Next Article in Journal
Increasing the Brazilian Lychee Production: A Strategy Based on the Experience of the Largest Producer Countries
Next Article in Special Issue
Genomic Characterization and Functional Validation of Six cis-Regulatory Sequences in Medicinal Plant Andrographis paniculata
Previous Article in Journal
Septoria Leaf Spot of Tomatoes: Historical Insights, Present Challenges, and Future Prospects
Previous Article in Special Issue
Optimizing the In Vitro Propagation of Tea Plants: A Comparative Analysis of Machine Learning Models
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis

Institute of Livestock Grass and Green Agriculture, Gansu Academy of Agricultural Sciences, Lanzhou 730070, China
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(12), 1300; https://doi.org/10.3390/horticulturae10121300
Submission received: 10 November 2024 / Revised: 23 November 2024 / Accepted: 27 November 2024 / Published: 5 December 2024
(This article belongs to the Special Issue Breeding, Cultivation, and Metabolic Regulation of Medicinal Plants)

Abstract

:
Angelica sinensis is a perennial herbaceous species mainly cultivated in the Gansu, Yunnan, and Qinghai provinces of China, and its dried roots have been widely used for nourishing blood and harmonizing vital energy, largely relying on its bioactive compounds (e.g., alkylphthalides, polysaccharides, and flavonoids). In recent years, viral diseases have been suspected to be present in A. sinensis in field cultivation. In order to reveal the infection status and causes, a survey and the identification of viral diseases and their influence on the yield and quality of A. sinensis were conducted in four different counties of Gansu province. The results showed viral disease rates of ca. 21% to 37% for potato virus Y (PVY) and tomato mosaic virus (ToMV), as well as ca. 2.8- to 8.9-fold decreases in root yield on a unit-area basis; meanwhile, the contents of the main bioactive compounds (i.e., ferulic acid, ligustilide, and polysaccharides) were significantly lower in the virus-infected plants (VIPs) compared with the virus-free plants (VFPs); there were significant positive relationships of the viral disease rate with planting density and expression levels of the PVY-coat protein (CP) and ToMV-CP genes (p < 0.01). The above-mentioned observations indicate that it is necessary and urgent to take measures (e.g., controlling plant density, rational rotation, and using virus-free seedlings) to prevent the spread of plant viruses.

1. Introduction

Angelica sinensis (Oliv.) Diels (family Apiaceae), commonly referred to as Dang Gui, is a perennial herbaceous species mainly cultivated in the Gansu, Yunnan, and Qinghai provinces of China [1,2]. The dried roots are among the most important traditional Chinese medicines, generally known as female ginseng, and have been used to nourish blood and harmonize vital energy for over 2000 years [1,3]. In recent years, the roots have also been utilized in the treatment of acute ischemic stroke and cardio-cerebrovascular disease and have been used as anti-inflammatories, among other things [4,5]. These pharmaceutical properties largely rely on bioactive compounds, including alkylphthalides, polysaccharides, flavonoids, and phenolics, among others [3,5,6].
With increasing market demand, the average annual demand for dried roots has reached ca. 30,000 t, which has prompted the artificial cultivation areas to expand to over 43,000 ha [7,8]. However, the high yield of these roots is mainly limited to a rate of around 50% due to early bolting and around 30% due to diseases (e.g., Ditylenchus destructor, root rot, and brown spot) [2,7,9,10,11]. In recent years, various strategies have been implemented to inhibit early bolting using elite germplasms and storing seedlings to avoid vernalization and to control diseases using rational rotation and standard management in the field [9,12]. In recent years, the viral diseases of potato virus Y (PVY) and tomato mosaic virus (ToMV) have been found in A. sinensis. The typical morphological symptoms of PVY and ToMV include slight mosaic-like patterns on leaves, yellow and green spots, and becoming hard and brittle [13,14].
Extensive investigations have found that viral diseases seriously reduced the yield and quality of crops and medicinal plants [15,16,17]. For example, the yield and the primary (e.g., chlorophyll, sugar, and amino acids) and secondary metabolite (e.g., rehmannioside C, rehmannioside D, and leonuride) contents of Rehmannia glutinosa gradually decreased when the plants were infected with viral diseases (e.g., ToMV, tobacco mosaic virus (TMV), and Rehmannia mosaic virus (ReMV)) [15,16]; the degeneration of Chrysanthemum morifolium infected with viral diseases (e.g., PVY, potato virus X (PVX), and cucumber mosaic virus (CMV)) [17,18] decreased yield and quality, and the degeneration of Pinellia ternata infected with viral diseases (e.g., CMV, konjac mosaic virus (KoMV), and soybean mosaic virus (SMV)) decreased yield and quality [19,20]. Recently, several methods have been created to identify viral diseases, such as the deep sequencing of small RNA [19], morphological observation (using transmission electron microscopy (TEM)) [13,19], and molecular biology validation (using quantitative real-time polymerase chain reaction (qRT–PCR)) [14,19]. In this study, the viral diseases PVY and ToMV were surveyed and identified, and their influence on the yield and quality of A. sinensis was assessed in Gansu province, with the aim of revealing the causes of viral disease infection and providing a useful reference for the prevention and control of infection in A. sinensis.

2. Materials and Methods

2.1. Survey Sites

Four counties (Minxian, Weiyuan, Zhangxian, and Tanchang), which are natural areas of A. sinensis (cultivar Mingui 1) production in Gansu province, China, were chosen for this study, with five different towns (i.e., sites) randomly selected in each county; in addition, there were different crops extant at different sites. The specific information is shown in Table 1.

2.2. Survey of Planting Density and Viral Disease

From 15 to 20 July 2023, the “five-point method” (5 m × 5 m) was used to survey the planting density (PD) and viral disease rate (VDR) for each site. The specific formula is as follows:
PD (plants/m2) = NP (plants)/[5 (m) × 5 (m)]
where PD and NP represent the planting density and the number of plants per point (5 m × 5 m), respectively.
VDR (%) = NPVD (plants)/NTP (plants) × 100%
where VDR, NPVD, and NTP represent the viral disease rate, the number of plant viral diseases, and the number of total plants, respectively.
After the survey of PD and VDR, the leaves infected with viruses were collected, rinsed in the water, and frozen in liquid nitrogen for qRT–PCR validation. Meanwhile, the survey sites were labeled for the collection of roots.

2.3. qRT–PCR Validation

2.3.1. RNA Extraction and cDNA Synthesis

Total RNA samples were extracted from the mixed leaves (a total of 15 plants, three plants in each site) using an RNA kit (DP419, Tiangen, Beijing, China), and the purity was determined using a NanoDrop (Micro Drop, BIO-DL, Shanghai, China). First-strand cDNA was synthesized using a FastKing RT kit (KR116, Tiangen, Beijing, China) according to the following protocols: 42 °C for 15 min and 95 °C for 3 min for one cycle.

2.3.2. Gene-Expression Analysis

Two candidate genes, PVY-coat protein (CP) and ToMV-CP, were selected according to previous literature [13,21]. The CDS sequences were obtained from the GenBank database (MN563134.1) and previous literature (Table 2) [21]. The primer sequences were designed using a primer-blast tool in the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/), and the elongation factor 1-gamma (EEF1G) gene was used as a reference control [22] (Table 3). The PCR amplification was performed using a SuperReal PreMix (FP205, Tiangen, Beijing, China) according to the following protocols: 95 °C for 15 min for one cycle, and then 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 30 s for 40 cycles. Melting curves were analyzed after 34 s incubation at 72 °C. The relative expression level (REL) of genes was calculated using a 2−∆∆Ct method [23]. The specific formula is as follows:
CtTest gene = CtTest geneCtReference gene
CtControl gene = CtControl geneCtReference gene
∆∆Ct = −(CtTest geneCtControl gene)
REL (Test gene/Control gene) = 2∆∆Ct

2.4. Evaluation of Root Yield

From 15 to 20 October 2023, the roots were collected from the survey sites and then dried at room temperature. The root dry weight (DW) was the average value of 15 roots in the five survey sites. The root yield of VIPs and VFPs was calculated based on their average root DW.

2.5. Determination of Quality

2.5.1. Preparation of Extracts

The extracts were prepared according to previous literature [24] with slight modifications. Briefly, the air-dried roots were finely ground, and the aliquots (2.0 g) were extracted in 25 mL ethanol (95% v/v) at 22 °C and 120 r/min for 72 h, and then the homogenate was centrifuged at 4 °C and 6000 r/min for 10 min. The supernatant was increased up to 25 mL with ethanol (95% v/v) and kept at 4 °C for further determinations.

2.5.2. Determination of Ferulic Acid and Ligustilide Contents

The ferulic acid and ligustilide contents were determined according to previous literature [25,26]. Briefly, the extracts (10 μL) were determined at 323 nm using an HPLC Symmetry® C18 column (250 mm × 4.6 mm, 5 μm; column temperature 30 °C; Waters ACQUITY Arc, Milford, MA, USA). The acetic acid (1.0% v/v, A)—acetonitrile (B) was the mobile phase with gradient elution: 38–90% B (0–8 min), 90–38% B (8–12 min), and 38% B (12–14 min) at a flow rate of 1.0 mL/min. The contents were calculated based on a comparison of peak area of reference standards.

2.5.3. Determination of Polysaccharides, Total Flavonoids, and Phenolic Contents

The polysaccharide content was determined using a sulfuric acid-phenol method [27]. Briefly, the extracts (10 µL) were added to the prepared phenol reagent (9% v/v, 1 mL); after oscillation, sulfuric acid (3 mL) was added and reacted at 22 °C for 30 min. Absorbance readings were taken at 485 nm using a spectrometer (V1800, Shanghai, China). Polysaccharide content was calculated based on a standard curve and expressed as mg of sucrose (SUC). The calibration equations C (SUC μg) = 168.34 A − 5.49 (R2 = 0.995). The specific formula is as follows:
Polysaccharide content (mg/g DW) = (C × V2)/(V1 × M × 1000)
where C, V1, V2, A, and M represent polysaccharides amount, sample volume, extract volume, sample absorbance, and material DW, respectively.
The total flavonoid content was determined using an NaNO2-AlCl3-NaOH method [28]. Briefly, the extracts (800 µL) were added into ddH2O (2 mL) and NaNO2 (5% w/v, 0.3 mL); after the mixture agitating for 5 min, 10% AlCl3 (w/v, 0.3 mL) was added and reacted for 1 min, and then 1.0 mol/L NaOH (2 mL) was added to stop the reaction. Absorbance readings were taken at 510 nm using a spectrometer (V1800, Shanghai, China). Total flavonoid content was calculated based on a standard curve and expressed as mg of catechin (CE), the calibration equations C (CE μg) = 212.25 A − 6.26 (R2 = 0.995). The specific formula is as follows:
Total flavonoid content (mg/g DW) = (C × V2)/(V1 × M × 1000)
where C, V1, V2, A, and M represent total flavonoid amount, sample volume, extract volume, sample absorbance, and material DW, respectively.
The total phenolic content was determined using the Folin–Ciocalteu method [29]. Briefly, the extracts (70 µL) were added into the prepared Folin–Ciocalteu reagent (10% v/v, 2 mL) and Na2CO3 (7.5% v/v, 1 mL). Then, the mixture was agitated for 5 min and left to react at 37 °C for 1 h in the dark. Absorbance readings were taken at 760 nm using a spectrometer (V1800, Shanghai, China). Total phenolic content was calculated based on a standard curve and expressed as mg of gallic acid equivalent (GAE), the calibration equations C (GAE μg) = 35.23 A + 0.72 (R2 = 0.994). The specific formula is as follows:
Total phenolic content (mg/g DW) = (C × V2)/(V1 × M × 1000)
where C, V1, V2, A, and M represent total phenolic amount, sample volume, extract volume, sample absorbance, and material DW, respectively.

2.5.4. Determination of Antioxidant Capacity

The antioxidant capacity was determined using two widely used methods: 1, 1-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power (FRAP) [30,31].
For the determination of DPPH scavenging, the extracts (200 µL) were added to the prepared 10−4 mol/L DPPH methanol solution (3 mL). Then, the mixture was agitated for 5 min and then left to react at 37 °C for 30 min in the dark. Absorbance readings were taken at 515 nm using a spectrometer (V1800, Shanghai, China). Antioxidant capacity was calculated based on the capacity to scavenge DPPH radicals. The specific formula is as follows:
DPPH scavenging activity (%) = [(A0A)/A0] × 100
where “A0”and “A” represent the absorbance of DPPH without and with samples, respectively.
For the determination of FRAP value, the extracts (200 µL) were added to the prepared FRAP reagent (3 mL). Then, the mixture was agitated for 5 min and left to react at 37 °C for 30 min in the dark. Absorbance readings were taken at 593 nm using a spectrometer (V1800, Shanghai, China). Antioxidant capacity was calculated based on a reference FeSO4·7H2O (500 μmol Fe(II)/g). The specific formula is as follows:
FRAP value (μmol Fe(II)/g)= (∆A593 test sample/∆A593 standard sample) × 500 (μmol Fe(II)/g)
where ∆A593 represented the absorbance of the test or standard sample minus the absorbance of the blank at the 4th min.

2.6. Statistical Analysis

All the measurements were performed using three biological replicates. SPSS 22.0 software was used for using Duncan’s multiple-range test with p < 0.05 considered to be significant.

3. Results

3.1. Planting Density in Different Survey Sites

A significant difference in planting density among the 20 different survey sites was observed, with the highest value of 26.61 plants/m2 at the 4-Mazichuan town of Minxian county and the lowest value of 14.85 plants/m2 at the 1-Jinzhong town of Zhangxian county (Figure 1).

3.2. Viral Disease Rate in Different Survey Sites

The virus-free leaves of A. sinensis presented greenness and flatness (Figure 2A), while the virus-infected leaves were yellow, spotted, and twisted (Figure 2B–E). A significant difference in the viral disease rate among the 20 different survey sites was observed, with the highest value of 37.16% in the 4-Mazichuan town of Minxian county and the lowest value of 20.55% was in the 3-Huichuan town of Weiyuan County (Figure 3).

3.3. Relationship of Viral Disease Rate with Planting Density

To reveal the effect of planting density on viral disease rate, a relationship was analyzed, and there was a significant relationship between viral disease rate and planting density with R2 = 0.4766 (p < 0.01) (Figure 4).

3.4. Effect of Viral Disease on Expression Level of PVY-CP and ToMV-CP

The relative expression level of the two genes PVY-CP and ToMV-CP showed a significant alteration in the 20 different survey sites, with the PVY-CP ranging from 0.02- (5-Jinzhong, Zhangxian) to 17.64-fold (4-Mazichuan, Minxian), and the ToMV-CP ranging from 0.01-(5-Jinzhong, Zhangxian) to 0.92-fold (4-Mazichuan, Minxian) (Figure 5).

3.5. Relationship of Viral Disease Rate with Expression Level of Viral Genes

To reveal the effect of the expression level of viral genes on viral disease rate, a relationship was analyzed, and there was a significant relationship between viral disease rate and expression level of the two genes PVY-CP and ToMV-CP, with R2 = 0.4628 and 0.4376 (p < 0.01), respectively (Figure 6).

3.6. Effect of Viral Disease on Root Yield

On a per-plant basis, the root DW of VIPs was significantly lower than the VFPs, with a 3.91-, 4.10-, 3.48-, and 4.22-fold decrease in Minxian, Weiyuan, Zhangxian, and Tanchang counties, respectively (Figure 7A). On a unit-area basis, the root yield of the VIPs was also significantly lower than the VFPs, with a 8.93-, 6.97-, 2.81-, and 4.47-fold decrease in Minxian, Weiyuan, Zhangxian, and Tanchang counties, respectively (Figure 7B).

3.7. Effect of Viral Disease on Content of Ferulic Acid and Ligustilide

The representative HPLC chromatogram of ferulic acid and ligustilide in different survey regions is shown in Figure 8A. The ferulic acid content in the VIPs was significantly lower than the VFPs, with a 7.66-, 6.70-, 4.52-, and 5.14-fold decrease in Minxian, Weiyuan, Zhangxian, and Tanchang counties, respectively (Figure 8B). The ligustilide content in the VIPs was significantly lower than the VFPs, with a 1.82-, 1.78-, 1.73-, and 1.75-fold decrease in Minxian, Weiyuan, Zhangxian, and Tanchang counties, respectively (Figure 8C).

3.8. Effect of Viral Disease on Content of Polysaccharides, Total Flavonoids and Phenolic

The polysaccharide content in the VIPs was significantly lower than the VFPs, with a 10.74-, 9.60-, 11.17-, and 11.24-fold decrease in Minxian, Weiyuan, Zhangxian, and Tanchang counties, respectively (Figure 9A). The total flavonoid and phenolic contents were significantly greater than the VFPs, with a 1.10- and 1.15-, 1.33-, and 1.14-fold, and 1.28-, 1.42-, 1.19-, and 1.20-fold increase in Minxian, Weiyuan, Zhangxian, and Tanchang counties, respectively (Figure 9B,C).

3.9. Effect of Viral Disease on Antioxidant Capacity

The antioxidant capacity in the extracts of the VIPs was significantly greater than the VFPs, with a 1.21- and 1.22-, 1.39-, and 1.20-fold increase of DPPH scavenging activity, and 1.28-, 1.28-, 1.26-, and 1.23-fold increase of FRAP value in Minxian, Weiyuan, Zhangxian, and Tanchang counties, respectively (Figure 10A,B).

4. Discussion

In recent years, the cultivation area of medicinal plants in China has been prompted by increasing market demand, while viral diseases seriously affect the yield and quality of species including the Lilium, Panax notoginsen, and Chrysanthemum morifolium [14,18,32,33]. The viral diseases of PVY and ToMV have been found in A. sinensis plants in recent years [13,14], while the viral disease rate in the field and their influences on yield and quality have not been investigated. In this study, we found that there was ca. 30% viral disease rate, over a 2.8-fold reduction of yield, and a significant decrease of main bioactive contents (i.e., ferulic acid, ligustilide, and polysaccharides) in A. sinensis in field cultivation.
Previous studies have demonstrated that there is a significant relationship between plant diseases with planting density, with a higher planting density enhancing the disease spread [34]. For example, a higher plant density (75 cm × 75 cm) causes the highest incidence (28.4%) of viral disease in Vigna unguiculata [35]; a higher planting density causes the increase of cotton leaf-curl virus (CLCuV) and decreases the number of bolls and boll weight in Gossypium hirsutum [36]; and a higher plant population caused the number of infected virus plant in Beta vulgaris [37]. In this study, the average planting density was ca. 20 plants/m2 in the 20 different survey sites, which was 2.0-fold higher than that of standard cultivation in the field (ca. 10 plants/m2) [2,12]. The investigations indicate that planting density plays a critical role in causing the occurrence of viral disease of A. sinensis.
Previous studies have proven that the occurrence of plant viral diseases mainly depends on the expression level of viral genes. For example, there was a significant decrease in viral disease rate when the viral genes were inhibited using RNA silencing [38]; there was a significant positive relationship between viral disease rate and the expression level of ringspot virus (RSV), TMV, and turnip crinkle virus (TCV) genes in tobacco as well as the PVX and TMV genes in tomato [39]; and there was a significant increase of plant death rate with a higher expression level of curly shoot virus (CSV) gene in tobacco [40]. In this study, we found that there was a positive relationship between viral disease rate and with expression level of the two genes PVY-CP and ToMV-CP in A. sinensis.
Extensive experiments have found that the yield and quality of medicinal plants were significantly decreased by the viral diseases, while the content of flavonoids and phenolic were improved [41,42,43,44,45]. For example, a 15–35% decrease in yield was observed in Radix pseudostellariae infected by the TMV and CMV [41]; a 10–30% decrease in yield was observed in Chrysanthemum morifolium infected by the chrysanthemum virus B (CVB), tomato aspermy virus (TAV), and TMV [42]; and over 60% decrease of yield and 30–50% decrease of bioactive compounds (e.g., catalpol, rehmannioside, and ajugol) were observed in Rehmannia glutinosa infected by the TMV, ReMV, and ToMV [43]. Additionally, a significant increase of flavonoids and phenolic contents was observed in the Solanum lycopersicum leaves infected by the ToMV [44], and a 1.3- and 1.1-fold increase of flavonoids and phenolic contents in the Nicotiana tobacum roots infected by the potato virus Y vein necrosis (PVYN) [45]. In this study, there was a significant decrease in root yield and quality and an increase in flavonoids and phenolic contents in A. sinensis roots. These findings confirm that the viral diseases significantly reduced the yield and quality of A. sinensis.
Previous studies have also found that the occurrence of plant diseases is also affected by the previous crops [46,47]. For example, there was a higher disease index of fusarium crown rot (FCR) in wheat with the previous wheat and maize crops [48]; a higher disease rate (91.4%) of lily symptomless virus (LSV) was observed with previous crop Lilium brownii, while a lower disease rate (13.4%) with previous crop Triticum aestivum [49]; a higher disease rate (51.3%) of pepper virus diseases (e.g., CMV, TMV, and PVY) was observed with previous crop Capsicum annuum, while a lower disease rate (8.4%) with previous crop Oryza sativa [50]. In this study, there was a higher occurrence of PVY or ToMV in A. sinensis with the previous crop Solanum tuberosum. Several experiences have found that several previous crops (e.g., Hordeum vulgare, Glycine max, and Brassica napus) are suitable for the crop rotation of A. sinensis [51].
To inhibit the occurrence of viral diseases, several strategies have been applied in medicinal plants, such as creating disease-resistant varieties using the CRISPR-Cas9 system, obtaining virus-free plants using the virus-free tissue culture technique, and optimizing field management [14,52,53,54]. These strategies will provide useful references for inhibiting the occurrences of viral diseases of A. sinensis.

5. Conclusions

From the above survey and investigations, the PVY and ToMV viral diseases have been confirmed to infect the medicinal plant A. sinensis in the mainly cultivated areas in Gansu province, China, and has already started to decrease the root yield and quality, which may largely result from a higher planting density and an unreasonable rotation of previous crops. Thus, it is necessary and urgent to control the planting density, select a reasonable rotation, and apply the virus-free variety to improve the root yield and quality of A. sinensis.

Author Contributions

J.L.: conceptualization, data curation, methodology, investigation, project administration, and writing—review and editing; T.L.: data curation, methodology, investigation, writing—original draft preparation. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of Gansu Province (21JR7RA731).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zhang, H.Y.; Bi, W.G.; Yu, Y.; Liao, W.B. Angelica sinensis (Oliv.) Diels in China: Distribution, cultivation, utilization and variation. Genet. Resour. Crop Environ. 2012, 59, 607–613. [Google Scholar] [CrossRef]
  2. Huang, L.Q.; Jin, L. Suitable Technology for Production and Processing of Angelica sinensis; China Pharmaceutical Science and Technology Press: Beijing, China, 2018; pp. 1–14. [Google Scholar]
  3. Chinese Pharmacopoeia Commission. Pharmacopoeia of the People’s Republic of China; China Medical Science and Technology Press: Beijing, China, 2020; p. 139.
  4. Upton, R. American Herbal Pharmacopoeia and Therapeutic Compendium: Dang Gui Root-Angelica sinensis (Oliv.); American Herbal Pharmacopoeia and Therapeutic Compendium: Scotts Valley, CA, USA, 2003; pp. 1–41. [Google Scholar]
  5. Wei, W.L.; Zeng, R.; Gu, C.M.; Qu, Y.; Huang, L.F. Angelica sinensis in China-a review of botanical profile, ethnopharmacology, phytochemistry and chemical analysis. J. Ethnopharm. 2016, 190, 116–141. [Google Scholar] [CrossRef] [PubMed]
  6. Ma, J.P.; Guo, Z.B.; Jin, L.; Li, Y.D. Phytochemical progress made in investigations of Angelica sinensis (Oliv.) Diels. Chin. J. Nat. Med. 2015, 13, 241–249. [Google Scholar] [CrossRef]
  7. Li, M.F.; Kang, T.L.; Jin, L.; Wei, J.H. Research progress on bolting and flowering of Angelica sinensis and regulation pathways. Chin. Trad. Herb. Drugs 2020, 51, 5894–5899. [Google Scholar]
  8. Luo, M.M.; Liu, X.X.; Su, H.Y.; Li, M.L.; Li, M.F.; Wei, J.H. Regulatory networks of flowering genes in Angelica sinensis during vernalization. Plants 2022, 11, 1355. [Google Scholar] [CrossRef] [PubMed]
  9. Liu, X.X.; Luo, M.M.; Li, M.F.; Wei, J.H. Depicting precise temperature and duration of vernalization and inhibiting early bolting and flowering of Angelica sinensis by freezing storage. Front. Plant Sci. 2022, 13, 853444. [Google Scholar] [CrossRef]
  10. Zhang, X.H.; Lang, D.Y.; Zhang, E.H.; Wang, Z.S. Effect of autotoxicity and soil microbes in continuous cropping soil on Angelica sinensis seedling growth and rhizosphere soil microbial population. Chin. Herb. Med. 2015, 7, 88–93. [Google Scholar]
  11. Li, M.L.; Li, J.; Cao, X.L.; Wang, Q.L.; Li, M.F.; Wei, J.H. Analytic research on current situation of early bolting rate and component factors of economic benefits of Gansu province genuine medicinal herbs Angelica sinensis. Grassl. Turf. 2022, 42, 152–158. [Google Scholar]
  12. Li, Y.D. Research on Angelica sinensis (Oliv.) Diels; Science Press: Beijing, China, 2021; pp. 36–45. [Google Scholar]
  13. Liu, W.; Yan, L.Y.; Wen, Z.H.; Chen, X.R. Survey of virus diseases on 18 species of medical herbs in Gansu province and identification of two virus disease. Plant Prot. 2014, 5, 133–137. [Google Scholar]
  14. Liu, Z.; Peng, Q.P.; Xiang, Y.Y.; Li, L.M. Damage and control of viral diseases on common medicinal plants in China. Plant Prot. 2018, 44, 9–19. [Google Scholar]
  15. Yang, L.; Zhang, Z.C.; Zhang, R.Y. Molecule detection of Rehmannia mosaic virus. J. Henan Agric. Sci. 2009, 4, 77–78. [Google Scholar]
  16. Matsumoto, M.; Shoyama, Y.; Nishioka, I.; Iwai, H.; Wakimoto, S. Identification of viruses infected in Rehmannia glutinosa Libosch. var purpurea Makino and effect of virus infection on root yield and iridoid glycoside contents. Plant Cell Rep. 1989, 7, 636–638. [Google Scholar] [CrossRef] [PubMed]
  17. Wang, T.L.; Qin, L.; Du, Y.X.; Sun, K.; Wang, S.; He, Z. Virus diseases in Chrysanthemum morifolium: A review. Mod. Chin. Med. 2021, 23, 1655–1663. [Google Scholar]
  18. Liu, H.H.; Shen, X.G.; Mao, B.Z. Chrysanthemum virus disease and its prevention countermeasures. Pharm. Biotechnol. 2015, 22, 91–94. [Google Scholar]
  19. Wang, M.X.; Chen, Q.H.; Xu, J.W.; Huang, B.S.; Du, C.; Liu, D.H.; Miao, Y.H. Identification of the pathogens of Pinellia ternata virus disease in Hubei province based on small RNA deep sequencing. J. Chin. Med. Mat. 2022, 45, 2535–2540. [Google Scholar] [CrossRef] [PubMed]
  20. Xie, H.E.; Xie, X.H.; Li, J.H.; Chen, L.; Wu, Z.X.; Hao, J.P. Virus damage to Pinellia ternata and its rapid-proliferation technique for virus-free seedlings. Chin. Trad. Herb. Drugs 2005, 36, 1697–1700. [Google Scholar]
  21. Zhang, Y.; Wang, R.; Wang, J.; Chang, J.; Zhang, X.; Chen, T.; An, L.; Xu, S. A new potyvirus first isolated and identified from Angelica sinensis. Virus Genes 2009, 39, 120–125. [Google Scholar] [CrossRef]
  22. Peng, D.Q.; Luo, M.M.; Guo, X.W.; Li, M.F.; Wei, J.H. Selection of reference genes for quantitative real-time PCR analysis in Angelica sinensis. Chin. Trad. Herb. Drugs. 2024, 55, 269–278. [Google Scholar]
  23. Willems, E.; Leyns, L.; Vandesompele, J. Standardization of real-time PCR gene expression data from independent biological replicates. Anal. Biochem. 2008, 379, 127–129. [Google Scholar] [CrossRef] [PubMed]
  24. Huang, T.M.; Liu, D.; Cui, X.W.; Li, M.L.; Jin, L.; Paré, P.W.; Li, M.F.; Wei, J.H. In vitro bioactive metabolite production and plant regeneration of medicinal plant Angelica sinensis. Ind. Crops Prod. 2023, 194, 116276. [Google Scholar] [CrossRef]
  25. Deng, X.Q.; Guan, X.J.; Huang, N.N.; Li, J. Simultaneous determination of eight constituents in Angelica sinensis by HPLC. Chin. Tradit. Patent Med. 2020, 42, 2075–2079. [Google Scholar]
  26. Dong, H.; Li, M.L.; Jin, L.; Xie, X.R.; Li, M.F.; Wei, J.H. Cool temperature enhances growth, ferulic acid and flavonoid biosynthesis while inhibiting polysaccharide biosynthesis in Angelica sinensis. Molecules 2022, 27, 320. [Google Scholar] [CrossRef]
  27. Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
  28. Lv, M.; Su, H.Y.; Li, M.L.; Yang, D.L.; Yao, R.Y.; Li, M.F.; Wei, J.H. Effect of UV-B radiation on growth, flavonoid and podophyllotoxin accumulation, and related gene expression in Sinopodophyllum hexandrum. Plant Biol. 2021, 23, 202–209. [Google Scholar] [CrossRef] [PubMed]
  29. Li, M.F.; Li, T.; Li, W.; Yang, D.L. Changes in antioxidant capacity, levels of soluble sugar, total polyphenol, organosulfur compound and constituents in garlic clove during storage. Ind. Crops Prod. 2015, 69, 137–142. [Google Scholar]
  30. Arnao, M.B. Some methodological problems in the determination of antioxidant activity using chromogen radicals: A practical case. Trends Food Sci. Technol. 2000, 11, 419–421. [Google Scholar] [CrossRef]
  31. Nencini, C.; Menchiari, A.; Franchi, G.G.; Micheli, L. In vitro antioxidant activity of aged extracts of some Italian Allium species. Plant Food. Hum. Nutr. 2011, 66, 11–16. [Google Scholar] [CrossRef]
  32. Wang, L.C.; Kong, B.H.; Zhao, D.; Chen, H.R.; Li, F. Occurance and detection of viruses infecting Yuannan edible Lily. J. Yunnan Agric. Univ. 2009, 24, 518–521. [Google Scholar]
  33. Ma, N.; Wang, Y.; Liu, Y.Z.; Sun, Y.Q.; Chen, Y.J. Effects of Notoginseng virus disease on yield and quality. Mod. Agric. Sci. Technol. 2015, 14, 110–113. [Google Scholar]
  34. Krupinsky, J.M.; Bailey, K.L.; McMullen, M.P.; Gossen, B.D.; Turkington, T.K. Managing plant disease risk in diversified cropping systems. Agron. J. 2002, 94, 198–209. [Google Scholar] [CrossRef]
  35. Aliyu, T.H.; Balogun, O.S. Effects of variety and planting density on the incidence of common viral diseases of Cowpea (Vigna unguiculatd) in a southern guinea savannah agro-ecology. Asian J. Plant Pathol. 2011, 5, 126–133. [Google Scholar]
  36. Iqbal, M.; Khan, M.A.; Ul-Allah, S. High density cotton population in late sowing improves productivity and tolerance to cotton leaf curl virus under semi-arid subtropical conditions. J. Plant Dis. Prot. 2021, 128, 685–692. [Google Scholar] [CrossRef]
  37. Heathcote, G.D. Effect of Plant spacing and time of sowing of sugar beet on aphid infestation and spread of virus yellows. Plant Pathol. 1970, 19, 32–39. [Google Scholar] [CrossRef]
  38. Kaldis, A.; Berbati, M.; Melita, O.; Reppa, C.; Holeva, M.; Otten, P.; Voloudakis, A. Exogenously applied dsRNA molecules deriving from the Zucchini yellow mosaic virus (ZYMV) genome move systemically and protect cucurbits against ZYMV. Mol. Plant Pathol. 2018, 19, 883–895. [Google Scholar] [CrossRef] [PubMed]
  39. Pesti, R.; Kontra, L.; Paul, K.; Vass, I.; Csorba, T.; Havelda, Z.; Várallyay, É. Differential gene expression and physiological changes during acute or persistent plant virus interactions may contribute to viral symptom differences. PLoS ONE 2019, 14, e0216618. [Google Scholar] [CrossRef] [PubMed]
  40. Sun, M.; Jiang, K.R.; Li, C.J.; Du, J.; Li, M.J.; Ghanem, H.; Wu, G.T.; Qing, L. Tobacco curly shoot virus C3 protein enhances viral replication and gene expression in Nicotiana benthamiana plants. Virus Res. 2020, 281, 197939. [Google Scholar] [CrossRef]
  41. Xie, R.J.; Dong, Y.Z. Occurrence and prevention of virus disease in Radix pseudostellariae in Weng ‘an County. Plant Health Med. 2012, 3, 27. [Google Scholar]
  42. Zhao, X.T.; Liu, X.L.; Ge, B.B.; Li, M.J.; Hong, B. A multiplex RT-PCR for simultaneous detection and identification of five viruses and two viroids infecting Chrysanthemum. Arch. Virol. 2015, 160, 1145–1152. [Google Scholar] [CrossRef]
  43. Zhang, Z.C.; Zhang, L.F.; Qiao, Q.; Wang, Y.J.; Jin, X.L. Identification of viral pathogens of Rehmannia glutinosa disease in Henan Province. Acta Phytopathol. Sin. 2004, 34, 395–399. [Google Scholar]
  44. López-Gresa, M.P.; Lisón, P.; Kim, H.Y.; Choi, Y.H.; Verpoorte, R.; Rodrigo, I.; Conejero, V.; Bellés, J.M. Metabolic fingerprinting of Tomato Mosaic Virus infected Solanum lycopersicum. J. Plant Physiol. 2012, 169, 1586–1596. [Google Scholar] [CrossRef] [PubMed]
  45. Wu, Y.H.; Zhong, L.J.; Zhao, X.X. Relationship among total phenol flavonoid and PPO activity with the necrosis of tobacco infected by PVYN. Acta Phytopathol. Sin. 2007, 37, 398–402. [Google Scholar]
  46. Thresh, J.M. Cropping practices and virus spread. Annu. Rev. Phytopathol. 1982, 20, 193–216. [Google Scholar] [CrossRef]
  47. Holt, J.; Chancellor, T.C.B. A model of plant virus disease epidemics in asynchronously-planted cropping systems. Plant Pathol. 1997, 46, 490–501. [Google Scholar] [CrossRef]
  48. Wang, Y.W.; Zhou, J.H.; Luo, N.; Wang, G.Y. Control effect of BR and agronomic measures on TY virus disease and stem base rot of autumn tomato in plastic house. China Cucurbits Veg. 2021, 34, 60–64. [Google Scholar]
  49. Xu, B.L.; Liang, Q.L.; Xu, Q. Occurrence and the types of symptoms of lily virus diseases. Plant Prot. 2004, 30, 62–65. [Google Scholar]
  50. Lin, C.Y.; Luo, M.Y.; Lin, J.; Huang, Y.P.; Zhang, F.Z. Study on occurrence law and control technology of pepper virus disease. Hubei Agric. Sci. 2009, 48, 2142–2144, 2183. [Google Scholar]
  51. Zhang, Z.; Liu, X.Z.; Bao, Y.J.; Li, J.; Cao, X.L.; Li, M.F. Selection of cropping rotations of Angelica sinensis based on biomass, bioactive compounds accumulation and antioxidant capacity. J. Gansu Agric. Univ. 2018, 53, 82–89. [Google Scholar]
  52. Yan, J.M.; Ye, H.Z.; Qin, Y.; Wu, G.T. Investigation on the disease of medical plants in Sichuan province and pathogen identification II A list of medicinal plant diseases. Southwest China J. Agric. Sci. 2008, 21, 359–363. [Google Scholar]
  53. Feng, X.H.; Li, J.; Luo, X.G. Research advances on virus elimination in Lily. J. Agric. 2015, 5, 91–95. [Google Scholar]
  54. Yao, Y.S. Comprehensive control technology for Radix pseudostellariae virus disease. Fujian Agric. Sci. Technol. 2014, 45, 41–42. [Google Scholar]
Figure 1. Planting density of Angelica sinensis at the 20 different survey sites located in four different counties. Different lowercase letters indicate a significant difference at p < 0.05 level among different survey sites.
Figure 1. Planting density of Angelica sinensis at the 20 different survey sites located in four different counties. Different lowercase letters indicate a significant difference at p < 0.05 level among different survey sites.
Horticulturae 10 01300 g001
Figure 2. Leaf characteristics of A. sinensis infected with viruses. Image (A) represents the virus-free leaves, and images (BE) represent the virus-infected leaves.
Figure 2. Leaf characteristics of A. sinensis infected with viruses. Image (A) represents the virus-free leaves, and images (BE) represent the virus-infected leaves.
Horticulturae 10 01300 g002
Figure 3. Viral disease rate of A. sinensis in the 20 different survey sites located at four different counties. Different lowercase letters indicate a significant difference at p < 0.05 level among different survey sites.
Figure 3. Viral disease rate of A. sinensis in the 20 different survey sites located at four different counties. Different lowercase letters indicate a significant difference at p < 0.05 level among different survey sites.
Horticulturae 10 01300 g003
Figure 4. Relationship of viral disease rate (DR) with planting density (PD) in the 20 different survey sites. ** indicates a significant relationship at p < 0.01 level.
Figure 4. Relationship of viral disease rate (DR) with planting density (PD) in the 20 different survey sites. ** indicates a significant relationship at p < 0.01 level.
Horticulturae 10 01300 g004
Figure 5. Relative expression level of two viral genes (PVY-CP and ToMV-CP) in the 20 different survey sites. The red dotted line in the image differentiates up-regulation (>1) and down-regulation (<1) at different survey sites, respectively.
Figure 5. Relative expression level of two viral genes (PVY-CP and ToMV-CP) in the 20 different survey sites. The red dotted line in the image differentiates up-regulation (>1) and down-regulation (<1) at different survey sites, respectively.
Horticulturae 10 01300 g005
Figure 6. Relationship of viral disease rate (VDR) with the expression level of two genes PVY-CP (A) and ToMV-CP (B) in the 20 different survey sites. ** indicates a significant relationship at p < 0.01 level.
Figure 6. Relationship of viral disease rate (VDR) with the expression level of two genes PVY-CP (A) and ToMV-CP (B) in the 20 different survey sites. ** indicates a significant relationship at p < 0.01 level.
Horticulturae 10 01300 g006
Figure 7. Root DW and yield of virus-infected plants (VIPs) and virus-free plants (VFPs) in four different counties. Images (A,B) represent the root DW and yield on a per-plant and unit-area basis, respectively. “*” indicates a significant difference at p < 0.05 level between the VIPs and VFPs in the same survey region.
Figure 7. Root DW and yield of virus-infected plants (VIPs) and virus-free plants (VFPs) in four different counties. Images (A,B) represent the root DW and yield on a per-plant and unit-area basis, respectively. “*” indicates a significant difference at p < 0.05 level between the VIPs and VFPs in the same survey region.
Horticulturae 10 01300 g007
Figure 8. Content of ferulic acid (B) and ligustilide (C) in virus-infected plants (VIPs) and virus-free plants (VFPs) at four different counties. Image (A) presents the representative HPLC chromatogram. “*”indicates a significant difference at p < 0.05 level between the VIPs and VFPs in the same survey region.
Figure 8. Content of ferulic acid (B) and ligustilide (C) in virus-infected plants (VIPs) and virus-free plants (VFPs) at four different counties. Image (A) presents the representative HPLC chromatogram. “*”indicates a significant difference at p < 0.05 level between the VIPs and VFPs in the same survey region.
Horticulturae 10 01300 g008
Figure 9. Content of polysaccharides (A), total flavonoids (B), and phenolic (C) in virus-infected plants (VIPs) and virus-free plants (VFPs) at four different counties. * indicates a significant difference at p < 0.05 level between the VIP and VFP in the same survey region.
Figure 9. Content of polysaccharides (A), total flavonoids (B), and phenolic (C) in virus-infected plants (VIPs) and virus-free plants (VFPs) at four different counties. * indicates a significant difference at p < 0.05 level between the VIP and VFP in the same survey region.
Horticulturae 10 01300 g009
Figure 10. DPPH scavenging activity (A) and FRAP value (B) in virus-infected plants (VIPs) and virus-free plants (VFPs) in four different counties. * indicates a significant difference at p < 0.05 level between the VIPs and VFPs in the same survey region.
Figure 10. DPPH scavenging activity (A) and FRAP value (B) in virus-infected plants (VIPs) and virus-free plants (VFPs) in four different counties. * indicates a significant difference at p < 0.05 level between the VIPs and VFPs in the same survey region.
Horticulturae 10 01300 g010
Table 1. Survey sites of Angelica sinensis cultivated in four different counties in Gansu province of China.
Table 1. Survey sites of Angelica sinensis cultivated in four different counties in Gansu province of China.
CountiesTownsLocationsPrevious Crops
Minxian1-Lujing104°28′56.64″, 34°18′43.92″; 2611 mAstragalus membranaceus
2-Sigou104°5′12.48″, 4°22′16.68″; 2494 mVicia faba
3-Mazichuan104°3′28.08″, 34°17′0.96″; 2564 mZea mays
4-Mazichuan104°3′22.32″, 34°10′8.04″; 2551 mAstragalus membranaceus
5-Mazichuan104°3′54″, 34°17′33.36″; 2550 mCodonopsis pilosula
Weiyuan1-Huichuan103°59′29.76″, 35°1′48.72″; 2458 mZea mays
2-Huichuan104°2′11.4″, 35°13′37.56″; 2437 mSolanum tuberosum
3-Huichuan104°7′9.12″, 35°4′39.72″; 2458 mSolanum tuberosum
4-Wuzhu104°3′47.16″, 35°26′7.44″; 2552 mSolanum tuberosum
5-Qijiamiao103°59′18.24″, 35°4′33.24″; 2392 mAngelica sinensis
Zhangxian1-Jinzhong104°0.46998′0″, 34°51′14.04″; 2975 mGlycine max
2-Jinzhong104°3′7.2″, 34°50′32.64″; 2867 mVicia faba
3-Jinzhong104°6′16.2″, 34°49′43.68″; 2711 mAstragalus membranaceus
4-Jinzhong104°7′56.28″, 34°49′24.24″; 2842 mCodonopsis pilosula
5-Jinzhong104°2′32.28″, 34°51′46.44″; 2932 mGlycine max
Tanchang1-Awu104°9′52.92″, 34°17′29.4″; 2386 mAvena sativa
2-Awu104°10′49.8″, 34°20′6.72″; 2529 mBrassica campestris
3-Lichuan104°11′25.8″, 34°10′30.72″; 2483 mCodonopsis pilosula
4-Pangjia104°15′30.6″, 34°19′42.24″; 2461 mBrassica campestris
5-Pangjia104°9′28.08″, 34°11′38.76″; 2478 mFallow land
Table 2. CDS sequences of the two viral genes PVY-CP and ToMV-CP.
Table 2. CDS sequences of the two viral genes PVY-CP and ToMV-CP.
GenesCDS Sequences
PVY-CP1 ggaaatgaca caatcgatgc aggaggaagc actaagaagg atgcaaaaca agagcaaggt
61 agcattcaac caaatctcaa caaggaaaag gaaaaggacg tgaatgttgg aacatctgga
121 actcatactg tgccacgaat taaagctatc acgtccaaaa tgagaatgcc caagagtaaa
181 ggtgcaactg tactaaattt ggaacactta ctcgagtatg ctccacagca aattgacatc
241 tcaaatactc gagcaactca atcacagttt gatacgtggt atgaagcggt acaacttgca
301 tacgacatag gagaaactga aatgccaact gtgatgaatg ggcttatggt ttggtgcatt
361 gaaaatggaa cctcgccaaa catcaacgga gtttgggtta tgatggatgg agatgaacaa
421 gtcgaatacc cactgaaacc aatcgttgag aatgcaaaac caccacttag gcaaatcatg
481 gcacttttct cagatgttgc agaagtgtat atagaaatgc ttatcaaaaa ggaaccatat
541 atgccacgat atggtttagt tcgtaatctg cgcgatggaa gtttggctcg ctatgctttt
601 gacttttatg aggtcacatc acgaacacca gtgagggcta gggaagcgca cattcaaatg
661 aaggccgcag cattgaaatc agcccaacct cgacttttcg ggttggacgg tggcatcagt
721 acacaagagg agaacacaga gaggcacacc accgaggatg tctctccaag tatgcatact
781 ctacttggag tcaagaacat g
ToMV-CP1 tactcaatca cttctccatc gcaatttgtg tttttgtcat ctgtatgggc tgaccctata
61 gaattgttaa acgtttgtac aaattcgtta ggtagccagt ttcaaacaca gcaagcaaga
121 actactgttc aacagcagtt cagcgaggtg tggaaacctt tccctcagag caccgtcaga
181 tttcctggtg atgtttataa ggtgtacagg tacaatgcag ttttagatcc tctaattact
241 gcgttgctgg ggactttcga tactaggaat agaataatcg aagtaaaaaa ccagcagat
301 ccgacaacag ctgaaacgtt agatgctacc cgcagggtag acgacgctac ggttgcaatt
361 cggtctgcta taaataattt agttaatgaa ctagtaagag gtactggact gtacaatcag
421 aatacttttg aaagtatgtct gggttggtct ggacctctgc acctgcatc
Table 3. Primer sequences used for qRT–PCR analysis.
Table 3. Primer sequences used for qRT–PCR analysis.
GenesPrimer Sequences (5′ to 3′)Amplicon Size (bp)
EEF1GForward: GTCCCAGCAGCCAAAAAGTC101
Reverse: TCTGCCTTGGGCAATTCCTT
PVY-CPForward: TGTGGCAGGCTTACCAGTTG132
Reverse: AGTAAGTCACTGGCTGGCAA
ToMV-CPForward: CTTTCCCTCAGAGCACCGTC149
Reverse: TGTCGGACTCTGCTGGTTTT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Li, T. Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis. Horticulturae 2024, 10, 1300. https://doi.org/10.3390/horticulturae10121300

AMA Style

Li J, Li T. Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis. Horticulturae. 2024; 10(12):1300. https://doi.org/10.3390/horticulturae10121300

Chicago/Turabian Style

Li, Jinjuan, and Ting Li. 2024. "Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis" Horticulturae 10, no. 12: 1300. https://doi.org/10.3390/horticulturae10121300

APA Style

Li, J., & Li, T. (2024). Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis. Horticulturae, 10(12), 1300. https://doi.org/10.3390/horticulturae10121300

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop