Abstract
Variety characterization is crucial in the seed trade, particularly for protecting variety rights. However, the identification of roselle (Hibiscus sabdariffa L.) varieties, known for their beneficial effects on human health and high processing potential, has traditionally relied on morphological traits due to limited genetic information. To investigate genetic polymorphisms of roselle germplasms and to develop breeder-accessible genotyping tools, this study first phenotyped a roselle collection from diverse geographical origins for the selection of core varieties, and then utilized double-digest restriction-associated DNA sequencing (ddRAD-seq) to identify 53,746 single nucleotide polymorphisms (SNPs) across 17 core varieties. Cluster analysis of the SNP data effectively grouped varieties with similar genetic backgrounds. From this genetic information, we selected nine SNPs as a toolkit to simplify core variety discrimination. These SNPs were then converted into breeder-friendly kompetitive allele-specific PCR (KASP) markers, facilitating the classification of an additional 54 roselle accessions. In conclusion, this research contributes novel insights into the genetic relationships among roselle varieties, and establishes a robust framework utilizing ddRAD-seq and KASP markers for improved genetic resource identification and application in breeding programs.
1. Introduction
Roselle (Hibiscus sabdariffa L.) is an annual crop with significant processing potential, widely utilized in the production of juices, beverages, wines, and other products [1]. Its commercial appeal lies in its rich content of bioactive compounds such as phenolics, anthocyanins, flavonoids, and organic acids, which are believed to provide various health benefits, including anti-diabetic, anti-inflammatory, and anti-cholesterol effects [2,3,4]. To enhance roselle cultivars, it is essential for breeders to identify germplasm with desirable traits. Accurate variety identification is crucial for safeguarding variety rights and preserving genetic resources. Traditionally, the identification of roselle cultivars has depended on labor-intensive grow-out tests based on morphological assessments, which are susceptible to environmental variability [5,6]. Consequently, there is an urgent need to develop a more efficient genetic marker-based platform for identifying roselle germplasms.
Despite the availability of whole genome information for Hibiscus sabdariffa L. [7] and the draft genome of its relative, Hibiscus syriacus [8], the genotyping tools accessible to breeders remain limited. This gap highlights the need to develop and refine genotyping technologies that leverage these genomic resources effectively. Nowadays, various molecular markers have been employed for the classification of roselle and its relatives, including amplified fragment length polymorphism (AFLP) markers [9,10,11], random amplification of polymorphic DNA (RAPD) [12,13,14], internal transcribed spacer (ITS) sequences in rRNA [15], inverse sequence-tagged repeat (ISTR) [16], and inter-simple sequence repeat (ISSR) [17,18]. Additionally, morphological indicators and functional markers, such as resistance gene analogs (RGA), have been utilized alongside microsatellite markers to assess genetic diversity between roselle and kenaf [19,20]. Despite the development of various markers for characterizing roselle germplasm, the low marker density across the roselle genome poses challenges in classifying closely related varieties, as demonstrated in a group of Taiwanese-bred varieties in this work. Consequently, there is a pressing need for more refined tools that provide higher identification resolution to improve the classification and differentiation of roselle varieties.
Establishing molecular markers requires the evaluation of diverse accessions, including commercial varieties and core collections. Recent advancements in next-generation sequencing (NGS) techniques have significantly reduced the cost of whole-genome sequencing and facilitated the development of novel sequencing-based genotyping approaches, such as restriction-site associated DNA sequencing (RAD-seq) and genotyping-by-sequencing (GBS) [21,22,23,24]. These methodologies simplify the complexity of whole genomes while enabling the generation of extensive, high-density single-nucleotide polymorphisms (SNPs) as molecular markers. Such markers have been widely utilized in genetic diversity analysis, genetic map construction, and breeding applications [25,26,27]. SNP detection can be efficiently achieved through gel-free PCR-based methods. One notable technique, Kompetitive Allele-Specific PCR (KASP), employs fluorescence-labeled primer pairs and fluorescence resonance energy transfer (FRET) cassettes to accurately identify SNPs [28]. KASP offers advantages such as low cost, high efficiency, and excellent specificity [28,29,30], making it a widely adopted genotyping platform for germplasm identification and applying functional markers in genotype improvement [30,31,32,33,34].
This study aims to establish a robust and breeder-friendly genotyping platform for identifying roselle varieties using SNPs derived from the double digest restriction associated DNA sequencing (ddRAD-seq) technique. We collected 71 roselle accessions and selected 17 core varieties representing diverse morphological characteristics and geographical distributions for ddRAD-seq analysis. SNPs identified through NGS enabled the characterization of genetic relationships and successful differentiation among the roselle varieties. To minimize the bioinformatics expertise requirement for breeders to process NGS data, we selected nine SNPs that effectively distinguish between these varieties. These key SNP markers were further converted into KASP assays, a platform that eliminates the need for gel electrophoresis. The KASP assay was applied to all 71 accessions, providing its utility in screening and identifying Taiwanese-bred varieties and classifying other germplasms. This approach significantly reduces the technical barriers for breeders, facilitating future variety identification.
2. Materials and Methods
2.1. Plant Materials
Seventy-one accessions of roselle (Hibiscus sabdariffa L.) from diverse origins were sampled by collecting fully expanded old leaves to establish a germplasm identification system (see Table 1 and Table A1 for Material Sources). Among these, 17 were selected as core varieties according to their diverse origins and representing key phenotypes relevant to breeding programs, including calyx color, fruit shape, fruit end closure, and leaf shape (Table 1). The growth condition and phenotyping procedures followed the Trial and Evaluation Protocol for roselle varieties promulgated by the Taiwanese Ministry of Agriculture (Order No. 1011048754, https://law.moa.gov.tw/LawContentSource.aspx?id=GL000355 (accessed on 11 November 2024)). Briefly, seeds of each accession were sown separately in 70-cell trays and transplanted into 30 cm diameter pots containing Stender Peat Substrate (Known-You Seed, Kaohsiung, Taiwan) when seedlings reached 10–15 cm in height, to ensure a homogeneous growing environment and minimize soil-borne diseases. Plants were spaced 2 m × 1 m and 20 plants per genotype were replicated once. The experiment was conducted at the Herb Botanical Garden of Taitung District Agricultural Research and Extension Station (22.74801430793307° N, 121.15025319115882° E) from June to December 2019. Some elite genotypes were continuously monitored in subsequent years. Drip irrigation was applied when the substrate was dry, twice daily (except on rainy days). HeyWon Nitrophosphate Organic Compound Fertilizer (20-5-10 4.5(S)-6.5(CaO)-3(O.M.), Taiwan Fertilizer, Taipei, Taiwan, was applied three times during the growing season: one month, two months, and at the flower bud stage after transplanting, at a rate of 20 g per pot. Calyxes were phenotyped and harvested when 80% of the plants in the field displayed large, full calyxes that had changed color, but the capsules were still green and had not turned brown or cracked. This typically occurred in mid-November in the Taitung area. Traits were characterized based on the Roselle Variety Descriptor table promulgated by the Taiwanese Ministry of Agriculture (please see Supplementary Materials “Roselle Trait Table.pdf” for the English version).
Table 1.
Phenotypes and origins of 17 core roselle varieties.
The core varieties underwent ddRAD-seq analysis. The remaining 54 accessions were utilized to evaluate the efficacy of the KASP genotyping system. All accessions were collected and cultivated at the Taitung District Agricultural Research and Extension Station. Leaf samples were then harvested and stored at −80 °C prior to genomic DNA (gDNA) extraction.
2.2. Roselle gDNA Extraction
For roselle gDNA extraction, three fully expanded mature leaves were collected from three individuals and pooled for homogenization. Total gDNA was then extracted from 0.2 g of frozen roselle leaf tissues using the modified cetyltrimethylammonium bromide (CTAB) method [35]. Roselle leaves were homogenized with a pestle and mortar in liquid nitrogen. Subsequently, 1 mL of DNA extraction buffer [100 mM Tris-HCl at pH 8.0, 25 mM EDTA, 1.4 M NaCl, 0.1% polyvinylpyrrolidone with an average molecular weight of 40,000 (PVP-40), 2% CTAB, 0.2% ß-mercaptoethanol, and 0.15 mg·mL−1 Proteinase K] was thoroughly mixed with homogenized samples. After incubation at 65 °C for 30 min, centrifuge the sample at 3000× g for 10 min and transfer the supernatant into a new tube. Then, an equal volume of chloroform: isoamyl alcohol (24:1) was added into the tube, followed by centrifugation at 10,000× g for 10 min. The upper aqueous phase was carefully transferred to a new tube, and half the volume of 5 M NaCl and 0.6–0.7 volume of cold isopropanol were added, incubating at room temperature for 1 h. Finally, DNA was precipitated by centrifugation at 10,000× g for 20 min, and the collected pellet was washed with 70% ethanol, air-dried, and dissolved in 0.5 mL of high-salt TE buffer (1 M NaCl, 10 mM Tris-HCl at pH 8.0, and 1 mM EDTA). Following DNA extraction, 0.5 μL of RNase A (20 mg·mL−1) was added to the DNA extract and incubated at 37 °C for 30 min to eliminate RNA contamination. The RNase-treated DNA was purified using chloroform: isoamyl alcohol (24:1) and precipitated with 0.6–0.7 volume of cold isopropanol, followed by centrifugation at 12,000× g for 30 min at 4 °C. The precipitated DNA pellet was washed with 70% ethanol, air-dried, and dissolved in DNase-free water for use as stock in subsequent experiments.
The integrity of gDNA was assessed using 1% agarose gel electrophoresis, which allows for the visualization of DNA fragments to ensure no signs of degradation or contamination. In addition, DNA purity (ratios of absorbance at 260 nm, 280 nm, and 230 nm) and concentration were measured with NanoDrop One Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). The working DNA solution was adjusted to 25 ng·μL−1 for subsequent analysis or experimental procedures, ensuring that the DNA is at an optimal concentration for downstream applications.
2.3. Library Construction for ddRAD-Seq Analysis
The ddRAD library was constructed as described [36] with modification. Briefly, 0.3 μg gDNA was incubated at 37 °C overnight (approximately 16 h) for digestion by PstI and MseI in a 50 μL volume containing 5 μL 10× CutSmart buffer (New England Biolabs, Ipswich, MA, USA), 0.5 μL 20 unit·μL−1 PstI-HF (New England Biolabs, Ipswich, MA, USA), and 1 μL 10 unit·μL−1 MseI (New England Biolabs, Ipswich, MA, USA). Inactivate restriction enzyme at 80 °C for 20 min, and then cooled to room temperature. The total 50 μL enzyme-digested gDNA was then mixed with 1.37 μL 100 nM P1 adaptor and 8.63 μL reaction master mix consisting of 1 μL 10× CutSmart buffer, 0.6 μL 100 mM rATP, 4.14 μL 2 μM Mse-P2, 0.5 μL 2000 unit·μL−1 T4 Ligase, and 2.39 μL ddH2O for ligation of barcode-tagged adaptors at 20 °C for 3 h. Adaptor-ligated DNA samples were then pooled and purified using AMPure XP (Beckman Coulter, CA, USA). Following quantification with a Qubit 2.0 fluorometer (Thermo Fisher Scientific, Waltham, MA, USA), DNA fragments ranging from 300 to 500 bp were size-selected with BluePippin (Sage Science, Beverly, MA, USA) according to the manufacturer’s manual. For RAD tag enrichment, 150 ng of purified DNA was mixed with 4 µL 10 µM Solexa Primer mix (NEB, Ipswich, MA, USA) and 50 µL Q5 mix (NEB, Ipswich, MA, USA) to a final volume of 100 µL for PCR amplification under the following conditions: initial denaturation at 98 °C for 30 s, followed by 18 cycles of denaturation at 98 °C for 10 s, annealing at 66 °C for 30 s, and extension at 72 °C for 30 s, with a final extension step at 72 °C for 5 min. The PCR products were purified with AMPure XP and quantified again with a Qubit 2.0 fluorometer. The constructed RAD-seq libraries were visualized using 1% agarose gel electrophoresis and subsequently sequenced on a HiSeq2500 system (Illumina, San Diego, CA, USA) using 100 bp single-read mode.
2.4. Raw Sequencing Data Processing and SNP Calling
A total of 229,672,776 raw reads were de-multiplexed, adapter-trimmed, and assigned to varieties using STACKS v.2.41 pipeline [37]. Reads were quality-filtered using Trimmomatic v.0.38 [38]. All reads were trimmed based on an average Phred quality score of 20 over 4 consecutive bases and truncated to a uniform length of 103 bp, with all shorter reads being discarded. In total, 216,553,573 sequences were retained for further processing.
RAD loci were reconstructed using the de novo pipeline. The “ustacks” module built putative loci in each sample with a minimum stack size of four reads (m = 4) and a maximum distance of three between stacks (M = 2). The “cstacks” module created a catalog of loci across the population, and “sstacks” matched sample loci against the catalog. SNPs were called using the “populations” program, filtering out SNPs with a minor allele frequency < 0.05 and those deviating significantly from Hardy-Weinberg equilibrium (HWE).
2.5. Phylogenetic Analysis Using Polymorphic SNPs
To establish reliable evolutionary relationships based on fixed genetic differences, we selected SNPs with homozygous genotypes across all individuals for phylogenetic analysis. Phylogenetic relationships among the 17 varieties were analyzed using RAxML-NG, based on 1952 common homozygous SNPs. First, the VCF file was converted to PHYLIP format using the Python script VCF2phlip v.2.0 [39]. RAxML-NG v.8.2.10 [40] was used to construct a maximum likelihood phylogenetic tree with automatic model selection and 1000 bootstrap replicates. The resulting tree was visualized and edited using FigTree v1.4.3.
2.6. Development of Kompetitive Allele Specific PCR (KASP) Markers
For KASP genotyping, two specific primers with FAM or HEX fluorescent labels, along with one common primer were designed based on de-novo assembled contigs. The KASP primer sequences were listed in Appendix A Table A2 and ordered from Integrated DNA Technologies (Coralville, IA, USA). The KASP genotyping reaction comprised a KASP master mix (LGC genomics, Teddington, UK), 0.33 μM specific primers each, 0.82 μM common primer, and 50 ng gDNA as a template. PCR was performed using a CFX connect real-time PCR Detection System (Bio-Rad, Hercules, CA, USA) in 96-well plates, employing a 61 °C–55 °C touchdown protocol. One to two technical replicates were conducted for each roselle accession. PCR conditions were as follows: Hot-start Taq activation at 94 °C for 15 min, followed by 10 touchdown cycles. Each touchdown cycle included denaturation at 94 °C for 20 s, 61 °C–55 °C for 60 s (decreasing 0.6 °C per cycle to achieve a final annealing/extension temperature of 55 °C), followed by 29 amplification cycles of denaturation at 94 °C for 20 s, annealing/extension at 55 °C for 60 s, and a plate read stage at 30 °C for 60 s. Variant calling was performed by analyzing end-point fluorescence data using Bio-Rad CFX Maestro software 1.1 (Bio-Rad, Hercules, CA, USA). In cases where genotype clusters were not clearly grouped, a KASP recycling protocol was implemented. KASP recycling protocol involved three PCR cycles as follows: 94 °C for 20 s, annealing/extension at 55 °C for 60 s, and a plate read stage at 30 °C for 60 s. This systematic approach ensures robust genotyping and offers a mechanism to resolve ambiguous genotype clustering through the KASP recycling protocol when necessary.
3. Results
3.1. DdRAD-Seq Analysis and SNP Exploration in Roselle Genotypes
Phenotypic characterization was conducted on landraces from various geographic origins, including Taitung, Taiwan, Burkina Faso, and Mali, as well as on varieties selected by breeders from the Taitung District Agricultural Research and Extension Station (TTDARES) and Known-You Seed. To obtain a high-density set of molecular markers for characterizing of the roselle genome, we selected 17 core varieties (Table 1) representing diverse morphological traits and geographical distributions for ddRAD-seq analysis. A total of 229,672,776 raw reads were generated from ddRAD-seq, of which 216,562,286 reads were retained after discarding low-quality sequences (Table 2). After assigning the reads to the core varieties, the number of retained reads ranged from 7,252,287 to 20,485,457 per sample (Table 2). The lowest number of retained reads was observed in the ‘A129’ variety, while the highest was recorded in the ‘L7’ variety (Table 2).
Table 2.
Summary statistics of sequence reads and SNP information produced by ddRAD-seq.
Following the analysis of the sequencing data, a total of 53,746 SNPs were identified across 17 roselle core varieties using ddRAD-seq (Table 3). The sequencing depth ranged from 65× to 142×, with an average depth of 93× (Table 3). Among the examined varieties, ‘A129’ (sample code 6) exhibited the lowest sequencing depth, while ‘L7’ (sample code 35) had the highest (Table 3), correlating with the number of retained sequencing reads (Table 2). In addition, the number of homozygous SNPs ranged from 9130 to 17,178, with an average of 14,384; the highest count was observed in ‘Taitung No. 3’ (sample code 11), while the lowest is in ‘Taitung No. 5’ (sample code 0611). For heterozygous SNPs, counts ranged from 17,085 to 23,182, with an average of 20,802. The highest heterozygous SNP count was observed in ‘A128 Pinky’ (sample code 5), while the lowest was in ‘Mandeka’ (sample code 36).
Table 3.
Summary of SNP information generated by ddRAD-seq.
Furthermore, the ratio of homozygous to heterozygous SNPs (Hom/Hets) was approximately 0.7 across most varieties, with ‘A128 Pinky’ (sample code 5) and ‘A129’ (sample code 6) exhibiting ratios around 0.5. The lowest Hom/Hets ratio, 0.41, was recorded in ‘Taitung No. 5’ (sample code 0611), which corresponded to the smallest number of homozygous SNPs (Table 3). Moreover, SNPs were classified based on nucleotide substitution as either transition or transversion SNPs. The transition-to-transversion ratio (Ts/Tv) across all roselle varieties was approximately 2 (Table 3).
3.2. Genetic Diversity Evaluation of Roselle Varieties Using SNP Markers from ddRAD-Seq
After assessing genetic variation among the selected roselle varieties, we analyzed their genetic relationships using SNP markers to evaluate genetic diversity. Dendrogram clustering and principal component analysis (PCA) (Figure 1A,B) were employed to visualize these relationships, revealing a correlation between genetic polymorphism and geographical distribution. Varieties from different regions generally grouped into distinct clusters, though samples from Mali showed a more complex pattern, dividing into two to three groups (Figure 1A). Genetic distances among the 17 varieties ranged from 0.018 to 0.121, with particularly low distances observed between ‘A128 Pinky’ (sample code 5) and ‘A129’ (sample code 6), ‘Taibai’ (sample code 10) and ‘Taitung No. 3’ (sample code 11), as well as ‘ACC Martin’ (sample code 28) and ‘Vimto’ (sample code 45), indicating close genetic relationships.
Figure 1.
Classification of 17 core roselle varieties according to SNPs explored by ddRAD-seq: Visualization by dendrogram (A) and principal component analysis (PCA) (B) using all QC-passed SNPs. (C) A maximum likelihood (ML) phylogeny was based on 1952 homozygous common SNPs by using the Tamura–Nei model. The numbers within the dendrogram and phylogenetic trees represent the sample codes of varieties. The number at the node of the phylogenetic tree indicates the Bootstrap value. The number underneath the branch of the phylogenetic tree indicates the branch lengths.
A set of 1952 homozygous SNPs was identified across all 17 core varieties (please see Supplementary Materials “1952.SNP.CONTIGS.fa” and “1952.HOMO.SNP.TABLE”). Based on these homozygous SNPs, a maximum likelihood (ML) phylogenetic tree was constructed (Figure 1C), showing that Taiwanese-bred varieties clustered closely, consistent with their origins. These common homozygous SNPs can serve as reliable markers for variety identification, effectively distinguishing both closely related Taiwanese-bred varieties and genetically distant accessions across diverse origins, except for ‘ACC Martin’ and ‘Vimto’ sharing identical SNP profiles. Overall, SNP markers derived from ddRAD-seq demonstrated high efficacy in evaluating genetic relationships and distinguishing varieties among the examined roselle accessions.
3.3. Nine KASP Markers Were Developed for Variety Identification on Roselles
While ddRAD-seq is a powerful tool for cultivar identification, the substantial amount of NGS data generated can pose a significant barrier for breeders and plant rights owners. To address this, we identified a set of key SNPs whose variation can reliably differentiate among key cultivars. Our goal was to develop PCR-based markers derived from these SNPs, enabling breeders to conduct genotyping independently and facilitating the classification of additional germplasm. We identified three specific SNPs for the differentiation of roselle varieties from distinct origins (Appendix A Figure A1). Among the 3 SNPs, 2 homozygous SNPs, 46313_71 and 95813_33, from the 1952 homozygous common SNPs were capable of distinguishing varieties originating from Mali, Burkina Faso, and Known-You Seed.
Given that the Taiwanese locally bred ‘Taitung No. 5’ (sample code 0611) is an F1 hybrid, we further identified a shortlist of heterozygous SNPs specific to ‘Taitung No. 5’ (please see Supplementary Materials “HETERO.SNP.CONTOGS.fa” and “HETERO.SNP.TABLE”). A ‘Taitung No. 5’ heterozygous SNP 42728_45 was A/T in ‘Taitung No. 5’, T/T in other Taiwanese-bred varieties, and A/A in the rest of the core varieties (Appendix A Figure A1). To further discriminate the T/T genotype Taiwanese-bred varieties, an additional four homozygous SNPs were able to identify these varieties (Appendix A Figure A2). In this context, we developed a proposed workflow that facilitates the grouping of varieties using only seven SNPs (Appendix A Figure A1 and Figure A2). To simplify and strengthen the workflow, we provided a nine-SNP list as a toolkit to differentiate the core varieties (Table 4).
Table 4.
Genotypes of a 9-SNP toolkit in roselle core varieties based on ddRAD-seq and Sanger sequencing.
Using this nine-SNP toolkit, we were able to distinguish most of the core varieties, except ‘A128 Pinky’ (sample code 5) and ‘A129’ (sample code 6), which share identical genotypes, as well as ‘ACC Martin’ (sample code 28) and ‘Vimto’ (sample code 45). We further validated the genotypes of these nine SNPs in the core varieties using Sanger sequencing. All genotypes derived by ddRAD-seq and Sanger sequencing were identical. Although these two pairs of closely related varieties could not be discriminated from each other by the nine SNPs, the nine-SNP toolkit functions effectively as a barcode system to identify or classify the core varieties. Importantly, all Taiwanese-bred varieties can be identified by this nine-SNP barcode, establishing it as a novel genetic tool for the variety right protection of our TTDARES-bred varieties.
Subsequently, to develop a rapid, cost-effective, and low-tech identification platform, a KASP molecular marker identification system was created based on the selected SNP markers. Using Sanger-validated SNPs, we converted the nine validated SNPs into a set of KASP markers. These nine SNP markers were employed to establish the genotyping system (Figure 2). The results demonstrated that samples with identical genotypes clustered together following the KASP reaction (Figure 2). As anticipated, all KASP markers effectively discriminated between homozygous and heterozygous alleles (Figure 2 and Table 4), indicating that this system can classify germplasm by referencing known genotypes (Table 4). These findings suggest that the KASP technique is a valuable and reliable tool for genotyping based on SNP markers derived from ddRAD-seq data.
Figure 2.
Allelic discrimination using 9 KASP markers across 17 roselle core varieties. Orange circles and blue squares represent the homozygous genotypes; the green triangles represent heterozygous genotypes; and the black squares on the bottom left of the plot are no template controls.
3.4. Evaluation of the KASP Genotyping System with an Additional 54 Roselle Accessions
To evaluate the validity of the roselle germplasm identification system, an additional 54 roselle varieties were collected for KASP genotyping tests (Appendix A Table A1). Following the KASP reaction, the samples were classified into distinct groups based on the results from all KASP markers (Figure 3). The majority of genotypes among the roselle varieties exhibited homozygosity according to the SNP calling results (Figure 3). By integrating the KASP genotyping data from the 17 core varieties with the 54 newly genotyped accessions, all varieties included in this study were classified into distinct groups (Figure 4). Specifically, the varieties, ‘Taitung No. 1’, ‘Taitung No. 2’, ‘Taitung No. 4’, and ‘Taitung No. 5’, as well as varieties 4, 8, 9, 10, 24, 31, 36, 40, 43, 46, 49, 71, 73, 76*, and 81 were distinctly identified with unique 9-KASP SNP barcodes (Figure 4). In summary, these results demonstrate that the genetic characterization platform demonstrates high potential for screening roselle varieties, even within related genetic backgrounds.
Figure 3.
Allelic discrimination using 9 KASP markers across 54 roselle accessions. Orange circles and blue squares represent the homozygous genotypes; the green triangles represent heterozygous genotypes; and the black squares on the bottom left of the plot are no template controls.
Figure 4.
Hierarchical clustering of roselle varieties based on KASP genotyping of 9 SNP markers. The heatmap visualizes the clustering results, with samples (columns) grouped using the Manhattan distance metric and Ward’s D2 method. The color scale indicates the genotype values: blue, AA; yellow, BB; green, AB; grey, not detected (n.d.). In each SNP, A and B genotypes are assigned as following: 20162_54, A=T, B=C; 36343_44, A=A, B=G; 42308_57, A=A, B=G; 42728_45, A=A, B=T; 46313_71, A=C, B=T; 6542_68, A=G, B=T; 69354_27, A=C, B=A; 92456_35, A=C, B=G; 95813_33, A=G, B=A. The solid triangle (▲) indicates the 9 SNP barcode is unique in this accession among all examined germplasms. A sample code followed by an asterisk (*) indicates that the origin or information for this line is missing or uncertain. Accessions with the same Sample Code, with or without an asterisk, may be derived from a common ancestor, synonymous, or independent origins.
4. Discussion
4.1. The Integration of a Molecular Marker-Based Genotyping System Is Crucial for Enhancing Germplasm Identification Beyond Traditional Morphological Indicators
Roselle (Hibiscus sabdariffa L.) is a crop rich in bioactive compounds. The inconsistency in quality among the diverse landraces of roselle developed by breeders has resulted in fluctuating purchase prices in the market. This study aimed to establish a breeder-accessible variety identification system to enhance the utilization of genetic resources within breeding programs and protect variety rights. A total of 71 roselle accessions were collected, and 17 core varieties were identified based on phenotypes and geographic origins, including Taiwanese-bred varieties developed by TTDARES and Known-You Seed (Table 1). Initial evaluations using morphological traits, such as calyx color and fruit shape [19,41], allowed for the preliminary distinction of some varieties (Table 1). However, identification based solely on phenotypic traits proved challenging for closely related varieties such as ‘Taitung No. 1’ and ‘Taitung No. 3’, as well as ‘ACC Martin’ and ‘Vimto’ (Table 1). Furthermore, phenotypic assessment is labor-intensive, requires highly trained personnel, and is susceptible to environmental influences [5,6]. Consequently, to reduce labor costs and mitigate the impact of environmental variations on phenotypic characterization, there is a pressing need for a more precise system for identifying roselle varieties. A variety identification system grounded in genetic variance, utilizing polymorphisms across individuals within a population, can offer improved resolution for germplasm identification. Therefore, a marker-based genotyping platform presents a feasible and efficient approach for the identification of roselle varieties.
We collected a total of 71 roselle accessions, from which 17 were selected as representative core varieties for marker identification. While a small core population may limit the identification of effective markers. There are several reasons for selecting only 17 core varieties. First, these 17 varieties have the most complete and stable phenotypic records, supported by our extensive field trials and multiple years of observations. Some of them are even listed as representative reference varieties in the governmental Roselle Variety Descriptor table (please see Supplementary Materials “Roselle Trait Table.pdf”). Their stable phenotypic traits ensure that they are reliable representatives for the study. Second, the selected core varieties represent those with traits of high value for breeding programs, including calyx color, fruit shape, fruit end, and leaf shape, all of which contribute to fruit quality, ornamental value, and the ease of seed collection. These traits also exhibit sufficient polymorphism to capture the genetic diversity relevant to breeding goals. Third, the 17 core varieties encompass a diverse range of geographic origins, which helps ensure that the markers identified are applicable across different environmental conditions and regions. Finally, the core varieties include locally developed varieties, particularly those developed by our team at TTDARES. Developing genetic markers for these local varieties is especially important as it supports ongoing breeding efforts and genetic research within the region. The tools developed in this study aim to enhance the value and competitiveness of our local germplasm, bolstering its utility in both research and commercial applications.
4.2. DdRAD-Seq as an Effective Tool for Polymorphism Exploration and Genetic Diversity Analysis on Roselle Genotype
To develop a genetic marker-based genotyping platform aimed at identifying genetic polymorphisms across roselle varieties exhibiting similar phenotypes, previous studies utilized various molecular markers to evaluate genetic diversity in roselle (Hibiscus sabdariffa L.) and its relative, kenaf (H. cannabinus L.). Specifically, RAPD-PCR reactions have been conducted on roselle and kenaf varieties, yielding between 30 and 149 polymorphic sites for genetic similarity analyses [12,13]. Furthermore, an analysis of 84 kenaf germplasms employing 28 ISSR primers identified a total of 193 polymorphisms [17]. In another study, molecular analyses using ISTR markers reported 80 polymorphic loci [16]. Additionally, AFLP analysis generated a wide range of polymorphic markers, with reports indicating between 229 and 3193 polymorphisms derived from various primer combinations applied to kenaf and roselle accessions [9,10,11]. In contrast to these earlier methods, ddRAD-seq in this study identified a substantial 53,746 SNPs across 17 selected roselle varieties, highlighting its enhanced capacity for generating a higher density of markers across the roselle genome.
This study retained over 94% of high-quality raw reads following the pipeline for filtering low-quality bases in ddRAD-seq (Table 2). Specifically, we filtered out SNPs with a minor allele frequency lower than 5% and excluded loci that significantly deviated from Hardy–Weinberg equilibrium (HWE), which filters are designed to eliminate SNPs with poor data quality or those that may reflect population stratification or evolutionary influences. Furthermore, the utilization of restriction enzymes for genome complexity reduction significantly contributed to achieving a high average sequencing depth (Table 3). A sequencing depth of over 26 is usually considered reliable, as it maintains an experimental-wise Type I error below 0.05 using the Bonferroni adjustment procedure for more than a million SNP markers. In our case, the sequencing depth ranged between 65× to 145× between varieties. While the low-bias SNP filtering and high sequence coverage enforce the confidence of our data, some limitations may be still associated with the pipeline. While the Bonferroni adjustment procedure effectively controlled for false positives, it might be overly conservative and potentially lead to the exclusion of biologically relevant SNPs.
Additionally, the transition/transversion (Ts/Tv) ratio serves as a key quality control indicator for evaluating overall SNP quality [42,43]. The Ts/Tv ratios across all tested roselle varieties are comparable and approximate a value of two (Table 3), indicating a high specificity and a limited false-positive rate in the variant calling results. Among the assessed varieties, most exhibited a homozygous to heterozygous SNP ratio (Hom/Hets) of approximately 0.7 (Table 3), which is consistent with their self-pollinated nature. This ratio suggested more stable and consistent phenotypic performance, making these varieties suitable for use as parental lines. In contrast, ‘Taitung No. 5’, ‘A128 Pinky’ (sample code 5), and ‘A129’ (sample code 6) exhibited Hom/Hets ratios around 0.4–0.5 (Table 3), indicating a higher degree of cross-pollination in their genetic backgrounds. These varieties may be used for greater genetic recombination and the development of novel trait combinations. In addition, ‘Taitung No. 5’, a hybrid of ‘A129’ and ‘Taitung No. 3’, displayed the lowest ratio of homozygous to heterozygous sites (Table 3). This observation aligns with its genetic background and further supports the reliability of the SNPs identified through ddRAD-seq.
This study primarily focused on homozygous SNPs due to roselle’s self-pollinating and allotetraploid nature (2n = 4x = 72). Homozygous SNPs offer greater stability across generations, particularly for self-pollinating crops like roselle, as heterozygous SNPs tend to become fixed over successive generations of selfing, reducing their informativeness. While heterozygous markers were not a primary focus, our high sequencing depth minimized the risk of misclassifying heterozygous genotypes as homozygous. Thus, heterozygous SNPs identified here may still provide valuable insights for genetic analyses and breeding programs targeting novel trait combinations.
Using high-quality SNPs derived from ddRAD-seq, we successfully defined genetic relationships between selected roselle varieties (Figure 1). The self-pollinating nature of roselle, which promotes high genetic homozygosity, enabled us to identify 1925 homozygous SNPs across all 17 core varieties. This robust SNP dataset serves as a valuable tool for roselle genetic characterization (Figure 1C). Notably, while ‘ACC Martin’ and ‘Vimto’ shared identical genotypes for homozygous SNP loci, they were distinguishable through the broader genetic diversity analysis conducted via ddRAD-seq when using all 53,746 SNPs (Figure 1), highlighting the advantage of using high-density genetic markers. Compared to AFLP and RAPD markers, SNP markers derived from ddRAD-seq are recognized for their high reproducibility and stronger linkage to biological functions and phenotypic traits [44,45]. The ddRAD-seq approach can be re-performed for other accessions to obtain high-reliability SNP markers for fingerprinting purposes. This suggests that the SNPs identified through ddRAD-seq possess superior potential for enhancing the resolution of germplasm characterization in genotyping efforts.
4.3. The KASP Genotyping Technique Can Be Successfully Applied to Roselle Germplasm Identification
Despite the efficacy of ddRAD-seq as a high-throughput approach for discovering genetic markers and assessing genetic diversity among unknown roselle samples, it is difficult to widely apply the ddRAD-seq technique for breeders in germplasm identification practice due to the computational threshold. To improve the accessibility of genotyping tools, we propose the KASP genotyping system as a more suitable alternative. KASP is a PCR-based fluorescent SNP genotyping method that precisely determines genotypes in individual samples [28]. This technique has been extensively utilized in germplasm identification across various species, including grape cultivars, mung bean, and rice [46,47,48]. Given roselle’s self-pollinating nature and tetraploid characteristics, we prioritized the selection of homozygous SNPs to mitigate errors associated with heterozygous genotypes and reduce complexity.
In the present study, we established a germplasm identification strategy using SNP markers derived from ddRAD-seq, and successfully converted a total of nine SNPs into KASP markers (Figure 2). This KASP marker set effectively characterized the genotypes of roselle across various accessions (Figure 2, Figure 3 and Figure 4), except for some accessions when a larger number of varieties were used (Figure 4). These results demonstrated that this system is viable for identification of core varieties or germplasm classification. To utilize this KASP-based germplasm identification system for common roselle varieties, different KASP marker sets can be used based on the different objectives. Among all KASP markers, a combination of three KASP markers, 42728_45, 46313_71, and 95313_33, could classify the origins of roselle varieties (Appendix A Figure A1); the 42728_45, 69354_27, 6542_68, and 92456_35 KASP marker set could be used to discriminate Taiwanese-bred varieties, ‘Taitung No. 1’ to ‘Taitung No. 5’ (Appendix A Figure A2). Using all KASP markers can identify most common varieties; however, some varieties with identical homozygous SNP genotypes remain indistinguishable, such as ‘A128 Pinky’ and ‘A129’; ‘ACC Martin’ and ‘Vimto’.
4.4. Limitations and Future Perspectives
The developed KASP markers successfully classify the origins of roselles (Table 4; Appendix A Figure A1), identifying core varieties and discriminating key germplasms for our roselle breeding program (Figure 2, Figure 3 and Figure 4; Appendix A Figure A2). However, relying solely on a limited set of selected SNPs may not be sufficient to differentiate closely related varieties. In addition, the small number of markers used in this study restricts this tool’s ability to fully resolve the origins of large populations (Figure 4). To achieve more accurate differentiation among varieties, incorporating additional SNP markers identified through ddRAD-seq (Supplementary Materials “1952.SNP.CONTIGS.fa” and “1952.HOMO.SNP.TABLE”) may be necessary.
In terms of future perspectives, recent advancements in genome resources of H. sabdariffa [7] provide an opportunity to map the identified SNPs back to the genome, creating a high-density molecular marker system. Coupled with more intensive trait information, these data can be utilized for GWAS to identify key chromosomal regions associated with specific traits. This approach will facilitate functional research on genes of interest and their application in breeding programs.
5. Conclusions
The effective utilization of roselle genetic resources and the protection of roselle variety rights require reliable tools for variety characterization. The present study successfully identified 53,746 SNP markers across 17 core roselle varieties. By utilizing SNP markers identified through ddRAD-seq, we characterized the genetic relationships among 17 core roselle varieties. Furthermore, this research introduced a practical and breeder-friendly approach employing nine KASP markers to characterize roselle germplasm. To our knowledge, this is the first to provide high-density SNP markers for roselle, as well as accessible KASP genotyping tools for roselle germplasm identification. These advancements offer a valuable platform for the effective utilization of roselle genetic resources and hold significant potential to enhance roselle breeding programs.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae10121325/s1, Data S1: The list of 1952 homozygous SNPs common in 17 core roselle varieties (File: “1952.HOMO.SNP.TABLE”); Data S2: The contig sequences of the 1952 homozygous SNP loci (File: “1952.SNP.CONTIGS.fa”); Data S3: The list of ‘Taitung No. 5’ heterozygous SNPs common in 17 core roselle varieties (File: “HETERO.SNP.TABLE”); Data S4: The contig sequences of the ‘Taitung No. 5’ heterozygous SNP loci (File: “HETERO.SNP.CONTOGS.fa”).
Author Contributions
Conceptualization, J.-W.C., Y.-C.L. and F.-C.H.; methodology, K.-Y.C., J.-Y.O. and F.-C.H.; validation, S.-J.H., Y.-L.W., C.-H.H., J.-Y.L. and J.-W.W.; formal analysis, J.-Y.O. and S.-J.H.; investigation, J.-Y.O., S.-J.H. and F.-C.H.; resources, K.-Y.C., J.-W.C., Y.-C.L. and F.-C.H.; writing—original draft preparation, J.-Y.O., S.-J.H. and F.-C.H.; writing—review and editing, Y.-C.L. and F.-C.H.; visualization, J.-Y.O., S.-J.H. and F.-C.H.; supervision, Y.-C.L. and F.-C.H.; funding acquisition, F.-C.H. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Ministry of Agriculture, Taiwan (grant number 108AS-1.2.1-ST-a5 and 109AS-1.1.5-ST-a3). The open access and Article Processing Charge (APC) were funded by the National Science and Technology Council, Taiwan (grant number NSTC 112-2313-B-002-050-MY3). The research was also supported by the National Taiwan University and Taitung District Agricultural Research and Extension Station.
Data Availability Statement
The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.
Acknowledgments
The authors thank NTU, Academia Sinica, and Taitung District Agricultural Research and Extension Station for their support and facility. The authors would like to thank the High-Throughput Genomics Core at the Biodiversity Research Center, Academia Sinica, for NGS sequencing services. The authors would also like to acknowledge Technology Commons at the College of Life Science, NTU, and Yen-Chou Kuan at the Department of Horticulture and Landscape Architecture, NTU, for facility support.
Conflicts of Interest
The authors declare no conflicts of interest.
Appendix A
Table A1.
A collection of 71 roselle accessions was used for core variety identification and the KASP genotyping system in the study.
Table A1.
A collection of 71 roselle accessions was used for core variety identification and the KASP genotyping system in the study.
| Sample Code | TTDARES Code | Original Identifier | Variety | Phenotype | Source |
|---|---|---|---|---|---|
| 0611 | - 1 | - | Taitung No. 5 | Peach Calyx, Ovoid fruit, oval leaf | TTDARES |
| 1 | TTD01 | A123 | - 1 | Black calyx | Burkina Faso |
| 2 | TTD02 | A125 | - | - | Burkina Faso |
| 3 | TTD03 | A126 | - | Black calyx | Burkina Faso |
| 4 | TTD04 | A128 white | - | - | Burkina Faso |
| 5 | - | A128 pinky | - | Pink calyx, spheroid fruit, digitate leaf | Burkina Faso |
| 6 | - | A129 | - | Oblate fruit, oval leaf | Burkina Faso |
| 8 | TTD07 | A130 | - | - | Burkina Faso |
| 9 | TTD08 | A131 | - | - | Burkina Faso |
| 10 | - | Taibai | Taibai | Ovoid fruit, penta lobed leaf | Taitung |
| 10 2* | TTD09 | A132 | - | - | Burkina Faso |
| 11 | - | - | Taitung No. 3 | Dark red calyx, ovoid fruit, penta lobed leaf | TTDARES |
| 12 | - | - | Taitung No. 1 | Red calyx, ovoid fruit, penta lobed leaf | TTDARES |
| 13 | - | - | Taitung No. 2 | Red calyx, crown fruit, penta lobed leaf | TTDARES |
| 15 | - | - | Taitung No. 4 | Dual (red/white) fruit, ellipsoid fruit, penta lobed leaf | TTDARES |
| 17 | TTD16 | Nukung | - | - | Costa Rica |
| 18 | TTD17 | t141 | Local variety ‘Victor’ | - | Chiayi Agricultural Experiment Branch, Taiwan Agricultural Research Institute |
| 19 | TTD18 | YMC | - | - | Jamaica |
| 20 | TTD19 | t141C A2 Variegated leaves | Local variety ‘Victor’ | Variegated leaves | Natural Variation of t141 |
| 21 | TTD20 | Green(TS-95) | Local variety ‘Victor’ | - | Taitung |
| 22 | TTD21 | Kuang-Hui | - | early-ripening variety (Sept. fruiting) | Local variety (provided by Kuang-Hui Lin) |
| 23 | TTD22 | Tamsui | - | early-ripening variety (Aug. fruiting) | Local variety (provided by National Chiayi University) |
| 24 | - | Cocktail White | Cocktail White | White calyx, oblate fruit, digitate leaf | Known-You |
| 25 | - | Cocktail Red | Cocktail Red | Red calyx, oblate fruit, digitate leaf | Known-You |
| 28 | - | VI060115, 2017A01573 | ACC Martin | Purplish red calyx, crown fruit, penta lobed | Mali |
| 30 | CT03 | Cocktail Purple | Cocktail Purple | - | Known-you |
| 31 | CT04 | Lobed leaves | Cocktail Red Violet | - | Known-you |
| 32 | - | VI060119, 2017A01577 | Koor | Green calyx, ovoid fruit, penta lobed | Mali |
| 32 * | CT05 | Tamsui | Cocktail Tamsui | - | Tamsui |
| 34 | AV02 | VI060116-1, 2017A01574 | Dah Blanc | - | Mali |
| 35 | - | VI060123-A, 2017A01580 | L7 | Green calyx, ellipsoid fruit, penta lobed leaf | Mali |
| 35 * | AV03 | VI060117-1, 2017A01575 | Dah Rouge | - | Mali |
| 36 | - | VI060124, 2017A01581 | Mandeka | White calyx, spheroid fruit, digitate leaf | Mali |
| 36 * | AV04 | VI060118, 2017A01576 | llafia | - | Mali |
| 38 | AV06 | VI060121, 2017A01578 | L24 | - | Mali |
| 39 | AV07 | VI060122, 2017A01580 | L28 | - | Mali |
| 40 | - | VI060125-A, 2017A01582 | Marohe de Bozola | Pink calyx, acuminate ovoid fruit, penta lobed leaf | Mali |
| 43 | - | VI060128, 2017A01585 | Vert CDH | White calyx, ovoid fruit, penta lobed leaf | Mali |
| 45 | - | VI060130-B, 2017A01587 | Vimto | Purplish red calyx, crown fruit, penta lobed leaf | Mali |
| 46 | AV14 | VI060126, 2017A01583 | Novorongo | - | Mali |
| 47 | AV15 | VI060127, 2017A01584 | Samandah | - | Mali |
| 49 | AV17 | VI060129-1, 2017A01586 | Vert Fatick | - | Mali |
| 52 | TARI02 | 2010A00445 | Katiap Deng Or In Ranong ‘Som Mynmar’ | - | NPGRC 3 |
| 53 | TARI03 | 2010A00446 | Rau Chua | - | NPGRC |
| 54 | TARI04 | 2010A00447 | Kra Tiyap Daeng | - | NPGRC |
| 55 | TARI05 | 2010A00448 | Kra-Jeat-Daeng[TOT5437] | - | NPGRC |
| 56 | TARI06 | 2010A00449 | Kra-Jeat-Daeng[TOT5438] | - | NPGRC |
| 57 | TARI07 | 2010A00450 | Kra-Jeat-Daeng[TOT5439] | - | NPGRC |
| 58 | TARI08 | 2010A00451 | TOT5516 | - | NPGRC |
| 59 | TARI09 | 2010A00452 | TOT5523 | - | NPGRC |
| 60 | TARI10 | 2010A00453 | TOT5674 | - | NPGRC |
| 61 | TARI11 | 2010A00454 | TOT5770 | - | NPGRC |
| 62 | TARI12 | 2010A00455 | Ribena | - | NPGRC |
| 64 | TARI14 | 2010A00457 | Som Phody[TOT7482] | - | NPGRC |
| 65 | TARI15 | 2010A00458 | Som Pho Di | - | NPGRC |
| 66 | TARI16 | 2010A00459 | Somphodee | - | NPGRC |
| 67 | TARI17 | 2010A00460 | TOT7813 | - | NPGRC |
| 68 | TARI18 | 2010A00461 | TOT7843 | - | NPGRC |
| 71 | TARI21 | 2017A01560 | BISSAP[VI038286] | - | NPGRC |
| 72 | TARI22 | 2017A01561 | BISSAP[VI038287] | - | NPGRC |
| 72 * | uncertain | - | - | - | - |
| 73 | TARI23 | 2017A01562 | MAK SOMPODI | - | NPGRC |
| 73 * | uncertain | - | - | - | - |
| 74 | TARI24 | 2017A01563 | CHUKUR SHAK | - | NPGRC |
| 76 | TARI26 | 2017A01565 | SABUJ CUKAIR | - | NPGRC |
| 76 * | uncertain | - | - | - | - |
| 77 | TARI27 | 2017A01566 | KRA CHIAP DAENG | - | NPGRC |
| 79 | TARI29 | 2017A01568 | VI049883 | - | NPGRC |
| 81 | TARI31 | 2017A01570 | SOMPHODEE[VI055841] | - | NPGRC |
| 82 | TARI32 | 2017A01571 | SOMPHODEE[VI055972] | - | NPGRC |
| 83 | TARI33 | 2017A01572 | SOMPHODEE[VI055985] | - | NPGRC |
1, indicates data not available. 2*, a sample code followed by an asterisk (*) indicates that the origin or information for this line is missing or uncertain. Accessions with the same Sample Code, with or without an asterisk, may be derived from a common ancestor, synonymous, or independent origins. 3 NPGRC represents the variety collected from National Plant Genetic Resources Center of Taiwan Agricultural Research Institute.
Table A2.
Primer lists of SNP markers for Sanger sequencing and KASP genotyping.
Table A2.
Primer lists of SNP markers for Sanger sequencing and KASP genotyping.
| SNP Marker 1 | Primer Name | Sequence (5′-3′) | Ta (°C) 2 |
|---|---|---|---|
| For sequencing | |||
| 20162_54 | Hs20162s-F1 | GCAGCTAGTTTCAATACTAGATGAATG | 52.4 |
| Hs20162s-R1 | CTAGTTCTGAAAACCATAGCCCTGT | 54.2 | |
| 36343_44 | Hs36343s-F1 | TGGGCTTCAGTAAAATGGCAG | 54.4 |
| Hs36343s-R1 | GCATACCTTCGACACAACTCCG | 56.0 | |
| 42308_57 | Hs42308-F1 | GCAGAGCATCAACAGCACCCG | 60.2 |
| Hs42308s-R1 | GCTTCTGTAGGTGTATCCTGCAAAG | 55.4 | |
| 42728_45 | Hs42728s-F1 | TTTGTAGGAATACAAGTGACCAGCA | 54.7 |
| Hs42728s-R1 | GAAAATTCAGGTGTTTGCGTGT | 53.4 | |
| 46313_71 | Hs46313s-F1 | GCACAAGTAAATCCTACTGCAATTTATG | 56.0 |
| Hs46313s-R1 | TCAACAGCACGCAAACCATC | 54.3 | |
| 6542_68 | Hs6542s-F1 | AGAAGTGCCAACCCCGTGTA | 54.4 |
| Hs6542s-R1 | TTGACCCTGAGTTTGTTGGATG | 54.0 | |
| 69354_27 | Hs69354s-F1 | AGTCGGTGATATGCTTTTGTGC | 53.5 |
| Hs69354s-R1 | GATCGGAGAAGGTCGAACATG | 53.5 | |
| 92456_35 | Hs92456s-F1 | GCAGGTACTTTCACAACCATCCA | 55.5 |
| Hs92456s-R1 | GCTTGTTCGAGCTTCCCAAG | 54.1 | |
| 95813_33 | Hs95813s-F1 | CAGGTCTTCATGCAAGCCATG | 55.5 |
| Hs95813s-R1 | AGCCGTTGGGGTCCACCT | 56.3 | |
| For KASP genotyping | |||
| 20162_54 | Hs20162-F5-(FAM) | ATTTCGAAATCATTTGAAGGTGGT | 54.9 |
| Hs20162-F5-(HEX) | ATTTCGAAATCATTTGAAGGTGGC | 57.3 | |
| Hs20162s-R1 | CTAGTTCTGAAAACCATAGCCCTGT | 54.2 | |
| 36343_44 | Hs36343-F1 | TGCAGCCAACTTCGATCTGTTGTG | 61.0 |
| Hs36343-R1-(FAM) | GTCCTCTGATAGACGGAAACTGGTTGTAAC | 60.7 | |
| Hs36343-R1-(HEX) | GTCCTCTGATAGACGGAAACTGGTTGTAAT | 60.3 | |
| 42308_57 | Hs42308a-F1-(FAM) | CCGTCGACTCCACATTCTAACAACA | 59.0 |
| Hs42308a-F1-(HEX) | CCGTCGACTCCACATTCTAACAACG | 60.6 | |
| Hs42308a-R1 | CCTTTGCTTTTCTCATGGTATGCTTC | 58.5 | |
| 42728_45 | Hs42728-F1-(FAM) | GTTTTTGTAGGAATACAAGTGACCAGCAA | 59.0 |
| Hs42728-F1-(HEX) | GTTTTTGTAGGAATACAAGTGACCAGCAT | 58.3 | |
| Hs42728-R1 | GGTGTTTGCGTGTATCATTTCATTTGC | 61.3 | |
| 46313_71 | Hs46313-F1 | CACAAGTAAATCCTACTGCAATTTATGGAGC | 60.6 |
| Hs46313-R1-(FAM) | ACAGCACGCAAACCATCGGAAG | 60.8 | |
| Hs46313-R1-(HEX) | ACAGCACGCAAACCATCGGAAA | 61.1 | |
| 6542_68 | Hs6542-F1 | CCGTGTATCATTCCAAAATGAAGCA | 58.9 |
| Hs6542-R1-(FAM) | TTGTTGGATGCCACCTTTTCCC | 59.5 | |
| Hs6542-R1-(HEX) | TTGTTGGATGCCACCTTTTCCA | 58.8 | |
| 69354_27 | Hs69354-F1-(FAM) | GCAGTCGGTGATATGCTTTTGTGCTC | 61.8 |
| Hs69354-F1-(HEX) | GCAGTCGGTGATATGCTTTTGTGCTA | 60.4 | |
| Hs69354-R1 | GATCGGAGAAGGTCGAACATGAACA | 60.2 | |
| 92456_35 | Hs92456-F2 | TGCAGGTACTTTCACAACCATCCAAG | 60.1 |
| Hs92456-R2-(FAM) | ACTGCTTCTGCTCGGCATCATG | 59.0 | |
| Hs92456-R2-(HEX) | ACTGCTTCTGCTCGGCATCATC | 58.1 | |
| 95813_33 | Hs95813-F1-(FAM) | TGCAAGCCATGCATCTCATCG | 59.2 |
| Hs95813-F1-(HEX) | TGCAAGCCATGCATCTCATCA | 57.3 | |
| Hs95813s-R1 | AGCCGTTGGGGTCCACCT | 56.3 | |
| FAM and HEX label for KASP genotyping | |||
| 5′ FAM tag | GAAGGTGACCAAGTTCATGCT | N/A 3 | |
| 5′ HEX tag | GAAGGTCGGAGTCAACGGATT | N/A | |
1 SNP Marker: the SNP markers selected from ddRAD-seq results. It is defined by contig_bp position. 2 Ta, annealing temperature, is calculated using the thermodynamic properties function of Vector NTI. 3 N/A: not applicable.
Figure A1.
Classification of 17 core varieties aimed at origins by using 3 SNPs. The two numbers in a box indicate SNP ID, in which the first number is contig ID and the second number is SNP position in the contig. The N/N indicates the genotypes of the SNP. The Italic number indicates the sample code (Table 1).
Figure A2.
Classification of Taiwanese-bred variety by using 5 SNPs. The two numbers in a box indicate SNP ID, in which the first number is contig ID and the second number is SNP position in the contig. The N/N indicates the genotypes of the SNP. The Italic number indicates the sample code (Table 1).
References
- Da-Costa-Rocha, I.; Bonnlaender, B.; Sievers, H.; Pischel, I.; Heinrich, M. Hibiscus sabdariffa L.—A phytochemical and pharmacological review. Food Chem. 2014, 165, 424–443. [Google Scholar] [CrossRef] [PubMed]
- Mardiah; Zakaria, F.R.; Prangdimurti, E.; Damanik, R. Anti-inflammatory of purple roselle extract in diabetic rats induced by streptozotocin. Proc. Food Sci. 2015, 3, 182–189. [Google Scholar] [CrossRef]
- Yang, M.-Y.; Peng, C.-H.; Chan, K.-C.; Yang, Y.-S.; Huang, C.-N.; Wang, C.-J. The hypolipidemic effect of Hibiscus sabdariffa polyphenols via inhibiting lipogenesis and promoting hepatic lipid clearance. J. Agric. Food Chem. 2010, 58, 850–859. [Google Scholar] [CrossRef] [PubMed]
- Mozaffari-Khosravi, H.; Jalali-Khanabadi, B.A.; Afkhami-Ardekani, M.; Fatehi, F.; Noori-Shadkam, M. The effects of sour tea (Hibiscus sabdariffa) on hypertension in patients with type II diabetes. J. Hum. Hypertens. 2009, 23, 48–54. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.; Choi, S.R.; Kim, J.; Jeong, Y.-M.; Kim, J.-S.; Ahn, C.-H.; Kwon, S.-Y.; Lim, Y.P.; Shin, A.-Y.; Kim, Y.-M. Identification of accession-specific variants and development of KASP markers for assessing the genetic makeup of Brassica rapa seeds. BMC Genom. 2022, 23, 326. [Google Scholar] [CrossRef] [PubMed]
- Saxena, R.K.; Saxena, K.; Varshney, R.K. Application of SSR markers for molecular characterization of hybrid parents and purity assessment of ICPH 2438 hybrid of pigeonpea [Cajanus cajan (L.) Millspaugh]. Mol. Breed. 2010, 26, 371–380. [Google Scholar] [CrossRef]
- Kim, T.; Lee, J.H.; Seo, H.H.; Moh, S.H.; Choi, S.S.; Kim, J.; Kim, S.-G. Genome assembly of Hibiscus sabdariffa L. provides insights into metabolisms of medicinal natural products. G3 Genes Genom. Genet. 2024, 14, jkae134. [Google Scholar] [CrossRef]
- Kim, Y.-M.; Kim, S.; Koo, N.; Shin, A.-Y.; Yeom, S.-I.; Seo, E.; Park, S.-J.; Kang, W.-H.; Kim, M.-S.; Park, J. Genome analysis of Hibiscus syriacus provides insights of polyploidization and indeterminate flowering in woody plants. DNA Res. 2017, 24, 71–80. [Google Scholar]
- Kim, W.J.; Kim, D.S.; Kim, S.H.; Kim, J.-B.; Goh, E.J.; Kang, S.-Y. Analysis of genetic similarity detected by AFLP and PCoA among genotypes of kenaf (Hibiscus cannabinus L.). J. Crop Sci. Biotechnol. 2010, 13, 243–249. [Google Scholar] [CrossRef]
- Coetzee, R.; Herselman, L.; Labuschagne, M.T. Genetic diversity analysis of kenaf (Hibiscus cannabinus L.) using AFLP (amplified fragment length polymorphism) markers. Plant Genet. Resour.-C. 2009, 7, 122–126. [Google Scholar] [CrossRef]
- Cheng, Z.; Lu, B.-R.; Sameshima, K.; Fu, D.-X.; Chen, J.-K. Identification and genetic relationships of kenaf (Hibiscus cannabinus L.) germplasm revealed by AFLP analysis. Genet. Resour. Crop Ev. 2004, 51, 393–401. [Google Scholar] [CrossRef]
- Mohammed, O.; Islam, A.A.; Jahan, M.A.; Yaakob, Z.; Osman, M. Genetic relationship between roselle (Hibiscus sabdariffa L.) and kenaf (Hibiscus cannabinus L.) accessions through optimization of PCR based RAPD method. Emir. J. Food Agr. 2014, 26, 247–258. [Google Scholar]
- Guo, A.; Zhou, P.; Su, J. Random amplified polymorphic DNA (RAPD) analyses among Hibiscus cannabinus and related species. J. Trop. Subtrop. Bot. 2002, 10, 306–312. [Google Scholar]
- Cheng, Z.; Lu, B.R.; Baldwin, B.S.; Sameshima, K.; Chen, J.K. Comparative studies of genetic diversity in kenaf (Hibiscus cannabinus L.) varieties based on analysis of agronomic and RAPD data. Hereditas 2002, 136, 231–239. [Google Scholar] [CrossRef]
- Park, S.H.; Ginibun, F.C.; Roh, M.S.; Li, M.-X.; Suh, J.K.; Joung, Y.H. Evaluation of roselle based on the internal transcribed spacer sequence of rRNA gene. Emir. J. Food Agr. 2015, 27, 659–661. [Google Scholar] [CrossRef]
- Torres-Morán, M.I.; Escoto-Delgadillo, M.; Ron-Parra, J.; Parra-Tovar, G.; Mena-Munguía, S.; Rodríguez-García, A.; Rodríguez-Sahagún, A. Relationships among twelve genotypes of roselle (Hibiscus sabdariffa L.) cultivated in western Mexico. Ind. Crop. Prod. 2011, 34, 1079–1083. [Google Scholar] [CrossRef]
- Zhang, L.; Li, A.; Wang, X.; Xu, J.; Zhang, G.; Su, J.; Qi, J.; Guan, C. Genetic diversity of kenaf (Hibiscus cannabinus) evaluated by inter-simple sequence repeat (ISSR). Biochem. Genet. 2013, 51, 800–810. [Google Scholar] [CrossRef]
- Tao, A.F.; Qi, J.M.; Li, A.Q.; Fang, P.P.; Lin, L.H.; Wu, J.M.; Wu, W.R. The analysis of genetic diversity and relationship of elite kenaf germplasm based on inter-simple sequence repeats. Acta Agronom. Sin. 2005, 12, 1668. [Google Scholar]
- Sharma, H.K.; Sarkar, M.; Choudhary, S.B.; Kumar, A.A.; Maruthi, R.; Mitra, J.; Karmakar, P.G. Diversity analysis based on agro-morphological traits and microsatellite based markers in global germplasm collections of roselle (Hibiscus sabdariffa L.). Ind. Crop. Prod. 2016, 89, 303–315. [Google Scholar] [CrossRef]
- Satya, P.; Karan, M.; Chakraborty, K.; Biswas, C.; Karmakar, P. Comparative analysis of diversification and population structure of kenaf (Hibiscus cannabinus L.) and roselle (H. sabdariffa L.) using SSR and RGA (resistance gene analogue) markers. Plant Syst. Evol. 2014, 300, 1209–1218. [Google Scholar] [CrossRef]
- Elshire, R.J.; Glaubitz, J.C.; Sun, Q.; Poland, J.A.; Kawamoto, K.; Buckler, E.S.; Mitchell, S.E. A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. PLoS ONE 2011, 6, e19379. [Google Scholar] [CrossRef] [PubMed]
- Varshney, R.K.; Nayak, S.N.; May, G.D.; Jackson, S.A. Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends Biotechnol. 2009, 27, 522–530. [Google Scholar] [CrossRef] [PubMed]
- Mardis, E.R. The impact of next-generation sequencing technology on genetics. Trends Genet. 2008, 24, 133–141. [Google Scholar] [CrossRef] [PubMed]
- Baird, N.A.; Etter, P.D.; Atwood, T.S.; Currey, M.C.; Shiver, A.L.; Lewis, Z.A.; Selker, E.U.; Cresko, W.A.; Johnson, E.A. Rapid SNP discovery and genetic mapping using sequenced RAD markers. PLoS ONE 2008, 3, e3376. [Google Scholar] [CrossRef]
- Tian, H.-L.; Wang, F.-G.; Zhao, J.-R.; Yi, H.-M.; Wang, L.; Wang, R.; Yang, Y.; Song, W. Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties. Mol. Breeding 2015, 35, 136. [Google Scholar] [CrossRef]
- Sindhu, A.; Ramsay, L.; Sanderson, L.-A.; Stonehouse, R.; Li, R.; Condie, J.; Shunmugam, A.S.K.; Liu, Y.; Jha, A.B.; Diapari, M.; et al. Gene-based SNP discovery and genetic mapping in pea. Theor. Appl. Genet. 2014, 127, 2225–2241. [Google Scholar] [CrossRef]
- Varshney, R.K.; Thiel, T.; Sretenovic-Rajicic, T.; Baum, M.; Valkoun, J.; Guo, P.; Grando, S.; Ceccarelli, S.; Graner, A. Identification and validation of a core set of informative genic SSR and SNP markers for assaying functional diversity in barley. Mol. Breeding 2008, 22, 1–13. [Google Scholar] [CrossRef]
- Semagn, K.; Babu, R.; Hearne, S.; Olsen, M. Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): Overview of the technology and its application in crop improvement. Mol. Breeding 2014, 33, 1–14. [Google Scholar] [CrossRef]
- Steele, K.A.; Quinton-Tulloch, M.J.; Amgai, R.B.; Dhakal, R.; Khatiwada, S.P.; Vyas, D.; Heine, M.; Witcombe, J.R. Accelerating public sector rice breeding with high-density KASP markers derived from whole genome sequencing of indica rice. Mol. Breeding 2018, 38, 38. [Google Scholar] [CrossRef]
- Islam, M.S.; Thyssen, G.N.; Jenkins, J.N.; Fang, D.D. Detection, validation, and application of genotyping-by-sequencing based single nucleotide polymorphisms in upland cotton. Plant Genome 2015, 8, plantgenome2014.2007.0034. [Google Scholar] [CrossRef]
- Ryu, J.; Kim, W.J.; Im, J.; Kim, S.H.; Lee, K.-S.; Jo, H.-J.; Kim, E.-Y.; Kang, S.-Y.; Lee, J.-H.; Ha, B.-K. Genotyping-by-sequencing based single nucleotide polymorphisms enabled Kompetitive Allele Specific PCR marker development in mutant Rubus genotypes. Electron. J. Biotechnol. 2018, 35, 57–62. [Google Scholar] [CrossRef]
- Owen, H.; Pearson, K.; Roberts, A.M.; Reid, A.; Russell, J. Single nucleotide polymorphism assay to distinguish barley (Hordeum vulgare L.) varieties in support of seed certification. Genet. Resour. Crop Ev. 2019, 66, 1243–1256. [Google Scholar] [CrossRef]
- Ryu, J.; Kim, W.J.; Im, J.; Kang, K.-W.; Kim, S.H.; Jo, Y.D.; Kang, S.-Y.; Lee, J.-H.; Ha, B.-K. Single nucleotide polymorphism (SNP) discovery through genotyping-by-sequencing (GBS) and genetic characterization of Dendrobium mutants and cultivars. Sci. Hortic. 2019, 244, 225–233. [Google Scholar] [CrossRef]
- Li, W.; Zeng, X.; Li, S.; Chen, F.; Gao, J. Development and application of two novel functional molecular markers of BADH2 in rice. Electron. J. Biotechnol. 2020, 46, 1–7. [Google Scholar] [CrossRef]
- Richards, E.; Reichardt, M.; Rogers, S. Preparation of genomic DNA from plant tissue. Curr. Protoc. Mol. Biol. 1994, 27, 2.3.1–2.3.7. [Google Scholar] [CrossRef]
- Etter, P.D.; Bassham, S.; Hohenlohe, P.A.; Johnson, E.A.; Cresko, W.A. SNP discovery and genotyping for evolutionary genetics using RAD sequencing. In Molecular Methods for Evolutionary Genetics; Orgogozo, V., Rockman, M.V., Eds.; Humana Press: Totowa, NJ, USA, 2011; pp. 157–178. [Google Scholar]
- Rochette, N.C.; Rivera-Colón, A.G.; Catchen, J.M. Stacks 2: Analytical methods for paired-end sequencing improve RADseq-based population genomics. Mol. Ecol. 2019, 28, 4737–4754. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Ortiz, E.M. Vcf2phylip v2. 0: Convert a VCF Matrix into Several Matrix Formats for Phylogenetic Analysis; Zenodo: Geneva, Switzerland, 2019. [Google Scholar]
- Kozlov, A.M.; Darriba, D.; Flouri, T.; Morel, B.; Stamatakis, A. RAxML-NG: A fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 2019, 35, 4453–4455. [Google Scholar] [CrossRef]
- Mahajan, R.; Sapra, R.; Srivastava, U.; Singh, M.; Sharma, G. Minimal Descriptiors for Charecterization and Evaluation of Agri Horticultural Crops-Part 1; National Bureau of Plant Genetic Resources: New Delhi, India, 2000. [Google Scholar]
- Guo, Y.; Ye, F.; Sheng, Q.; Clark, T.; Samuels, D.C. Three-stage quality control strategies for DNA re-sequencing data. Brief. Bioinform. 2014, 15, 879–889. [Google Scholar] [CrossRef]
- Wang, J.; Raskin, L.; Samuels, D.C.; Shyr, Y.; Guo, Y. Genome measures used for quality control are dependent on gene function and ancestry. Bioinformatics 2015, 31, 318–323. [Google Scholar] [CrossRef]
- Mammadov, J.; Aggarwal, R.; Buyyarapu, R.; Kumpatla, S. SNP markers and their impact on plant breeding. Int. J. Plant Genom. 2012, 2012, 728398. [Google Scholar] [CrossRef] [PubMed]
- Vignal, A.; Milan, D.; SanCristobal, M.; Eggen, A. A review on SNP and other types of molecular markers and their use in animal genetics. Genet. Sel. Evol. 2002, 34, 275–305. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.-Q.; Fan, X.-C.; Zhang, Y.; Sun, L.; Liu, C.-H.; Jiang, J.-F. Establishment and application of an SNP molecular identification system for grape cultivars. J. Integr. Agr. 2022, 21, 1044–1057. [Google Scholar] [CrossRef]
- Tang, W.; Lin, J.; Wang, Y.; An, H.; Chen, H.; Pan, G.; Zhang, S.; Guo, B.; Yu, K.; Li, H.; et al. Selection and validation of 48 KASP markers for variety identification and breeding guidance in conventional and hybrid rice (Oryza sativa L.). Rice 2022, 15, 48. [Google Scholar] [CrossRef]
- Islam, A.S.M.F.; Blair, M.W. Molecular characterization of mung bean germplasm from the USDA core collection using newly developed KASP-based SNP markers. Crop Sci. 2018, 58, 1659–1670. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).