Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis
Abstract
1. Introduction
2. Materials and Methods
2.1. Survey Sites
2.2. Survey of Planting Density and Viral Disease
2.3. qRT–PCR Validation
2.3.1. RNA Extraction and cDNA Synthesis
2.3.2. Gene-Expression Analysis
2.4. Evaluation of Root Yield
2.5. Determination of Quality
2.5.1. Preparation of Extracts
2.5.2. Determination of Ferulic Acid and Ligustilide Contents
2.5.3. Determination of Polysaccharides, Total Flavonoids, and Phenolic Contents
2.5.4. Determination of Antioxidant Capacity
2.6. Statistical Analysis
3. Results
3.1. Planting Density in Different Survey Sites
3.2. Viral Disease Rate in Different Survey Sites
3.3. Relationship of Viral Disease Rate with Planting Density
3.4. Effect of Viral Disease on Expression Level of PVY-CP and ToMV-CP
3.5. Relationship of Viral Disease Rate with Expression Level of Viral Genes
3.6. Effect of Viral Disease on Root Yield
3.7. Effect of Viral Disease on Content of Ferulic Acid and Ligustilide
3.8. Effect of Viral Disease on Content of Polysaccharides, Total Flavonoids and Phenolic
3.9. Effect of Viral Disease on Antioxidant Capacity
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Zhang, H.Y.; Bi, W.G.; Yu, Y.; Liao, W.B. Angelica sinensis (Oliv.) Diels in China: Distribution, cultivation, utilization and variation. Genet. Resour. Crop Environ. 2012, 59, 607–613. [Google Scholar] [CrossRef]
- Huang, L.Q.; Jin, L. Suitable Technology for Production and Processing of Angelica sinensis; China Pharmaceutical Science and Technology Press: Beijing, China, 2018; pp. 1–14. [Google Scholar]
- Chinese Pharmacopoeia Commission. Pharmacopoeia of the People’s Republic of China; China Medical Science and Technology Press: Beijing, China, 2020; p. 139.
- Upton, R. American Herbal Pharmacopoeia and Therapeutic Compendium: Dang Gui Root-Angelica sinensis (Oliv.); American Herbal Pharmacopoeia and Therapeutic Compendium: Scotts Valley, CA, USA, 2003; pp. 1–41. [Google Scholar]
- Wei, W.L.; Zeng, R.; Gu, C.M.; Qu, Y.; Huang, L.F. Angelica sinensis in China-a review of botanical profile, ethnopharmacology, phytochemistry and chemical analysis. J. Ethnopharm. 2016, 190, 116–141. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.P.; Guo, Z.B.; Jin, L.; Li, Y.D. Phytochemical progress made in investigations of Angelica sinensis (Oliv.) Diels. Chin. J. Nat. Med. 2015, 13, 241–249. [Google Scholar] [CrossRef]
- Li, M.F.; Kang, T.L.; Jin, L.; Wei, J.H. Research progress on bolting and flowering of Angelica sinensis and regulation pathways. Chin. Trad. Herb. Drugs 2020, 51, 5894–5899. [Google Scholar]
- Luo, M.M.; Liu, X.X.; Su, H.Y.; Li, M.L.; Li, M.F.; Wei, J.H. Regulatory networks of flowering genes in Angelica sinensis during vernalization. Plants 2022, 11, 1355. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.X.; Luo, M.M.; Li, M.F.; Wei, J.H. Depicting precise temperature and duration of vernalization and inhibiting early bolting and flowering of Angelica sinensis by freezing storage. Front. Plant Sci. 2022, 13, 853444. [Google Scholar] [CrossRef]
- Zhang, X.H.; Lang, D.Y.; Zhang, E.H.; Wang, Z.S. Effect of autotoxicity and soil microbes in continuous cropping soil on Angelica sinensis seedling growth and rhizosphere soil microbial population. Chin. Herb. Med. 2015, 7, 88–93. [Google Scholar]
- Li, M.L.; Li, J.; Cao, X.L.; Wang, Q.L.; Li, M.F.; Wei, J.H. Analytic research on current situation of early bolting rate and component factors of economic benefits of Gansu province genuine medicinal herbs Angelica sinensis. Grassl. Turf. 2022, 42, 152–158. [Google Scholar]
- Li, Y.D. Research on Angelica sinensis (Oliv.) Diels; Science Press: Beijing, China, 2021; pp. 36–45. [Google Scholar]
- Liu, W.; Yan, L.Y.; Wen, Z.H.; Chen, X.R. Survey of virus diseases on 18 species of medical herbs in Gansu province and identification of two virus disease. Plant Prot. 2014, 5, 133–137. [Google Scholar]
- Liu, Z.; Peng, Q.P.; Xiang, Y.Y.; Li, L.M. Damage and control of viral diseases on common medicinal plants in China. Plant Prot. 2018, 44, 9–19. [Google Scholar]
- Yang, L.; Zhang, Z.C.; Zhang, R.Y. Molecule detection of Rehmannia mosaic virus. J. Henan Agric. Sci. 2009, 4, 77–78. [Google Scholar]
- Matsumoto, M.; Shoyama, Y.; Nishioka, I.; Iwai, H.; Wakimoto, S. Identification of viruses infected in Rehmannia glutinosa Libosch. var purpurea Makino and effect of virus infection on root yield and iridoid glycoside contents. Plant Cell Rep. 1989, 7, 636–638. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.L.; Qin, L.; Du, Y.X.; Sun, K.; Wang, S.; He, Z. Virus diseases in Chrysanthemum morifolium: A review. Mod. Chin. Med. 2021, 23, 1655–1663. [Google Scholar]
- Liu, H.H.; Shen, X.G.; Mao, B.Z. Chrysanthemum virus disease and its prevention countermeasures. Pharm. Biotechnol. 2015, 22, 91–94. [Google Scholar]
- Wang, M.X.; Chen, Q.H.; Xu, J.W.; Huang, B.S.; Du, C.; Liu, D.H.; Miao, Y.H. Identification of the pathogens of Pinellia ternata virus disease in Hubei province based on small RNA deep sequencing. J. Chin. Med. Mat. 2022, 45, 2535–2540. [Google Scholar] [CrossRef] [PubMed]
- Xie, H.E.; Xie, X.H.; Li, J.H.; Chen, L.; Wu, Z.X.; Hao, J.P. Virus damage to Pinellia ternata and its rapid-proliferation technique for virus-free seedlings. Chin. Trad. Herb. Drugs 2005, 36, 1697–1700. [Google Scholar]
- Zhang, Y.; Wang, R.; Wang, J.; Chang, J.; Zhang, X.; Chen, T.; An, L.; Xu, S. A new potyvirus first isolated and identified from Angelica sinensis. Virus Genes 2009, 39, 120–125. [Google Scholar] [CrossRef]
- Peng, D.Q.; Luo, M.M.; Guo, X.W.; Li, M.F.; Wei, J.H. Selection of reference genes for quantitative real-time PCR analysis in Angelica sinensis. Chin. Trad. Herb. Drugs. 2024, 55, 269–278. [Google Scholar]
- Willems, E.; Leyns, L.; Vandesompele, J. Standardization of real-time PCR gene expression data from independent biological replicates. Anal. Biochem. 2008, 379, 127–129. [Google Scholar] [CrossRef] [PubMed]
- Huang, T.M.; Liu, D.; Cui, X.W.; Li, M.L.; Jin, L.; Paré, P.W.; Li, M.F.; Wei, J.H. In vitro bioactive metabolite production and plant regeneration of medicinal plant Angelica sinensis. Ind. Crops Prod. 2023, 194, 116276. [Google Scholar] [CrossRef]
- Deng, X.Q.; Guan, X.J.; Huang, N.N.; Li, J. Simultaneous determination of eight constituents in Angelica sinensis by HPLC. Chin. Tradit. Patent Med. 2020, 42, 2075–2079. [Google Scholar]
- Dong, H.; Li, M.L.; Jin, L.; Xie, X.R.; Li, M.F.; Wei, J.H. Cool temperature enhances growth, ferulic acid and flavonoid biosynthesis while inhibiting polysaccharide biosynthesis in Angelica sinensis. Molecules 2022, 27, 320. [Google Scholar] [CrossRef]
- Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
- Lv, M.; Su, H.Y.; Li, M.L.; Yang, D.L.; Yao, R.Y.; Li, M.F.; Wei, J.H. Effect of UV-B radiation on growth, flavonoid and podophyllotoxin accumulation, and related gene expression in Sinopodophyllum hexandrum. Plant Biol. 2021, 23, 202–209. [Google Scholar] [CrossRef] [PubMed]
- Li, M.F.; Li, T.; Li, W.; Yang, D.L. Changes in antioxidant capacity, levels of soluble sugar, total polyphenol, organosulfur compound and constituents in garlic clove during storage. Ind. Crops Prod. 2015, 69, 137–142. [Google Scholar]
- Arnao, M.B. Some methodological problems in the determination of antioxidant activity using chromogen radicals: A practical case. Trends Food Sci. Technol. 2000, 11, 419–421. [Google Scholar] [CrossRef]
- Nencini, C.; Menchiari, A.; Franchi, G.G.; Micheli, L. In vitro antioxidant activity of aged extracts of some Italian Allium species. Plant Food. Hum. Nutr. 2011, 66, 11–16. [Google Scholar] [CrossRef]
- Wang, L.C.; Kong, B.H.; Zhao, D.; Chen, H.R.; Li, F. Occurance and detection of viruses infecting Yuannan edible Lily. J. Yunnan Agric. Univ. 2009, 24, 518–521. [Google Scholar]
- Ma, N.; Wang, Y.; Liu, Y.Z.; Sun, Y.Q.; Chen, Y.J. Effects of Notoginseng virus disease on yield and quality. Mod. Agric. Sci. Technol. 2015, 14, 110–113. [Google Scholar]
- Krupinsky, J.M.; Bailey, K.L.; McMullen, M.P.; Gossen, B.D.; Turkington, T.K. Managing plant disease risk in diversified cropping systems. Agron. J. 2002, 94, 198–209. [Google Scholar] [CrossRef]
- Aliyu, T.H.; Balogun, O.S. Effects of variety and planting density on the incidence of common viral diseases of Cowpea (Vigna unguiculatd) in a southern guinea savannah agro-ecology. Asian J. Plant Pathol. 2011, 5, 126–133. [Google Scholar]
- Iqbal, M.; Khan, M.A.; Ul-Allah, S. High density cotton population in late sowing improves productivity and tolerance to cotton leaf curl virus under semi-arid subtropical conditions. J. Plant Dis. Prot. 2021, 128, 685–692. [Google Scholar] [CrossRef]
- Heathcote, G.D. Effect of Plant spacing and time of sowing of sugar beet on aphid infestation and spread of virus yellows. Plant Pathol. 1970, 19, 32–39. [Google Scholar] [CrossRef]
- Kaldis, A.; Berbati, M.; Melita, O.; Reppa, C.; Holeva, M.; Otten, P.; Voloudakis, A. Exogenously applied dsRNA molecules deriving from the Zucchini yellow mosaic virus (ZYMV) genome move systemically and protect cucurbits against ZYMV. Mol. Plant Pathol. 2018, 19, 883–895. [Google Scholar] [CrossRef] [PubMed]
- Pesti, R.; Kontra, L.; Paul, K.; Vass, I.; Csorba, T.; Havelda, Z.; Várallyay, É. Differential gene expression and physiological changes during acute or persistent plant virus interactions may contribute to viral symptom differences. PLoS ONE 2019, 14, e0216618. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Jiang, K.R.; Li, C.J.; Du, J.; Li, M.J.; Ghanem, H.; Wu, G.T.; Qing, L. Tobacco curly shoot virus C3 protein enhances viral replication and gene expression in Nicotiana benthamiana plants. Virus Res. 2020, 281, 197939. [Google Scholar] [CrossRef]
- Xie, R.J.; Dong, Y.Z. Occurrence and prevention of virus disease in Radix pseudostellariae in Weng ‘an County. Plant Health Med. 2012, 3, 27. [Google Scholar]
- Zhao, X.T.; Liu, X.L.; Ge, B.B.; Li, M.J.; Hong, B. A multiplex RT-PCR for simultaneous detection and identification of five viruses and two viroids infecting Chrysanthemum. Arch. Virol. 2015, 160, 1145–1152. [Google Scholar] [CrossRef]
- Zhang, Z.C.; Zhang, L.F.; Qiao, Q.; Wang, Y.J.; Jin, X.L. Identification of viral pathogens of Rehmannia glutinosa disease in Henan Province. Acta Phytopathol. Sin. 2004, 34, 395–399. [Google Scholar]
- López-Gresa, M.P.; Lisón, P.; Kim, H.Y.; Choi, Y.H.; Verpoorte, R.; Rodrigo, I.; Conejero, V.; Bellés, J.M. Metabolic fingerprinting of Tomato Mosaic Virus infected Solanum lycopersicum. J. Plant Physiol. 2012, 169, 1586–1596. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.H.; Zhong, L.J.; Zhao, X.X. Relationship among total phenol flavonoid and PPO activity with the necrosis of tobacco infected by PVYN. Acta Phytopathol. Sin. 2007, 37, 398–402. [Google Scholar]
- Thresh, J.M. Cropping practices and virus spread. Annu. Rev. Phytopathol. 1982, 20, 193–216. [Google Scholar] [CrossRef]
- Holt, J.; Chancellor, T.C.B. A model of plant virus disease epidemics in asynchronously-planted cropping systems. Plant Pathol. 1997, 46, 490–501. [Google Scholar] [CrossRef]
- Wang, Y.W.; Zhou, J.H.; Luo, N.; Wang, G.Y. Control effect of BR and agronomic measures on TY virus disease and stem base rot of autumn tomato in plastic house. China Cucurbits Veg. 2021, 34, 60–64. [Google Scholar]
- Xu, B.L.; Liang, Q.L.; Xu, Q. Occurrence and the types of symptoms of lily virus diseases. Plant Prot. 2004, 30, 62–65. [Google Scholar]
- Lin, C.Y.; Luo, M.Y.; Lin, J.; Huang, Y.P.; Zhang, F.Z. Study on occurrence law and control technology of pepper virus disease. Hubei Agric. Sci. 2009, 48, 2142–2144, 2183. [Google Scholar]
- Zhang, Z.; Liu, X.Z.; Bao, Y.J.; Li, J.; Cao, X.L.; Li, M.F. Selection of cropping rotations of Angelica sinensis based on biomass, bioactive compounds accumulation and antioxidant capacity. J. Gansu Agric. Univ. 2018, 53, 82–89. [Google Scholar]
- Yan, J.M.; Ye, H.Z.; Qin, Y.; Wu, G.T. Investigation on the disease of medical plants in Sichuan province and pathogen identification II A list of medicinal plant diseases. Southwest China J. Agric. Sci. 2008, 21, 359–363. [Google Scholar]
- Feng, X.H.; Li, J.; Luo, X.G. Research advances on virus elimination in Lily. J. Agric. 2015, 5, 91–95. [Google Scholar]
- Yao, Y.S. Comprehensive control technology for Radix pseudostellariae virus disease. Fujian Agric. Sci. Technol. 2014, 45, 41–42. [Google Scholar]










| Counties | Towns | Locations | Previous Crops |
|---|---|---|---|
| Minxian | 1-Lujing | 104°28′56.64″, 34°18′43.92″; 2611 m | Astragalus membranaceus |
| 2-Sigou | 104°5′12.48″, 4°22′16.68″; 2494 m | Vicia faba | |
| 3-Mazichuan | 104°3′28.08″, 34°17′0.96″; 2564 m | Zea mays | |
| 4-Mazichuan | 104°3′22.32″, 34°10′8.04″; 2551 m | Astragalus membranaceus | |
| 5-Mazichuan | 104°3′54″, 34°17′33.36″; 2550 m | Codonopsis pilosula | |
| Weiyuan | 1-Huichuan | 103°59′29.76″, 35°1′48.72″; 2458 m | Zea mays |
| 2-Huichuan | 104°2′11.4″, 35°13′37.56″; 2437 m | Solanum tuberosum | |
| 3-Huichuan | 104°7′9.12″, 35°4′39.72″; 2458 m | Solanum tuberosum | |
| 4-Wuzhu | 104°3′47.16″, 35°26′7.44″; 2552 m | Solanum tuberosum | |
| 5-Qijiamiao | 103°59′18.24″, 35°4′33.24″; 2392 m | Angelica sinensis | |
| Zhangxian | 1-Jinzhong | 104°0.46998′0″, 34°51′14.04″; 2975 m | Glycine max |
| 2-Jinzhong | 104°3′7.2″, 34°50′32.64″; 2867 m | Vicia faba | |
| 3-Jinzhong | 104°6′16.2″, 34°49′43.68″; 2711 m | Astragalus membranaceus | |
| 4-Jinzhong | 104°7′56.28″, 34°49′24.24″; 2842 m | Codonopsis pilosula | |
| 5-Jinzhong | 104°2′32.28″, 34°51′46.44″; 2932 m | Glycine max | |
| Tanchang | 1-Awu | 104°9′52.92″, 34°17′29.4″; 2386 m | Avena sativa |
| 2-Awu | 104°10′49.8″, 34°20′6.72″; 2529 m | Brassica campestris | |
| 3-Lichuan | 104°11′25.8″, 34°10′30.72″; 2483 m | Codonopsis pilosula | |
| 4-Pangjia | 104°15′30.6″, 34°19′42.24″; 2461 m | Brassica campestris | |
| 5-Pangjia | 104°9′28.08″, 34°11′38.76″; 2478 m | Fallow land |
| Genes | CDS Sequences |
|---|---|
| PVY-CP | 1 ggaaatgaca caatcgatgc aggaggaagc actaagaagg atgcaaaaca agagcaaggt 61 agcattcaac caaatctcaa caaggaaaag gaaaaggacg tgaatgttgg aacatctgga 121 actcatactg tgccacgaat taaagctatc acgtccaaaa tgagaatgcc caagagtaaa 181 ggtgcaactg tactaaattt ggaacactta ctcgagtatg ctccacagca aattgacatc 241 tcaaatactc gagcaactca atcacagttt gatacgtggt atgaagcggt acaacttgca 301 tacgacatag gagaaactga aatgccaact gtgatgaatg ggcttatggt ttggtgcatt 361 gaaaatggaa cctcgccaaa catcaacgga gtttgggtta tgatggatgg agatgaacaa 421 gtcgaatacc cactgaaacc aatcgttgag aatgcaaaac caccacttag gcaaatcatg 481 gcacttttct cagatgttgc agaagtgtat atagaaatgc ttatcaaaaa ggaaccatat 541 atgccacgat atggtttagt tcgtaatctg cgcgatggaa gtttggctcg ctatgctttt 601 gacttttatg aggtcacatc acgaacacca gtgagggcta gggaagcgca cattcaaatg 661 aaggccgcag cattgaaatc agcccaacct cgacttttcg ggttggacgg tggcatcagt 721 acacaagagg agaacacaga gaggcacacc accgaggatg tctctccaag tatgcatact 781 ctacttggag tcaagaacat g |
| ToMV-CP | 1 tactcaatca cttctccatc gcaatttgtg tttttgtcat ctgtatgggc tgaccctata 61 gaattgttaa acgtttgtac aaattcgtta ggtagccagt ttcaaacaca gcaagcaaga 121 actactgttc aacagcagtt cagcgaggtg tggaaacctt tccctcagag caccgtcaga 181 tttcctggtg atgtttataa ggtgtacagg tacaatgcag ttttagatcc tctaattact 241 gcgttgctgg ggactttcga tactaggaat agaataatcg aagtaaaaaa ccagcagat 301 ccgacaacag ctgaaacgtt agatgctacc cgcagggtag acgacgctac ggttgcaatt 361 cggtctgcta taaataattt agttaatgaa ctagtaagag gtactggact gtacaatcag 421 aatacttttg aaagtatgtct gggttggtct ggacctctgc acctgcatc |
| Genes | Primer Sequences (5′ to 3′) | Amplicon Size (bp) |
|---|---|---|
| EEF1G | Forward: GTCCCAGCAGCCAAAAAGTC | 101 |
| Reverse: TCTGCCTTGGGCAATTCCTT | ||
| PVY-CP | Forward: TGTGGCAGGCTTACCAGTTG | 132 |
| Reverse: AGTAAGTCACTGGCTGGCAA | ||
| ToMV-CP | Forward: CTTTCCCTCAGAGCACCGTC | 149 |
| Reverse: TGTCGGACTCTGCTGGTTTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Li, T. Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis. Horticulturae 2024, 10, 1300. https://doi.org/10.3390/horticulturae10121300
Li J, Li T. Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis. Horticulturae. 2024; 10(12):1300. https://doi.org/10.3390/horticulturae10121300
Chicago/Turabian StyleLi, Jinjuan, and Ting Li. 2024. "Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis" Horticulturae 10, no. 12: 1300. https://doi.org/10.3390/horticulturae10121300
APA StyleLi, J., & Li, T. (2024). Identification of Viral Diseases and Influences on Yield and Quality of Angelica sinensis. Horticulturae, 10(12), 1300. https://doi.org/10.3390/horticulturae10121300
