are light green, the filaments are not attached to the perianth, the root size is moderate, and the taste is sweet and slightly bitter. The resources of Wuchuan (TD-2) in Guizhou and Honghe (TD-4) in Yunnan were clustered into the second group, mainly distributed in mountainous areas above 800 m. Their flowers are yellow, with the middle of their filaments attached to the perianth, and their root tubers are thick and bitter in taste. There is no significant provincial difference between the two groups, but there is a certain relationship with elevation. In addition, Asparagus resources exhibited high diversity both in morphology and at the molecular level. However, due to the limited use of Asparagus resources in this study, there may be some deviation in diversity analysis. Therefore, it is necessary to continue conducting multi-dimensional genetic diversity analysis of Asparagus from multiple regions.

5. Conclusions

In accordance with the extensive distribution of Asparagus, and with high intra- and interspecies diversity, phenotypic and molecular markers are effective tools for detecting Asparagus diversity. MISA online software was used to comprehensively analyze the transcriptome data of A. cochinchinensis, and 8841 Unigenes containing SSR loci were identified. Ten specific Asparagus EST-SSR markers were screened out. In the morphological identification, we found that the number of leafy branches and the filiform adhesiveness of the flowers are important indexes to carry out the identification. Moreover, SSR molecular markers can be used as a supplementary means of morphological identification to strengthen the credibility of the morphological identification. Moreover, genetic diversity analysis showed that there may be two groups and two subgroups in the seven Asparagus samples, agreeing with the morphological results. This study classifies and identifies Asparagus germplasms based on phenotypic characteristics and molecular markers, which is of great significance for protecting Asparagus germplasm resources and promoting Asparagus industrialization. Our results not only lay a good foundation for the study of the genetic diversity of Asparagus, but also provide technical support for expanding the technical path of germplasm identification of Asparagus, for carrying out germplasm improvement and protection, and for utilization of Asparagus resources.

Author Contributions

D.L., F.Y. and C.L. contributed equally to this work. M.Y. and X.L. jointly supervised this study. D.L., F.Y., A.C. and J.W. performed transcriptome and gene functional analyses. D.L. and F.Y. prepared the DNA and RNA samples and performed the PCR analysis. D.L. conceived the study and drafted the manuscript. D.L. and F.Y. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Sichuan Provincial Science and Technology Plan Project in China, grant number 2022YFN0032, 2022NSFSC1703, 2022ZHXC0122, 2023YFQ0007, 2022NJZYZF002, the Sichuan Provincial Science and Technology Plan Project “Research on Industrialized Breeding and Ecological Planting Technology of Neijiang Asparagus Seedlings”, and the Science and Technology Plan Project of Sichuan Drug Administration, grant number 2023MS615.

Data Availability Statement

Data are contained within the article. Additional data can be obtained by contacting the corresponding author of the article.

Acknowledgments

The author is grateful for the financial support provided by the Science and Technology Department of Sichuan Province, China, the technical support provided by Southwest University of Science and Technology and Jiangnan University, and the valuable materials provided by the Neijiang Academy of Agricultural Sciences in Sichuan Province.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Wang, M.; Wang, S.; Hu, W.; Wang, Z.; Yang, B.; Kuang, H. Asparagus cochinchinensis: A review of its botany, traditional uses, phytochemistry, pharmacology, and applications. Front. Pharmacol. 2022, 13, 1068858. [Google Scholar] [CrossRef] [PubMed]
  2. Zhu, G.L. Study on Chemical Constituents and Cytotoxic Activity of Asparagus cochinchinensis. Master’s Thesis, Kunming University of Science and Technology, Kunming, China, 2013. [Google Scholar]
  3. Choi, J.Y.; Kim, S.H.; Kim, J.E.; Park, J.W.; Kang, M.J.; Choi, H.J. Four amino acids as serum biomarkers for anti-asthma effects in the ovalbumininduced asthma mouse model treated with extract of Asparagus cochinchinensis. Lab. Anim. Res. 2019, 35, 32. [Google Scholar] [CrossRef]
  4. Lei, L.; Ou, L.; Yu, X. The antioxidant effect of Asparagus cochinchinensis (Lour.) Merr. shoot in D-galactose induced mice aging model and in vitro. J. Chin. Med. Assoc. 2016, 79, 205–211. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, R.S.; Liu, Y.Y.; Zhu, P.F.; Jin, Q.; Dai, Z.; Luo, X.D. Furostanol saponins from Asparagus cochinchinensis and their cytotoxicity. Nat Prod Bioprospect. 2021, 11, 651–658. [Google Scholar] [CrossRef] [PubMed]
  6. Novi, S.; Rungkat, F.Z.; Endang, P.; Suwarti; Robert, V.; Dewi, Y.N. Using metabolomics to discover the immunomodulator activity of food plants. Heliyon 2022, 8, 1–14. [Google Scholar]
  7. Kim, M.; Kim, W.B.; Koo, K.Y.; Kim, B.R.; Kim, D.; Lee, S. Optimal fermentation conditions of hyaluronidase inhibition activity on Asparagus cochinchinensis merrill by Weissella cibaria. J. Microbiol. Biotechnol. 2017, 27, 701–708. [Google Scholar] [CrossRef] [PubMed]
  8. Kinga, T.; Adam, F.; Agnieszka, F. Functional Food-Consumer Motivations and Expectations. Int. J. Environ. Res. Public Health 2021, 18, 5327. [Google Scholar]
  9. Pegiou, E.; Mumm, R.; Acharya, P.; Vos, R.; Hall, R.D. Green and white Asparagus (Asparagus offificinalis): A source of developmental, chemical and urinary intrigue. Metabolites 2019, 10, 17. [Google Scholar] [CrossRef]
  10. Pahwa, P.; Singh, T.; Goel, R.K. Anticonvulsant effect of Asparagus racemosus willd in a mouse model of catamenial epilepsy. Neurochem. Res. 2022, 47, 422–433. [Google Scholar] [CrossRef]
  11. Editorial Committee of Flora of China, Chinese Academy of Sciences. Flora of China; Science Press: Beijing, China, 1995; pp. 107–108. [Google Scholar]
  12. Kantartzi, S.K. Microsatellites Methods and Protocols. In Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2013; p. 1006. [Google Scholar]
  13. Tello, J.; Forneck, A. Use of DNA markers for grape phylloxera population and evolutionary genetics: From RAPDs to SSRs and beyond. Insects 2019, 10, 317. [Google Scholar] [CrossRef]
  14. Dong, W.; Xu, C.; Cheng, T.; Lin, K.; Zhou, S. Sequencing angiosperm plastid genomes made easy: A complete set of universal primers and a case study on the phylogeny of Saxifragales. Genome Biol. Evol. 2013, 5, 989–997. [Google Scholar] [CrossRef]
  15. Jiang, C. Establishment of On-Site and Rapid Identification Methods of Traditional Chinese Medicine—Taking Honeysuckle as an Example. Master’s Thesis, China Academy of Chinese Medical Sciences, Beijing, China, 2013. [Google Scholar]
  16. Li, Q.; Li, B.; Guo, S.X. SSR information in transcriptome of Dendrobium nobile. Chin. J. Trad. Chin. Med. 2017, 42, 63–69. [Google Scholar]
  17. Hou, Y.Q.; Shi, Y.T.; Zhang, Y.P. Astragali radix and Hedysari radix molecular identification of SSR primers screening and fingerprints code. Chin. J. Mater. Sin. 2016, 41, 1819–1822. [Google Scholar]
  18. Dai, J.; Shi, X.D.; Gu, Y.X. Development and function analysis of SSR molecular markers in Magnolia officinalis transcriptome. Chin. Herb. Med. 2017, 48, 2726–2732. [Google Scholar]
  19. Yuan, C.; Peng, F.; Yang, Z.M. EST-SSR markers development of Ligusticum chuanxiong based on transcriptome sequences. China J. Chin Mater. Med. 2017, 17, 3332–3340. [Google Scholar]
  20. Zeng, G.P.; Pan, Z.P.; Liu, H.C. Genetic diversity of Asparagus cochinchinensis (Lour) Merr. in Guizhou based on ISSR Analysis. Henan J. Agri Sci. 2013, 42, 105–108. [Google Scholar]
  21. Ou, L.J.; Yan, W.; Liao, Y.X.; Liang, Y.X. Establishment and optimization of ISSR-PCR reaction system in Asparagus Cochinchinensis. Chin. Trad. Herb. Drugs 2011, 42, 353–357. [Google Scholar]
  22. Chinese Pharmacopoeia National Pharmacopoeia Commission. Pharmacopoeia of the People’s Republic of China: 2020 Edition; China Medical Science &Technology Press: Beijing, China, 2020. [Google Scholar]
  23. Hao, M.; Luo, J.T.; Yang, M.; Zhang, L.Q.; Yan, Z.H.; Yuan, Z.W.; Zheng, Y.L. Comparison of homoeologous chromosome pairing between hybrids of wheat genotypes Chinese Spring ph1b and Kaixian luohanmai with rye. Genome 2011, 54, 959–964. [Google Scholar] [CrossRef]
  24. Komuro, S.; Endo, R.; Shikata, K.; Kato, A. Genomic and chromosomal distribution patterns of various repeated DNA sequences in wheat revealed by a fluorescence in situ hybridization procedure. Genome 2013, 56, 131–137. [Google Scholar] [CrossRef]
  25. Saski, C.A.; Bhattacharjee, R.; Scheffler, B.E.; Asiedu, R. Genomic Resources for Water Yam (Dioscorea alata L.): Analyses of EST-Sequences, De Novo Sequencing and GBS Libraries. PLoS ONE 2015, 10, 134. [Google Scholar] [CrossRef]
  26. Kavas, M.; Yıldırım, K.; Seçgin, Z.; Gökdemir, G. Discovery of Simple Sequence Repeat (SSR) Markers in Hazelnut (Corylus avellana L.) by Transcriptome Sequencing and SSR-Based Characterization of Hazelnut Cultivars. Scand. J. For. Res. 2020, 35, 227–237. [Google Scholar] [CrossRef]
  27. Sabreena; Nazir, M.; Mahajan, R.; Hashim, M.J.; Iqbale, J.; Alyemeni, M.N.; Ganai, B.A.; Zargar, S.M. Deciphering Allelic Variability and Population Structure in Buckwheat: An Analogy between the Efficiency of ISSR and SSR markers. Saudi J. Biol. Sci. 2021, 28, 6050–6056. [Google Scholar] [CrossRef] [PubMed]
  28. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
  29. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
  30. Wang, J.F.; Teng, G.L.; Liu, S. Progress in clinical application of Asparagus. Chin. Mater. Med. Pharm. Clin. 2012, 4, 61–65. [Google Scholar]
  31. Luo, X.D.; Xu, G.J.; Xu, L.S. Textual Research on the Materia Medica of Chinese Medicine Asparagus. Chin. J. Chin. Mater. Med. 1996, 10, 578–580. [Google Scholar]
  32. Zhang, Y.; Zhao, J.S.; Jin, Y. Textual research on traditional Chinese Medicine Asparagi Radix. Mod. Chin. Med. 2020, 22, 1393–1403. [Google Scholar]
  33. Chen, G.F.; Xu, B. Analysis and B Chromosome Observation of Wild Ornamental Plants Asparagus filicinus in the Yulong Snow Mountain. J. Anhui Agric. Sci. 2019, 47, 178–180. [Google Scholar]
  34. Wang, J.J.; Nie, Z.L.; Meng, Y. Cytological Advances on Tribe Polygonateae (Asparagaceae). Acta Bot. Occident. Sin. 2016, 36, 834–845. [Google Scholar]
  35. Chen, G.F.; Sun, W.G.; Hong, D.Y. Systematic significance of cytology in Cyananthus (Campanulaceae) endemic to the Sino-Himalayan region. J. Syst. Evol. 2014, 52, 260–270. [Google Scholar] [CrossRef]
  36. Fu, C.X.; Zhang, Y. Chromosomal Karyotype Analysis of Three Liliaceae Plants. ACTA J. Zhejiang AF Univ. 1991, 17, 93–98. [Google Scholar]
  37. Hong, W.; Yue, W.; Ling, Z.X. Development of Simple Sequence REPEAT Markers for Genetic Diversity Analysis Based on the cDNA Sequences of Chinese Yam (Dioscorea spp.). Horticulturae 2022, 8, 1–14. [Google Scholar]
  38. Kumpatla, S.P.; Mukhopadhyay, S. Mining and Survey of Simple Sequence Repeats in Expressed Sequence Tags of Dicotyledonous Species. Genome 2005, 48, 985–998. [Google Scholar] [CrossRef] [PubMed]
  39. Wu, J.X.; Li, Y.L.; Zhang, Z.J. Analysis of SSR information in EST resource of Asparagus. Chin. J. Bioinform. 2012, 10, 96–100. [Google Scholar]
  40. Ma, Z.C. Nutrient Composition and EST-SSR Genetic Diversity Analysis of Asparagus Germplasm Resources. Master’s Thesis, Heilongjiang Bayi Agricultural University, Harbin, China, 2017. [Google Scholar]
  41. Wang, S.; Wang, X.; He, Q.; Liu, X.X.; Xu, W.L.; Li, L.B.; Gao, J.W.; Wang, F.D. Transcriptome Analysis of the Roots at Early and Late Seedling Stages Using Illumina Paired-End Sequencing and Development of EST-SSR Markers in Radish. Plant Cell. Rep. 2012, 31, 1437–1447. [Google Scholar] [CrossRef] [PubMed]
  42. Qiu, L.J.; Yang, C.; Tian, B.; Yang, J.B.; Liu, A.Z. Exploiting EST Databases for the Development and Characterization of EST-SSR Markers in Castor Bean (Ricinus communis L.). BMC Plant Biol. 2010, 10, 278. [Google Scholar] [CrossRef] [PubMed]
  43. Wei, W.L.; Qi, X.Q.; Wang, L.H.; Zhang, Y.X.; Hua, W.; Li, D.H.; Lyu, H.X.; Zhang, X.R. Characterization of the Sesame (Sesamum indicum L.) Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers. BMC Genom. 2011, 12, 451. [Google Scholar] [CrossRef]
  44. Feng, S.; He, R.; Lu, J.; Jiang, M.; Shen, X.; Yan, J.; Wang, Z.; Wang, H. Development of SSR markers and assessment of genetic diversity in medicinal Chrysanthemum morifolium cultivars. Front. Genet. 2016, 7, 113. [Google Scholar] [CrossRef]
  45. Temnykh, S.; De, C.G.; Lukashova, A.; Lipovich, L.; Cartinhour, S.; McCouch, S. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Res. 2001, 11, 1441–1452. [Google Scholar] [CrossRef]
  46. Jie, G.; Zhimong, L.; Zhao, W. Combined genotype and phenotype analyses reveal patterns of genomic adaptation to local environments in the subtropical oak Quercus acutissima. J. Syst. Evol. 2021, 59, 541–556. [Google Scholar]
  47. Mei, Y.; Min, Z.; Shouguo, S. Analysis of Genetic Structure of Magnolia sprengeri Populations Based on ISSR Markers. Sci. Silvae Sin. 2014, 50, 76–81. [Google Scholar]
  48. Ambreen, H.; Kumar, S.; Kumar, A.; Agarwa, M.; Jagannath, A.; Goel, S. Association mapping for important agronomic traits in safflflower (Carthamus tinctorius L.) core collection using microsatellite markers. Front. Plant Sci. 2018, 9, 402. [Google Scholar] [CrossRef] [PubMed]
  49. Wang, X.; Luo, G.; Yang, W.; Li, Y.; Sun, J.; Zhan, K.; Liu, D.; Zhang, A. Genetic diversity, population structure and marker-trait associations for agronomic and grain traits in wild diploid wheat Triticum urartu. BMC Plant Biol. 2017, 17, 112. [Google Scholar] [CrossRef] [PubMed]
  50. Golkar, P.; Arzani, A.; Rezaei, A.M. Genetic variation in safflflower (Carthamus tinctorious L.) for seed quality-related traits and inter-simple sequence repeat (ISSR) markers. Int. J. Mol. Sci. 2011, 12, 2664–2677. [Google Scholar] [CrossRef] [PubMed]
  51. Lyu, F.; Zong, S.N.; Li, W.Q. Genetic diversity analysis of natural population of Quercus serrata based on SSR markers. J. Nanjing Univ. Nat. Sci. Ed. 2022, 46, 109–116. [Google Scholar]
  52. Ylmaz, F.; Shidfar, M.; Hazrati, N.; Kazan, K.; Ergül, A. Genetic analysis of central Anatolian grapevine (Vitis vinifera L.) germplasm by simple sequence repeats. Tree Genet. Genomes 2020, 16, 4. [Google Scholar] [CrossRef]
  53. Liu, M.H.; Xiao, X.C.; Zhang, C.H. Genetic diversity of Toona sinensis provenance in Sichuan revealed by SSR markers. J. Cent. South Univ. For. Technol. 2022, 42, 60–67. [Google Scholar]
  54. Yi, R.; Wang, Z.Y.; Liu, L.Y. Genetic diversity analysis of 60 reed fescue based on EST-SSR markers. Acta Agrestia Sin. 2023, 31, 2041–2048. [Google Scholar]
  55. Hai, L.R.; Zhen, W.W.; Bo, Z. Molecular marker development and genetic diversity exploration in Medicago polymorpha. Peer J. 2023, 11, 14698. [Google Scholar]
  56. Liao, B.Y.; Wang, F.; Chen, L.J. Genetic diversity of germplasm resources of Melia azedarach revealed by SRAP markers. Sci. Silvae Sin. 2016, 54, 48–58. [Google Scholar]
  57. Wang, Y.; Yue, D.; Li, X.Z. Genetic diversity of Toona ciliata populations based on SSR markers. J. Resour. Ecol. 2020, 11, 466–474. [Google Scholar]
  58. Yi, X.G.; Chen, J.; You, L.X. Genetic diversity of Cerasus serrulata assessed by SSR markers. J. Nanjing For. Univ. Nat. Sci. Ed. 2018, 42, 25–31. [Google Scholar]
  59. Zang, M.Y.; Li, X.; Fang, Y.M. Genetic diversity analysis among natural populations of Quercus fabri based on SSR markers. J. Nanjing For. Univ. Nat. Sci. Ed. 2021, 45, 63–69. [Google Scholar]
Horticulturae 10 00121 g001
Figure 1. Asparagus plants and root characteristics. (a,b) TD-1 plant morphology and male flowers; (c,d) TD-2 plant morphology and male flowers; (e,f) TD-7 plant morphology.
Figure 1. Asparagus plants and root characteristics. (a,b) TD-1 plant morphology and male flowers; (c,d) TD-2 plant morphology and male flowers; (e,f) TD-7 plant morphology.
Horticulturae 10 00121 g001
Horticulturae 10 00121 g002
Figure 2. Characteristics of the medicinal parts of Asparagus plants. (a–c) dry root tubers of TD-1, TD-2, TD-7; (d–f) microscopic cross-section of TD-1, TD-2, TD-7 root tubers; (g–i) calcium oxalate needle crystals in TD-1, TD-2, TD-7.
Figure 2. Characteristics of the medicinal parts of Asparagus plants. (a–c) dry root tubers of TD-1, TD-2, TD-7; (d–f) microscopic cross-section of TD-1, TD-2, TD-7 root tubers; (g–i) calcium oxalate needle crystals in TD-1, TD-2, TD-7.
Horticulturae 10 00121 g002
Horticulturae 10 00121 g003
Figure 3. Root tip chromosomes of Asparagus plants. (a) TD-1; (b) TD-2; (c) TD-7.
Figure 3. Root tip chromosomes of Asparagus plants. (a) TD-1; (b) TD-2; (c) TD-7.
Horticulturae 10 00121 g003
Horticulturae 10 00121 g004
Figure 4. Agarose gel electrophoresis shows the results of the first round of PCR amplification. PCR products from 14 out of 100 pairs of SSR primers are shown. The primer name from left to right is: Asp.1, Asp.7, Asp.8, Asp.13, Asp.29, Asp.34, Asp.36, Asp.47, Asp.61, Asp.64, Asp.87, Asp.88, Asp.95, Asp.99; the genomic DNA of TD-1 was the PCR template.
Figure 4. Agarose gel electrophoresis shows the results of the first round of PCR amplification. PCR products from 14 out of 100 pairs of SSR primers are shown. The primer name from left to right is: Asp.1, Asp.7, Asp.8, Asp.13, Asp.29, Asp.34, Asp.36, Asp.47, Asp.61, Asp.64, Asp.87, Asp.88, Asp.95, Asp.99; the genomic DNA of TD-1 was the PCR template.
Horticulturae 10 00121 g004
Horticulturae 10 00121 g005
Figure 5. Results of fluorescent capillary electrophoresis using ten SSR primers (taking TD-4 as an example). The x-axis represents fragment size of an amplified microsatellite, and the y-axis represents the fluorescence intensity of the amplified products.
Figure 5. Results of fluorescent capillary electrophoresis using ten SSR primers (taking TD-4 as an example). The x-axis represents fragment size of an amplified microsatellite, and the y-axis represents the fluorescence intensity of the amplified products.
Horticulturae 10 00121 g005
Horticulturae 10 00121 g006
Figure 6. UPGMA clustering analysis of seven Asparagus resources.
Figure 6. UPGMA clustering analysis of seven Asparagus resources.
Horticulturae 10 00121 g006
Horticulturae 10 00121 g007
Figure 7. PCoA result of seven Asparagus resources. The red circle represents Group 1, and the green circle represents Group 2.
Figure 7. PCoA result of seven Asparagus resources. The red circle represents Group 1, and the green circle represents Group 2.
Horticulturae 10 00121 g007
Table 1. Provenances of Asparagus.
Table 1. Provenances of Asparagus.
IDGenotypesPopulationProvenance LocationSample SizeLongitude
(E)		Latitude
(N)		Elevation
(m)
TD-1TD1-1NJNeijiang,
Sichuan		1105°8′29°49′370
TD1-21105°22′29°49′350
TD1-31105°7′29°47′350
TD1-41105°12′29°49′440
TD1-51105°10′29°49′500
TD-2TD2-1WCWuchuan,
Guizhou		1107°55′28°42′1020
TD2-21108°09′28°58′864
TD2-31108°06′28°41′890
TD2-41108°24′28°42′720
TD2-51108°1328°30′750
TD-3TD3-1YLYulin,
Guangxi		1110°1′22°28′80
TD3-21110°10′22°3775
TD3-31109°59′22°32′80
TD3-41109°58′22°29′80
TD3-51109°56′22°31′85
TD-4TD4-1HHHonghe,
Yunnan		1103°30′22°51′1380
TD4-21101°53′24°58′1356
TD4-31102°44′23°27′1983
TD4-41102°32′23°29′1689
TD4-51102°57′25°9′1891
TD-5TD5-1CXChuxiong,
Yunnan		1101°53′24°58′1350
TD5-21101°55′25°1′1324
TD5-31101°43′24°38′1345
TD5-41102°13′24°23′1280
TD5-51103°2′24°56′1320
TD-6TD6-1KYKaiyang,
Guizhou		1107°13′26°53′1080
TD6-21107°11′26°58′1158
TD6-31106°54′26°53′980
TD6-41106°35′27°12′880
TD6-51106°21′27°20′1205
TD-7TD7-1ESEnshi, Hubei1109°29′30°16′780
TD7-21108°59′29°37′914
TD7-31109°5′29°42′910
TD7-41109°14′29°52′894
TD7-51108°50′29°20′950
Table 2. Amplification system of SSR-PCR.
Table 2. Amplification system of SSR-PCR.
ComponentVolume
2 × T5 super PCR Mix (PAGE)10 μL
10 μM Primer F1 μL
10 μM Primer R1 μL
Template (genomic DNA)1 μL
ddH2O7 μL
Total20 μL
Table 3. Germplasm resources of Asparagus used in this study.
Table 3. Germplasm resources of Asparagus used in this study.
IDPlant TypeAverage Stem Length
(cm)		StemNumber of Leafy BranchesLeafy Branch MorphologyLength of Leafy Branch
(mm)		Hard Thorn
(mm)		Pedicel Length
(mm)		Flower ColorFiliform Adhesiveness Root Length: Root ThicknessBotanical Origin
TD-1Climbing vine120Smooth stem with longitudinal lines3–6Sharp triangular shape1232PistachioFilaments are not attached7:1A. cochinchinensis
TD-2Climbing vine180Stem is smooth and longitudinal lines are not obvious6–9Sharp triangular shape942.5YellowMiddle and lower parts of filament are attached6:1A. taliensis
TD-3Climbing vine140Smooth stem with longitudinal lines3–5Sharp triangular shape143.52.5PistachioFilaments are not attached6:1A. cochinchinensis
TD-4Climbing vine210Stem is smooth and longitudinal lines are not obvious6–9Sharp triangular shape84.53YellowMiddle and lower parts of filament are attached7:1A. taliensis
TD-5Climbing vine130Smooth stem with longitudinal lines3–5Sharp triangular shape133.52PistachioFilaments are not attached6:1A. cochinchinensis
TD-6Climbing vine140Smooth stem with longitudinal lines3–5Sharp triangular shape1232.5PistachioFilaments are not attached7:1A. cochinchinensis
TD-7Semi-erect vine110Stem is smooth and longitudinal lines are not obvious2–3Sickle shape13InconspicuousNoNoNo5:1A. cochinchinensis
Table 4. Dried root tubers of Asparagus resources.
Table 4. Dried root tubers of Asparagus resources.
IDRoot ShapeRoot Length: ThicknessStone CellCalcium OxalateOrganoleptic
TD-1Spindle10:1Occasionally seenYesLight yellow, transparent, sweet taste
TD-2Long spindle12:1YesYesYellow, translucent, bitter
TD-3Spindle10:1YesYesYellow, transparent, sweet, slightly bitter
TD-4Long spindle13:1YesYesYellow, translucent, bitter
TD-5Spindle9:1Occasionally seenYesPale yellow, transparent, slightly bitter
TD-6Spindle9:1Occasionally seenYesPale yellow, transparent, sweet, slightly bitter
TD-7Short spindle7:1Occasionally seenYesLight yellow, transparent, sweet taste
Table 5. SSR repeat types in the young stem of A. cochinchinensis TD-1.
Table 5. SSR repeat types in the young stem of A. cochinchinensis TD-1.
Type of RepeatNumberPercentage
(%)		Number of Predominant Repeat MotifsPercentage of Predominant Repeat Motifs (%)
Dinucleotide21820.62AG/CT:3917.89
AT/AT:3114.22
Trinucleotide76171.99CGG/CCG:445.78
CCG/CGG:324.21
Tetranucleotide181.71TTTC/GAAA:211.1
Pentanucleotide201.89NoNo
Hexanucleotide403.78NoNo
Total1057
Footer: Each motif of pentanucleotides and hexanucleotides occurred only once.
Table 6. Primer screening.
Table 6. Primer screening.
Primer IDPrimer
Sequence		Original Repeating UnitNumber of RepeatsAnnealing TemperatureSpecificityPolymorphismPCR Product
Size (bp)
Asp.-8F:AACCTGTACAGCTCGTCGATGCAC (3 × 5)1557YesYes160
R:TGTTGCAGAACATCGCGAAG
Asp.-29F:ATGAGGACGTTGGACCAGTAATCCGC (3 × 5)1559YesYes158
R:GACAAGCTAGAGAGGTACAGAGC
Asp.-34F:TGACGATGATGAGAGGGATGAAGCCG (3 × 7)2157YesYes158
R:TTCAAAGGGGAAGGGAAAAACTG
Asp.-47F:GTCCATGTCTTCCTCCTTCGACCGG (3 × 7)2160YesYes157
R:GGACTCCGGCATCGAGAAG
Asp.-61F:ACAGATCTCAATCATCCCAGGTTCAT (3 × 8)2457YesYes155
R:CTCCTTAATCAGAAGGGCTGTGT
Asp.-64F:AGCTACTTATCCGCCACTCTTTCACC (3 × 7)2158YesYes155
R:TCCCACCTCACTATACAGACCAT
Asp.-87F:TTTGAGACTCAAGCAAAAGCACCTTA (3 × 8)2455YesYes151
R:TGCTTAGGAACTCTAAACACTGT
Asp.-88F:TGATCCTGTTCAGGAACGAAGAGTGC (3 × 7)2158YesYes151
R:TTCCTTTCTCAAGATCCAGAGCC
Asp.-95F:CTCGAGTTCACCGTCCAAAACCGT (3 × 6)1859YesYes149
R:GAGGAGGACAGGGAGATGCTAT
Asp.-99F:GAGTCGCTGAACTTCCATCTGAGCGC (3 × 8)2460YesYes149
R:GATCCCAACCCGAACCCTACTC
Table 7. Polymorphism of 10 pairs of SSR primers.
Table 7. Polymorphism of 10 pairs of SSR primers.
Primer IDNo. of BandsNo. of Polymorphic BandsProportion (%)Na
Allele Number		Ne
Number of Effective Alleles		H
Heterozygosity		I
Shannon Index
Asp.-814642.862.001.45 0.28 0.45
Asp.-2914857.142.001.33 0.22 0.36
Asp.-349555.562.001.33 0.23 0.37
Asp.-4712866.672.001.26 0.20 0.34
Asp.-6121942.862.001.44 0.28 0.44
Asp.-6414750.002.001.37 0.25 0.41
Asp.-8713969.232.001.25 0.19 0.33
Asp.-8816743.752.001.43 0.28 0.45
Asp.-959555.562.001.32 0.23 0.39
Asp.-9922731.822.001.55 0.34 0.52
Mean14 7 51.542.001.37 0.25 0.40
St. Dev 0.000.26 0.12 0.15
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, D.; Yan, F.; Liu, C.; Chen, A.; Wu, J.; Yu, M.; Lyu, X. Developing EST-SSR Markers for Identifying and Evaluating Asparagus Germplasm Resources Based on Transcriptome Sequences. Horticulturae 2024, 10, 121. https://doi.org/10.3390/horticulturae10020121

AMA Style

Liu D, Yan F, Liu C, Chen A, Wu J, Yu M, Lyu X. Developing EST-SSR Markers for Identifying and Evaluating Asparagus Germplasm Resources Based on Transcriptome Sequences. Horticulturae. 2024; 10(2):121. https://doi.org/10.3390/horticulturae10020121

Chicago/Turabian Style

Liu, Dan, Feili Yan, Changmei Liu, Aimeng Chen, Jiahui Wu, Ma Yu, and Xiangyang Lyu. 2024. "Developing EST-SSR Markers for Identifying and Evaluating Asparagus Germplasm Resources Based on Transcriptome Sequences" Horticulturae 10, no. 2: 121. https://doi.org/10.3390/horticulturae10020121

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop