Next Article in Journal
Blue and Red Light Downconversion Film Application Enhances Plant Photosynthetic Performance and Fruit Productivity of Rubus fruticosus L. var. Loch Ness
Next Article in Special Issue
Integrated Control of Powdery Mildew Using UV Light Exposure and OMRI-Certified Fungicide for Greenhouse Organic Lettuce Production
Previous Article in Journal
Diversity and Utilization of Commelinaceae in Central Laos
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 10
10.3390/horticulturae10101044
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Green Alternatives for the Control of Fungal Diseases in Strawberry: In-Field Optimization of the Use of Elicitors, Botanical Extracts and Essential Oils

by
Sebastian Soppelsa
1,
Antonio Cellini
2,
Irene Donati
2,
Giampaolo Buriani
2,
Francesco Spinelli
2,* and
Carlo Andreotti
3,*
1
Berries and Stonefruits Research Group, Laimburg Research Centre, 39040 Ora-Auer, Italy
2
Department of Agricultural Sciences, University of Bologna, 40127 Bologna, Italy
3
Faculty of Agricultural, Environmental and Food Sciences, Free University of Bolzano-Bozen, 39100 Bolzano, Italy
*
Authors to whom correspondence should be addressed.
Horticulturae 2024, 10(10), 1044; https://doi.org/10.3390/horticulturae10101044
Submission received: 21 August 2024 / Revised: 23 September 2024 / Accepted: 25 September 2024 / Published: 30 September 2024
(This article belongs to the Special Issue New Challenge of Fungal Pathogens of Horticultural Crops)
Browse Figures
Review Reports Versions Notes

Abstract

:
Finding safe and reliable alternatives to fungicides is currently one of the biggest challenges in agriculture. In this regard, this experiment investigated the effectiveness of different elicitors, botanical extracts and essential oils to control grey mold (Botrytis cinerea) and powdery mildew (Podosphaera aphanis) on strawberry plants. This trial was conducted in field conditions under a plastic tunnel with strawberry plants ‘Elsanta’. A first group of strawberry plants was treated before flowering with elicitors [acibenzolar-S-Methyl–(BTH), chitosan], botanical extracts (seaweed extract, alfalfa hydrolysate) and essential oils (thyme and juniper), and grey mold incidence on flowers was evaluated (Experiment 1). Furthermore, a second group of plants was treated before (Experiment 2) and after (Experiment 3) controlled inoculation with P. aphanis. The results indicated that the incidence of flower infected by B. cinerea was reduced by approximately 50% with thyme and juniper essential oils’ applications compared to the untreated control, with no significant difference observed compared to the commercial fungicide penconazole (positive control). As a consequence, the final yield of essential-oil-treated plants was +27% higher than that of non-treated plants. No significant differences emerged for other tested products against grey mold. However, gene expression analysis showed an up-regulation (>2 ÷ 5 folds as compared to control 4 days after application) of FaEDS1, FaLOX and PR gene expression (FaPR1, FaPR5, FaPR10) in leaves treated with BTH. The other natural substances tested also induced defense-related genes, albeit at a lower level than BTH. In Experiment 2, all treatments applied prior to inoculation significantly reduced the incidence and severity of powdery mildew as compared to control. At 28 days after inoculation, chitosan and thyme essential oil applications performed similarly to their positive controls (BTH and penconazole, respectively), showing a significant reduction in disease incidence (by −84 and −92%) as compared to control. Post-inoculum application of essential oils (Experiment 3) showed an efficacy similar to that of penconazole against powdery mildew. These results indicated that the tested substances could be used as alternatives to fungicides for the control of grey mold and powdery mildew in strawberry, therefore representing a valuable tool for the control of these fungal diseases under the framework of sustainable agriculture.

1. Introduction

Strawberry is the most important berry fruit crop produced globally with an increase of 39.4% between 2008 and 2021 [1]. In the EU, Spain (360 kiloton), Poland (162 kt), Germany (130 kt) and Italy (117 kt) are the leading producing countries. Europe produces nearly 1.7 Kt of strawberries (21% of the world’s quantity). From 2007 to 2021, the EU strawberry market increased yearly by +2.1%, reaching in 2020 ~EUR 3282 billion [2]. This growth responds to the increasing demand for red fruits, and consumers’ awareness about their nutritional value and antioxidant benefits [3]. However, strawberry cultivation relies on an average of 36 sprays per year with a pesticide application of 18 kg ha−1. Indeed, strawberry recurrently ranks at the top of the ‘dirty dozen’ (a list of 12 top pesticide-contaminated fruit/vegetables), supporting the need to develop zero-residue production methods [2,4]. Powdery mildew, caused by the obligate pathogenic fungus Podosphaera aphanis (Wallr.), and grey mold, the etiological agent of which is Botrytis cinerea Pers., are among the diseases of strawberry requiring the highest pesticide applications. Their control requires periodic application of fungicides such as penconazole, quinoxyfen, and trifloxystrobin [5,6,7].
Strawberry production is increasingly shifting from open fields into protected environments [8]. Unfortunately, phytosanitary problems related mainly to grey mold and powdery mildew are increasing inside the new growing environment since these diseases find conditions such as a lack of precipitation (for powdery mildew), reduced light intensities, high humidity and longer periods of temperature above 20 °C optimal [9,10].
Xenobiotic pesticides are still massively used for crop protection, with fungicides being the most widely applied chemical [11]. Indeed, despite integrated pest management being a key European cornerstone for crop production, between 2011 and 2020, pesticide sales in the EU were almost stable, around 350,000 t year−1 [12]. Pesticides use poses serious environmental, health and social risks [13]. For example, EFSA reports that, in 2019, approx. 4% of fruits and vegetables exceeded residue limits [14]. Moreover, pesticide use may lead to a rise in pathogen resistance and contribute to the environmental resistome [6,7,15]. In Europe, the awareness of the risks of pesticides led to the development of policies for their sustainable use (Directive 2009/128/EC) and actions, such as the Farm2Fork Strategy, aiming at a reduction of 50% in pesticide use by 2030 [16].
The use of botanical extracts, essential oils and natural elicitors represents a promising and safe alternative to the use of fungicides [17,18,19]. Resistance inducers are considered a reliable and sustainable method for crop protection since they promote natural plant defenses against pathogens [20]. These compounds may act on systemic acquired resistance (SAR) or induced systemic resistance (ISR). Among the signaling molecules regulating plant defenses, salicylic acid (SA), jasmonic acid (JA) and ethylene play a crucial role [21]. SAR acts mainly against biotrophic pathogens such as powdery mildew and depends on SA signaling, leading to systemic expression of pathogenesis-related (PR) genes [22,23,24]. SA biosynthesis is activated by PAD4 (Phytoalexin Deficient 4) and EDS1 proteins (Enhanced Disease Susceptibility 1) [25,26]. Several PR proteins were identified, such as PR-1 (antifungal), PR-5 (thaumatin-like protein), and PR-10 (ribonuclease-like protein) [27,28]. JA is an important regulator involved in the ISR signaling pathway, with lipoxygenase (LOX) being a key enzyme for its biosynthesis [29,30,31]. JA activates the expression of genes encoding antifungal compounds such as LOX-derived oxylipins, which are synthetized in response to biotic stress [32,33]. Furthermore, plants can activate defenses with the biosynthesis of particular defensive substances (secondary metabolites) such as phenylpropanoids, isoprenoids and alkaloids [34,35,36,37,38].
In the absence of any biotic stress, plant defense mechanisms might be trigged through exogenous chemical elicitors (or resistance inducers), which do not directly kill the harmful organism but promote plant defense [39,40].
In the present study, we investigated different resistance inducers (acibenzolar-S-methyl, chitosan), botanicals extracts (seaweed extract, alfalfa protein hydrolysate) and essential oils (thyme and juniper). Chitosan is the deacetylated form of biopolymer chitin, which is a component of crustacean and insect exoskeletons and fungal cell walls. Chitosan was found to be able to activate L-phenylalanine ammonia-lyase (PAL) biosynthesis in different crop species, leading to a higher final accumulation of phenolic compounds with antipathogenic activity in tomato [41], papaya [42] and grape [43]. For this reason, chitosan is often used as a plant elicitor rather than a product with a direct antimicrobial activity [44]. Seaweed extracts are a complex mixture of components such as mineral elements, amino acids, vitamins, phytohormones, betaines, sterols and polysaccharides (e.g., ulvans, agarans, carrageenans, alginates, fucans and laminarins) [45,46,47,48]. Studies have attributed to seaweed polysaccharides the role of effective elicitors of plant defense against biotic stresses [48,49,50,51]. Protein hydrolysates are defined as “mixtures of polypeptides, oligopeptides and amino acids that are manufactured from protein sources, using partial hydrolysis” [52]. They exert a biostimulating activity due to their content in plant hormones, peptides and amino acids [53,54,55]. Although biostimulant properties of legume-derived protein hydrolysates are well studied, few indications are present in the scientific literature regarding their eliciting action against pathogens. Essential oils have received great interest in recent years due to their antimicrobial, antiviral, biodegradable and eco-friendly properties [56,57,58]. Essential oils have a complex composition containing monoterpenes, sesquiterpenes and phenylpropanoids. As a consequence, resistance against them is rarely developed by pathogens [59]. In particular, Thymus essential oil has been demonstrated to have pronounced direct antimicrobial properties and in vitro experiments showed that this activity is mediated by two phenolic components, thymol and carvacrol [56,60,61]. The antimicrobial activity of Juniper essential oil, linked to some of its components such as limonene and terpinen-4-ol, has been demonstrated on fungal pathogens (e.g., B. cinerea) [62]. In addition to its direct antifungal activity, essential oils can have an elicitor activity against pathogens (e.g., downy mildew) on grapevine plants [63].
The aim of this work was to evaluate the efficacy of selected commercial products (elicitors and essential oils) to control grey mold and powdery mildew in strawberry plants cultivated under plastic tunnel conditions. Moreover, the impact of the tested products on the plant defense mechanism was investigated.

2. Materials and Methods

2.1. Plant Material, Growth Conditions and Tested Products

These experiments were conducted under soilless conditions within a plastic tunnel at the Laimburg Research Centre, in the municipality of Ora/Auer (46°22′ N; 11°17′ E; 237 m a.s.l.) in Alto-Adige/South Tyrol, Italy. The temperatures in the greenhouse ranged between 20–25 °C (day) and 10–15 °C (night), and relative humidity (RH) was kept at high values (Figure 1) owing to a fog system placed under the soilless structure.
Cold-stored strawberry tray plants (TP) ‘Elsanta’ were transplanted into individual pots (16 cm diameter) containing a mixture of natural clay, white peat, perlite and mineral fertilizer (pH 5.8, EC 0.40 dSm−1, total porosity 90%, bulk density 130 kg m−3; Profi Substrat, SP VM, Einheits Erde, Sinntal-Altengronau, Germany). All plants were watered daily by drip irrigation and fertilized weekly alternating between a granulated long-term NPK fertilizer (10 g per pot; Berry Fertilizer 15-8-12, Hack, Langerwehe, Germany) and a water-soluble fertilizer containing macro- and microelements (200 mL per pot at a dosage of 200 g h L−1; Floral 20-20-20, Cifo, Bologna, Italy). No fungicidal applications were carried out during this experiment, whereas the acaricide (Vertimec® EC, Syngenta, Basel, Switzerland) was sprayed twice before flowering at a concentration of 0.5 mL L−1.
Details on the names, abbreviations and application doses of the tested products are reported in Table 1. The fungicide Topas® and the plant defense elicitors Bion® and ChitoPlant Solution® were commercial products used as positive controls at the concentration suggested in their labels. The botanical extracts from seaweed and alfalfa were experimental products (prototypes) and were applied at concentrations previously tested for strawberry plants [64]. The essential oils from thyme and juniper were commercial products that were applied at concentrations previously found effective after in vitro spore germination essays conducted on B. cinerea and described in Soppelsa et al. [58]. Water was used as the negative control and in all cases, and Adesil A surfactant (Serpan, Vicenza, Italy) was added as wetting agent (0.03%) to improve the leaf coverage uniformity and solubility of different products. The products were applied as a fine mist on the upper surface of the leaves until the runoff point (50 mL per plant) using a hand sprayer before (Experiment 1) or after flowering (Experiment 2 and 3).

2.2. Experimental Design

The research activity was subdivided into three experiments:
Experiment 1: Pre-flowering treatment
To assess the efficacy of commercial products in preventing floral infection by B. cinerea, a group of 66 strawberry plants was sprayed before flowering (BBCH 56—Inflorescence elongating) with a single application of the products listed in Table 1. The same plants were also sampled for gene expression analysis to investigate the molecular basis of the products’ efficacy. The experimental setup was organized as a completely randomized block design with four replicates of two plants each per treatment. In addition to gene expression analysis (see Section 2.5), some parameters such as yield and fruit qualitative traits were evaluated (see Section 2.4), as well as the incidence of flowers infected by B. cinerea (see Section 2.3).
Experiment 2: Post-flowering treatment at pre-inoculation
A second group of 84 strawberry plants was sprayed post-flowering (BBCH 71—Receptacle protruding from sepal whorl). The plants were treated with a single application of FUN, BTH, APH and THY (Table 1). SEA was applied 2 times (second application after 3 days), while all other products were only applied one time. Seven days after treatment, the plants were artificially inoculated with Podosphaera aphanis (see Section 2.3). Powdery mildew assessment (Section 2.3) was conducted considering each strawberry plant as a single replication (8 plants per treatment).
Experiment 3: Post-flowering treatment at post-inoculation
This experiment aimed at investigating the potential curative effect of essential oils (THY and JUN) against P. aphanis. For this aim, 34 strawberry plants were sprayed with THY and JUN 24 h after inoculation. Penconazole and water were used as positive and negative control, respectively.

2.3. Disease Assessment and Inoculation Procedure of Podosphaera aphanis

Grey mold incidence was assessed in the condition of natural infection. Incidence was calculated taking into account the percentage of symptomatic flowers in each plant [65]. Powdery mildew incidence and severity were assessed after the experimental inoculation of the plants. The conidia of P. aphanis were collected from naturally infected, symptomatic strawberry plants ‘Elsanta’ obtained from a local farm. One hour before inoculation, a P. aphanis conidia suspension was produced by harvesting conidia by washing symptomatic strawberry leaves into a flask of 0.03% Adesil A (Serpan, Vicenza, Italy) in distilled water. Conidia concentration was quantified with a hemocytometer and adjusted to 105 conidia mL−1, as previously reported [66] with some modifications. P. aphanis conidia suspension was sprayed onto the upper surface of the leaves (100 mL per plant). Approximately every 2 weeks after inoculation, powdery mildew incidence and severity were assessed. The percentage of infected leaves per plant was calculated by counting the number of healthy and infected leaves (presenting at least one powdery mildew patch per leaf) [8]. Disease severity was determined considering 12 leaves per plant (8 plants per treatment) and was evaluated with a plant image analyzer (BioLeaf—Foliar Analysis™, Federal University of Mato Grosso do Sul, Campo Grande, Brazil) and expressed as percentage of the infected area compared to the total leaf area.

2.4. Yield and Fruit Quality

Ripe strawberries (full red color) were harvested every three days, starting at 50 days after transplanting. Data from each fruit picking were used to calculate the final cumulative yield per plant (as grams plant−1). Fruit quality was determined on four mature and homogeneous fruits per plant. The firmness (FF as kg cm−2), the total soluble solids (TSS as °Brix) and the titratable acidity (TA as g L−1 of citric acid) were evaluated, respectively, with a penetrometer (6 mm in diameter), a portable refractometer (PAL-1, ATAGO, Tokyo, Japan) and with a titrator (TitroLine easy, SCHOTT, Mainz, Germany) by titrating strawberry pulp to pH 8.2 using 0.1 M NaOH. Extraction and quantification of phenolic compounds were carried out using a method described by Meyers et al. [67] and Wolfe et al. [68]. Briefly, phenolics were extracted from lyophilized leaves/fruits using 80% methanol acidified with H3PO4 and NaF. The total phenolic content was determined with the Folin–Ciocalteu colorimetric method and expressed as milligrams of gallic acid equivalents (GAE) per 100 g of dry weight (mg GAE 100 g−1 DW).

2.5. Gene Expression Analysis

The gene expression analysis was conducted as part of the Experiment 1 activities only (see Section 2.2) on plants treated with BTH, CHI, SEA and THY. Leaf samples were collected at 0, 48, 72, 96 and 168 h after treatment, taking two young single leaves per plant. The leaves were immersed in liquid nitrogen and stored at −80 °C. At every sampling time, two plants per treatment were considered. Each plant was sampled only once to avoid a wounding effect. Changes in expression of genes related to downstream components of the SAR pathway (Table 2) were determined by a reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR), as described by Cellini et al. [69]. Briefly, total RNA was extracted from strawberry leaves following the manufacturer’s instructions in Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St. Luis, MI, USA). RNA was used for cDNA synthesis with reverse-transcription PCR. Specific primers were designed using Primer3Web software 4.1.0 and previously tested for specificity (Table 2). The expression of genes was measured using a StepOne Plus Real-Time PCR instrument (Thermo Fisher Scientific, Waltham, MA, USA) with a SYBR Green-based assay. Strawberry leaves pre-treated with different resistance inducers were examined for FaPR1, FaPR5, FaPR10, FaEDS1 and FaLOX genes.
All quantifications were normalized by the threshold cycle value (CT) compared to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (FaGPDH2). Gene expression analysis was expressed using the 2(−ΔΔCT) fold change method, in which ‘0’ fold change corresponds to ‘no change’. Untreated control at the corresponding time point was used to calculate the fold changes.

2.6. Statistical Analysis

One-way analysis of variance (ANOVA) was performed to determine the significance of differences among treatments after validating the data for normal distribution (Shapiro–Wilk normality test, p > 0.05) and equality of variances (Bartlett’s test, p > 0.05). For non-normal data, the Kruskal–Wallis test was applied. Data expressed in percentage were arcsin-transformed prior to the analysis of variance. In case of significance, mean separation was carried out with the least significant difference (LSD) test. All analyses were carried out in R v. 3.3.1. (R Development Core Team 2016). The results were expressed as mean ± standard error (SE).

3. Results

3.1. Efficacy against Natural Infection by Botrytis Cinerea (Experiment 1)

Natural disease incidence in untreated plants was around 50%, whereas treatment with fungicide was able to halve the percentage of infected flowers per plant compared to the control (Figure 2). An effect similar to that of the fungicide was observed in plants treated with THY and JUN (40–50% less infections in comparison to control). No significant differences were detected among other treatments (33–44% of infected flowers per plant) in comparison to untreated plants.

3.2. Preventive Effects against Powdery Mildew Incidence and Severity on Leaves (Experiment 2)

Symptoms of powdery mildew on strawberry leaves started to be visible about 14 days after inoculation. Considering preventive application, the results indicated that all tested products controlled powdery mildew development on strawberry leaves (Figure 3A,B). In further detail, at 28 days after inoculation, CHI and THY applications performed a similar action to their positive controls (BTH and FUN, respectively), showing a significant incidence reduction (by −84 and −92%) as compared to control. SEA and APH treatments were shown to significantly reduce powdery mildew incidence (−42 and −58%, respectively, as compared to the control). The statistical differences among the treatments remained similar at 42 days (Figure 3A). Powdery mildew was well established in untreated plants at almost 2 months after inoculation, when 65% more of the leaves presented at least one infection site (Figure 3A). At that time, all treatments maintained an inhibitory action towards powdery mildew. In further detail, the fungal incidence in CHI-, SEA- and APH-treated plants was similar to that observed on BTH-treated plants, whereas the THY effect was analogue to that of FUN. The assessment of disease severity showed that all treatments suppressed the development of powdery mildew. Despite disease severity remaining low, with symptoms developing on less than 5% of leaf area, differences among the treatments were detected (Figure 3B). In particular, as observed for disease incidence, the application of FUN, CHI and THY was demonstrated to significantly reduce the extension of red blotches (up to 94% reduction as compared to untreated).

3.3. Curative Effects against Powdery Mildew Incidence and Severity on Leaves (Experiment 3)

Post-inoculum application of products showed the effective action of essential oils in reducing disease incidence and severity (Figure 4A,B). Although both essential oils (THY and JUN) were shown to inhibit powdery mildew development with an action similar to that of the positive control (FUN), THY seemed to have the highest inhibitory action against the pathogen, as the disease severity at 56 days was the lowest among the treatments.

3.4. Fruit Production and Quality

Plants treated with essential oils (THY and JUN) were shown to increase the final yield per plant. In the case of JUN-treated plants, the yield result was comparable to that obtained with the fungicide treatment (around 0.160 kg plant−1) (Table 3). The enhanced yield in THY- and JUN-treated plants (+23 and +31% as compared to control, respectively) was a direct consequence of the reduction in fruit losses due to infection (about 15% more than untreated fruits) (Table 3).
Treatments such as CHI and SEA were also demonstrated to significantly increase the yield (0.135 kg compared to 0.120 kg plant−1 in control plants). BTH- and APH-treated plants yielded the same amount as control plants. Regarding fruit weight, no significant differences were observed among the treatments (around 10–12 g fruit−1) (Table 3).
A higher sugar and acidity content was observed in untreated fruits, though differences between the treated fruits were not significant (Table 3). As regards phenolic content in strawberry fruits, no significant differences were detected. FUN-treated fruits showed a tendency to increase this parameter (+24% as compared to control fruits).

3.5. Gene Expression Analysis

An up-regulation of the PR gene’s expression (FaPR1, FaPR5, FaPR10) was observed in leaves treated with BTH (Figure 5A–C). In further detail, gene expression was highest 4 days after BTH treatment. BTH application induced a long-lasting (up to 7 days) increase in the FaEDS1 and FaLOX genes’ expression. The expression levels of the target genes appeared weaker in plants treated with the natural elicitors (SEA and CHI) and THY than in the positive control (BTH). As shown in Figure 5, FaPR1, FaPR5, FaPR10 and FaLOX exhibited a peak of expression at 2 and 3 days after SEA application (fold change < 2). These effects completely disappeared at 4 (for FaPR5, FaPR10 and FaLOX) and 7 days (for FaPR1). FaEDS1 was not expressed after treatment. Contrary to what was observed in SEA, starting at 2 days after CHI treatment, FaPR1, FaPR5, FaEDS1 and FaLOX were induced and their expression levels continued to be stable even at 7 days (except for FaLOX). Thyme essential oil application was demonstrated to have a low effect on the activation of defense-related genes (fold-change < 1). SEA, CHI and THY proved to enhance defense-related gene expression, even though at a lower level as compared to BTH (fold change expression < 2).

4. Discussion

Pre-flowering applications of essential oils were the only treatments that significantly reduced the incidence of B. cinerea in flowers and their protective effect was comparable to that of commercial fungicide. This effect is related to the direct inhibition pathogen growth being essential oils well known for their antifungal activity [58,70,71]. In further detail, essential oils can directly inhibit the biosynthesis of chitin, β-glucans and ergosterol, alter fungal mitochondrial electron transport chain and cell division, and interfere with RNA/DNA and protein synthesis [72,73,74,75,76,77].
On the other hand, commercial products acting as resistance inducers, such as BTH, failed in protecting flowers from infection. BTH-induced resistance against diseases was observed on several plants such as tomato, Arabidopsis, peach, apple, strawberry and papaya [78,79,80,81,82,83]. Although our results confirmed the induction of defense responses in BTH-treated strawberry leaves (the highest level of gene expression in comparison to all tested products), the incidence of infected flowers, as well as the final yield, was not significantly different to that of the control treatment.
The lack of efficacy of BTH could be related to the timing of resistance induction. Several studies showed that the rise in plant defenses needs a minimum of 3–4 days, reaches a peak in two–three weeks and decreases to a normal level in approximately 4 weeks [84]. Indeed, in our study, a rise in defense-related genes was observed 4 days after the treatment. This indicates that in our experimental conditions, it can be assumed a timing of plant resistance similar to that found in other studies [85]. However, B. cinerea incidence was assessed only more than 60 days after treatment, when the BTH effect was probably already fading. Furthermore, under natural disease pressure, B. cinerea inoculum can build up rapidly under favorable conditions, making results less predictable. In this view, a product like essential oils, which have a dual mode of action—direct antifungal effects and induction of resistance—may result in a more consistent protective effect throughout the season.
Essential oils may also induce defense mechanisms in plant tissues, including the activation of antioxidant and defense-related enzymes and the accumulation of phenolic compounds [57,86]. A positive effect of thyme essential oil against grey mold and Fusarium wilt in tomato plants was observed by Ben-Jabeur et al. [60]. The authors attributed the protective action of thyme extract to a combination of a direct antifungal activity and the induction of defenses in plants.
However, in our experimental conditions, the protective effect of essential oils relies primarily on their fungicidal effects, which was also confirmed in curative treatments (Experiment 3). Indeed, application of THY did not significantly induce any defense-related gene expression in plant tissues, nor did it alter the total phenolic content (Figure 5; Table 3). The results may be related to the time required for strawberries to enhance their plant defenses or to the activation of defense mechanisms that are not associated with SAR. Concerning the induction of phenolic compounds, we measured it only on fruit that were not directly exposed to an essential oil. Furthermore, differences in phenolic compounds may be related to the induction of specific compounds rather than a generalized induction of this chemical class [87]. The reduction in flower losses by B. cinerea in plants treated with essential oils and fungicide could explain the increased final yield measured in those treated plants.
When considering the experiments in controlled inoculation with P. aphanis, the positive action of post-flowering application of elicitors and essential oils against powdery mildew infections was shown. Considering both preventive (Experiment 2) and curative actions (Experiment 3), the thyme essential oil had a protective effect against powdery mildew similar to that of the fungicide. In this experiment, thyme essential oil application resulted in a lower disease severity than in the preventive application (Experiment 2) despite the differences not being statistically significant. This finding is in agreement with studies conducted by Sturchio et al. [88] and Mostafa et al. [89], where clove, lemongrass, peppermint, rosemary, tea tree and thyme essential oils were demonstrated to be valid fungicidal alternatives to control powdery mildew infections on Cucurbitaceae crops. In our experiment, chitosan, seaweed extract and alfalfa hydrolysate showed an action similar to BTH treatment against powdery mildew infection (Figure 3). The induction of resistance by chitosan application is also a well-studied topic. Being a polysaccharide, chitosan could act in the same way as described for algal polysaccharides. The accumulation of PR proteins, phytoalexins, lignin biosynthesis and callose formation was among some of the defense mechanisms induced by chitosan in treated plants [44]. As an example, grapes treated with chitosan were shown to be less susceptible to powdery mildew and to enhance phenolic concentration in berry peel [90]. Similar results were also obtained by Faoro et al. [91] with powdery mildew infection on barley.
Carrot leaves treated with seaweed extract (Ascophyllum nodosum) were shown to be less infected by Alternaria and Botrytis due to the activation of defense genes (e.g., PR1, PR5 and PAL), as well as to an increased activity of defense enzymes and accumulation of phenols and phytoalexins [92]. Polysaccharides in seaweed extracts could be considered signaling molecules because they activate salicylic acid (SA) and the jasmonic acid (JA) signaling pathway, promoting the systemic acquired (SAR) and the induced systemic resistance (ISR) in treated plants [48]. Marine polysaccharides such as alginates, fucans and laminarin, which are components of the brown seaweed extract utilized, could have contributed to enhance plant defenses. The mechanism of action of alfalfa protein hydrolysate against diseases probably involves the complex biochemical composition of the hydrolysate. In further detail, two main categories of APH components such as peptides and amino acids are to be considered signaling molecules [93,94,95]. Cappelletti et al. [96] observed a reduced infection by powdery mildew in zucchini plants treated with different protein hydrolysates. The authors explained this result with the involvement of amino acids and peptides in the regulation of innate immune response in plants.

5. Conclusions

The effectiveness of natural products in the control of grey mold and powdery mildew was evaluated in this experiment. Essential oils showed an effect similar to that of synthetic fungicide both against B. cinerea and P. aphanis, significantly reducing the incidence and severity of infections. The highest defense-related gene expression level was induced by BTH application, even though only the incidence of powdery mildew was reduced in those treated plants. As for the other foliar applications (seaweed extract, alfalfa protein hydrolysate and chitosan), they were also demonstrated to be valid alternatives to fungicides against powdery mildew. In our experimental conditions, the effect of essential oils was primarily due to their fungicidal activity. However, in comparison to synthetic fungicides, essential oils may pose a minor risk of resistance development in the pathogen population. In fact, differently from chemical fungicides, essential oils exert several synergic antimicrobial actions [97].
Appropriate application methods (dosages, type of formulation, time and number of application) seem to be of great relevance to improve the efficiency of this group of products. Therefore, further investigations should be carried out in this direction.

Author Contributions

S.S. investigation, data analysis, writing—original draft preparation; C.A. supervision, conceptualization, writing—review and editing; A.C., I.D. and G.B. molecular, pathological and biochemical analysis and experimental design, formal analysis; F.S. supervision, conceptualization, formal analysis, manuscript writing and revisions. All authors have read and agreed to the published version of the manuscript.

Funding

This research was co-founded by the Free University of Bozen-Bolzano (Project BIO_TOOL TN 1B07). S.S. was funded by a Ph.D. grant from the Free University of Bozen-Bolzano.

Data Availability Statement

The original contributions presented in the study are available upon request, further inquiries can be directed to the corresponding author/s.

Acknowledgments

The authors would like to thank the Laimburg Research Centre for providing the experimental site where this study was conducted.

Conflicts of Interest

The authors declare that this research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. FAOSTAT. Available online: http://www.fao.org/faostat/en/#data/QC (accessed on 20 October 2022).
  2. IndexBox, Inc. EU—Strawberries—Market Analysis, Forecast, Size, Trends and Insights; IndexBox, Inc.: Luxembourg, 2021. [Google Scholar]
  3. van der Wolf, J.M.; Evenhuis, A.; Kastelein, P.; Krijger, M.C.; Funke, V.Z.; van den Berg, W.; Moene, A.F. Risks for Infection of Strawberry Plants with an Aerosolized Inoculum of Xanthomonas fragariae. Eur. J. Plant Pathol. 2018, 152, 711–722. [Google Scholar] [CrossRef] [PubMed]
  4. Nguyen, T.T.; Rosello, C.; Bélanger, R.; Ratti, C. Fate of Residual Pesticides in Fruit and Vegetable Waste (FVW) Processing. Foods 2020, 9, 1468. [Google Scholar] [CrossRef]
  5. Kim, J.-O.; Shin, J.-H.; Gumilang, A.; Chung, K.; Choi, K.Y.; Kim, K.S. Effectiveness of Different Classes of Fungicides on Botrytis cinerea Causing Gray Mold on Fruit and Vegetables. Plant Pathol. J. 2016, 32, 570–574. [Google Scholar] [CrossRef]
  6. Aktar, W.; Sengupta, D.; Chowdhury, A. Impact of Pesticides Use in Agriculture: Their Benefits and Hazards. Interdiscip. Toxicol. 2009, 2, 1–12. [Google Scholar] [CrossRef]
  7. Wightwick, A.; Walters, R.; Allinson, G.; Reichman, S.; Menzies, N. Environmental Risks of Fungicides Used in Horticultural Production Systems. In Fungicides; InTech: Rijeka, Croatia, 2010. [Google Scholar]
  8. Hukkanen, A.T.; Kokko, H.I.; Buchala, A.J.; McDougall, G.J.; Stewart, D.; Kärenlampi, S.O.; Karjalainen, R.O. Benzothiadiazole Induces the Accumulation of Phenolics and Improves Resistance to Powdery Mildew in Strawberries. J. Agric. Food Chem. 2007, 55, 1862–1870. [Google Scholar] [CrossRef] [PubMed]
  9. Elad, Y.; Malathrakis, N.E.; Dik, A.J. Biological Control of Botrytis-Incited Diseases and Powdery Mildews in Greenhouse Crops. Crop Prot. 1996, 15, 229–240. [Google Scholar] [CrossRef]
  10. Sylla, J.; Alsanius, B.W.; Krüger, E.; Becker, D.; Wohanka, W. In Vitro Compatibility of Microbial Agents for Simultaneous Application to Control Strawberry Powdery Mildew (Podosphaera aphanis). Crop Prot. 2013, 51, 40–47. [Google Scholar] [CrossRef]
  11. EUROSTAT. European Statistics. Agri-Environmental Indicator—Consumption of Pesticides; EUROSTAT: Luxembourg, 2021. [Google Scholar]
  12. EUROSTAT. Statistics on Agricultural Use of Pesticides in the EU; EUROSTAT: Luxembourg, 2019. [Google Scholar]
  13. EEA. How Pesticides Impact Human Health and Ecosystems in Europe (Briefing No. 06/2023); The European Environment Agency (EEA): Copenhagen, Denmark, 2023. [Google Scholar]
  14. EFSA. The 2019 European Union Report on Pesticide Residues in Food. EFSA J. 2021, 19, e06491. [Google Scholar] [CrossRef]
  15. Cernava, T.; Erlacher, A.; Soh, J.; Sensen, C.W.; Grube, M.; Berg, G. Enterobacteriaceae Dominate the Core Microbiome and Contribute to the Resistome of Arugula (Eruca sativa Mill.). Microbiome 2019, 7, 13. [Google Scholar] [CrossRef]
  16. Sangiorgio, D.; Cellini, A.; Donati, I.; Ferrari, E.; Tanunchai, B.; Fareed Mohamed Wahdan, S.; Sadubsarn, D.; Farneti, B.; Checcucci, A.; Buscot, F.; et al. Taxonomical and Functional Composition of Strawberry Microbiome Is Genotype-Dependent. Adv. Plant Genet. Genom. 2022, 42, 189–204. [Google Scholar] [CrossRef]
  17. Borges, A.A.; Sandalio, L.M. Induced Resistance for Plant Defense. Front. Plant Sci. 2015, 6, 109. [Google Scholar] [CrossRef]
  18. Romanazzi, G.; Sanzani, S.M.; Bi, Y.; Tian, S.; Gutiérrez Martínez, P.; Alkan, N. Induced Resistance to Control Postharvest Decay of Fruit and Vegetables. Postharvest Biol. Technol. 2016, 122, 82–94. [Google Scholar] [CrossRef]
  19. Terry, L. Elicitors of Induced Disease Resistance in Postharvest Horticultural Crops: A Brief Review. Postharvest Biol. Technol. 2004, 32, 1–13. [Google Scholar] [CrossRef]
  20. Reglinski, T.; Vanneste, J.; Wurms, K.; Gould, E.; Spinelli, F.; Rikkerink, E. Using Fundamental Knowledge of Induced Resistance to Develop Control Strategies for Bacterial Canker of Kiwifruit Caused by Pseudomonas syringae pv. actinidiae. Front. Plant Sci. 2013, 4, 24. [Google Scholar] [CrossRef]
  21. Phuntumart, V.; Marro, P.; Métraux, J.-P.; Sticher, L. A Novel Cucumber Gene Associated with Systemic Acquired Resistance. Plant Sci. 2006, 171, 555–564. [Google Scholar] [CrossRef]
  22. Kazan, K.; Lyons, R. Intervention of Phytohormone Pathways by Pathogen Effectors. Plant Cell 2014, 26, 2285–2309. [Google Scholar] [CrossRef]
  23. Mishina, T.E.; Zeier, J. The Arabidopsis Flavin-Dependent Monooxygenase FMO1 Is an Essential Component of Biologically Induced Systemic Acquired Resistance. Plant Physiol. 2006, 141, 1666–1675. [Google Scholar] [CrossRef] [PubMed]
  24. Shukla, P.S.; Borza, T.; Critchley, A.T.; Prithiviraj, B. Carrageenans from Red Seaweeds As Promoters of Growth and Elicitors of Defense Response in Plants. Front. Mar. Sci. 2016, 3, 81. [Google Scholar] [CrossRef]
  25. Amil-Ruiz, F.; Garrido-Gala, J.; Gadea, J.; Blanco-Portales, R.; Muñoz-Mérida, A.; Trelles, O.; de los Santos, B.; Arroyo, F.T.; Aguado-Puig, A.; Romero, F.; et al. Partial Activation of SA- and JA-Defensive Pathways in Strawberry upon Colletotrichum acutatum Interaction. Front. Plant Sci. 2016, 7, 1036. [Google Scholar] [CrossRef]
  26. Cui, H.; Gobbato, E.; Kracher, B.; Qiu, J.; Bautor, J.; Parker, J.E. A Core Function of EDS1 with PAD4 Is to Protect the Salicylic Acid Defense Sector in Arabidopsis Immunity. New Phytol. 2017, 213, 1802–1817. [Google Scholar] [CrossRef]
  27. Carr, J.P.; Lewsey, M.G.; Palukaitis, P. Chapter 3—Signaling in Induced Resistance. In Advances in Virus Research; Carr, J.P., Loebenstein, G., Eds.; Academic Press: Cambridge, MA, USA, 2010; Volume 76, pp. 57–121. ISBN 0065-3527. [Google Scholar]
  28. Ebrahim, S.; Usha, K.; Singh, B. Pathogenesis Related (PR) Proteins in Plant Defense Mechanism. Sci. Microb. Pathog. 2011, 2, 1043–1054. [Google Scholar]
  29. Chernin, L.; Glick, B.R. The Use of ACC Deaminase to Increase the Tolerance of Plants to Various Phytopathogens. In Bacteria in Agrobiology: Stress Management; Maheshwari, D.K., Ed.; Springer: Berlin/Heidelberg, Germany, 2012; pp. 279–299. ISBN 978-3-642-23465-1. [Google Scholar]
  30. Pieterse, C.M.J.; Van Pelt, J.A.; Ton, J.; Parchmann, S.; Mueller, M.J.; Buchala, A.J.; Métraux, J.-P.; Van Loon, L.C. Rhizobacteria-Mediated Induced Systemic Resistance (ISR) in Arabidopsis Requires Sensitivity to Jasmonate and Ethylene but Is Not Accompanied by an Increase in Their Production. Physiol. Mol. Plant Pathol. 2000, 57, 123–134. [Google Scholar] [CrossRef]
  31. Turner, J.G.; Ellis, C.; Devoto, A. The Jasmonate Signal Pathway. Plant Cell 2002, 14, S153–S164. [Google Scholar] [CrossRef]
  32. Creelman, R.A.; Mullet, J.E. Biosynthesis and Action of Jasmonates in Plants. Annu. Rev. Plant Biol. 1997, 48, 355–381. [Google Scholar] [CrossRef]
  33. Vellosillo, T.; Aguilera, V.; Marcos, R.; Bartsch, M.; Vicente, J.; Cascon, T.; Hamberg, M.; Castresana, C. Defense Activated by 9-Lipoxygenase-Derived Oxylipins Requires Specific Mitochondrial Proteins. Plant Physiol. 2013, 161, 617–627. [Google Scholar] [CrossRef] [PubMed]
  34. Iriti, M.; Rossoni, M.; Borgo, M.; Ferrara, L.; Faoro, F. Induction of Resistance to Gray Mold with Benzothiadiazole Modifies Amino Acid Profile and Increases Proanthocyanidins in Grape: Primary versus Secondary Metabolism. J. Agric. Food Chem. 2005, 53, 9133–9139. [Google Scholar] [CrossRef] [PubMed]
  35. Korkina, L.G. Phenylpropanoids as Naturally Occurring Antioxidants: From Plant Defense to Human Health. Cell. Mol. Biol. 2007, 53, 15–25. [Google Scholar]
  36. Mikulic-Petkovsek, M.; Schmitzer, V.; Jakopic, J.; Cunja, V.; Veberic, R.; Munda, A.; Stampar, F. Phenolic Compounds as Defence Response of Pepper Fruits to Colletotrichum coccodes. Physiol. Mol. Plant Pathol. 2013, 84, 138–145. [Google Scholar] [CrossRef]
  37. Ruiz-García, Y.; Gómez-Plaza, E. Elicitors: A Tool for Improving Fruit Phenolic Content. Agriculture 2013, 3, 33–52. [Google Scholar] [CrossRef]
  38. Sivankalyani, V.; Feygenberg, O.; Diskin, S.; Wright, B.; Alkan, N. Increased Anthocyanin and Flavonoids in Mango Fruit Peel Are Associated with Cold and Pathogen Resistance. Postharvest Biol. Technol. 2016, 111, 132–139. [Google Scholar] [CrossRef]
  39. Boubakri, H.; Poutaraud, A.; Wahab, M.A.; Clayeux, C.; Baltenweck-Guyot, R.; Steyer, D.; Marcic, C.; Mliki, A.; Soustre-Gacougnolle, I. Thiamine Modulates Metabolism of the Phenylpropanoid Pathway Leading to Enhanced Resistance to Plasmopara Viticolain Grapevine. BMC Plant Biol. 2013, 13, 31. [Google Scholar] [CrossRef] [PubMed]
  40. Cluzet, S.; Torregrosa, C.; Jacquet, C.; Lafitte, C.; Fournier, J.; Mercier, L.; Salamagne, S.; Briand, X.; Esquerre’-Tugaye’, M.-T.; Dumas, B. Gene Expression Profiling and Protection of Medicago Truncatula against a Fungal Infection in Response to an Elicitor from Green Algae Ulva spp. Plant Cell Environ. 2004, 27, 917–928. [Google Scholar] [CrossRef]
  41. Badawy, M.E.I.; Rabea, E.I. Potential of the Biopolymer Chitosan with Different Molecular Weights to Control Postharvest Gray Mold of Tomato Fruit. Postharvest Biol. Technol. 2009, 51, 110–117. [Google Scholar] [CrossRef]
  42. Ali, A.; Mohamed, M.T.M.; Siddiqui, Y. Control of Anthracnose by Chitosan through Stimulation of Defence-Related Enzymes in Eksotika II Papaya (Carica papaya L.) Fruit. J. Biol. Life Sci. 2012, 3, 114–126. [Google Scholar] [CrossRef]
  43. Meng, X.; Tian, S. Effects of Preharvest Application of Antagonistic Yeast Combined with Chitosan on Decay and Quality of Harvested Table Grape Fruit. J. Sci. Food Agric. 2009, 89, 1838–1842. [Google Scholar] [CrossRef]
  44. El Hadrami, A.; Adam, L.R.; El Hadrami, I.; Daayf, F. Chitosan in Plant Protection. Mar. Drugs 2010, 8, 968–987. [Google Scholar] [CrossRef] [PubMed]
  45. Calvo, P.; Nelson, L.; Kloepper, J.W. Agricultural Uses of Plant Biostimulants. Plant Soil 2014, 383, 3–41. [Google Scholar] [CrossRef]
  46. Khan, W.; Rayirath, U.P.; Subramanian, S.; Jithesh, M.N.; Rayorath, P.; Hodges, D.M.; Critchley, A.T.; Craigie, J.S.; Norrie, J.; Prithiviraj, B. Seaweed Extracts as Biostimulants of Plant Growth and Development. J. Plant Growth Regul. 2009, 28, 386–399. [Google Scholar] [CrossRef]
  47. Sivasankari, S.; Venkatesalu, V.; Anantharaj, M.; Chandrasekaran, M. Effect of Seaweed Extracts on the Growth and Biochemical Constituents of Vigna Sinensis. Bioresour. Technol. 2006, 97, 1745–1751. [Google Scholar] [CrossRef]
  48. Vera, J.; Castro, J.; Gonzalez, A.; Moenne, A. Seaweed Polysaccharides and Derived Oligosaccharides Stimulate Defense Responses and Protection against Pathogens in Plants. Mar. Drugs 2011, 9, 2514–2525. [Google Scholar] [CrossRef]
  49. Elmer, P.A.G.; Reglinski, T. Biosuppression of Botrytis cinerea in Grapes. Plant Pathol. 2006, 55, 155–177. [Google Scholar] [CrossRef]
  50. Klarzynski, O.; Descamps, V.; Plesse, B.; Yvin, J.-C.; Kloareg, B.; Fritig, B. Sulfated Fucan Oligosaccharides Elicit Defense Responses in Tobacco and Local and Systemic Resistance against Tobacco Mosaic Virus. Mol. Plant Microbe Interact. 2003, 16, 115–122. [Google Scholar] [CrossRef] [PubMed]
  51. Stadnik, M.J.; Freitas, M.B. de Algal Polysaccharides as Source of Plant Resistance Inducers. Trop. Plant Pathol. 2014, 39, 111–118. [Google Scholar] [CrossRef]
  52. Schaafsma, G. Safety of Protein Hydrolysates, Fractions Thereof and Bioactive Peptides in Human Nutrition. Eur. J. Clin. Nutr. 2009, 63, 1161. [Google Scholar] [CrossRef]
  53. Ertani, A.; Sambo, P.; Nicoletto, C.; Santagata, S.; Schiavon, M.; Nardi, S. The Use of Organic Biostimulants in Hot Pepper Plants to Help Low Input Sustainable Agriculture. Chem. Biol. Technol. Agric. 2015, 2, 11. [Google Scholar] [CrossRef]
  54. Matsubayashi, Y.; Sakagami, Y. Peptide Hormones in Plants. Annu. Rev. Plant Biol. 2006, 57, 649–674. [Google Scholar] [CrossRef]
  55. Rouphael, Y.; Colla, G.; Giordano, M.; El-Nakhel, C.; Kyriacou, M.C.; De Pascale, S. Foliar Applications of a Legume-Derived Protein Hydrolysate Elicit Dose-Dependent Increases of Growth, Leaf Mineral Composition, Yield and Fruit Quality in Two Greenhouse Tomato Cultivars. Sci. Hortic. 2017, 226, 353–360. [Google Scholar] [CrossRef]
  56. Boubaker, H.; Karim, H.; El Hamdaoui, A.; Msanda, F.; Leach, D.; Bombarda, I.; Vanloot, P.; Abbad, A.; Boudyach, E.H.; Ait Ben Aoumar, A. Chemical Characterization and Antifungal Activities of Four Thymus Species Essential Oils against Postharvest Fungal Pathogens of Citrus. Ind. Crops Prod. 2016, 86, 95–101. [Google Scholar] [CrossRef]
  57. Cindi, M.D.; Soundy, P.; Romanazzi, G.; Sivakumar, D. Different Defense Responses and Brown Rot Control in Two Prunus Persica Cultivars to Essential Oil Vapours after Storage. Postharvest Biol. Technol. 2016, 119, 9–17. [Google Scholar] [CrossRef]
  58. Soppelsa, S.; Van Hemelrijck, W.; Bylemans, D.; Andreotti, C. Essential Oils and Chitosan Applications to Protect Apples against Postharvest Diseases and to Extend Shelf Life. Agronomy 2023, 13, 822. [Google Scholar] [CrossRef]
  59. Farzaneh, M.; Kiani, H.; Sharifi, R.; Reisi, M.; Hadian, J. Chemical Composition and Antifungal Effects of Three Species of Satureja (S. hortensis, S. spicigera, and S. khuzistanica) Essential Oils on the Main Pathogens of Strawberry Fruit. Postharvest Biol. Technol. 2015, 109, 145–151. [Google Scholar] [CrossRef]
  60. Ben-Jabeur, M.; Ghabri, E.; Myriam, M.; Hamada, W. Thyme Essential Oil as a Defense Inducer of Tomato against Gray Mold and Fusarium Wilt. Plant Physiol. Biochem. 2015, 94, 35–40. [Google Scholar] [CrossRef]
  61. de Lira Mota, K.; de Oliveira Pereira, F.; de Oliveira, W.; Lima, I.; de Oliveira Lima, E. Antifungal Activity of Thymus Vulgaris L. Essential Oil and Its Constituent Phytochemicals against Rhizopus oryzae: Interaction with Ergosterol. Molecules 2012, 17, 14418–14433. [Google Scholar] [CrossRef]
  62. Wu, Y.-X.; Zhang, Y.-D.; Li, N.; Wu, D.-D.; Li, Q.-M.; Chen, Y.-Z.; Zhang, G.-C.; Yang, J. Inhibitory Effect and Mechanism of Action of Juniper Essential Oil on Gray Mold in Cherry Tomatoes. Front. Microbiol. 2022, 13, 1000526. [Google Scholar] [CrossRef]
  63. Maia, A.J.; Oliveira, J.S.B.; Schwan-Estrada, K.R.F.; Faria, C.M.R.; Batista, A.F.; Costa, W.F.; Batista, B.N. The Control of Isariopsis Leaf Spot and Downy Mildew in Grapevine cv. Isabel with the Essential Oil of Lemon Grass and the Activity of Defensive Enzymes in Response to the Essential Oil. Crop Prot. 2014, 63, 57–67. [Google Scholar] [CrossRef]
  64. Soppelsa, S.; Kelderer, M.; Casera, C.; Bassi, M.; Robatscher, P.; Matteazzi, A.; Andreotti, C. Foliar Applications of Biostimulants Promote Growth, Yield and Fruit Quality of Strawberry Plants Grown under Nutrient Limitation. Agronomy 2019, 9, 483. [Google Scholar] [CrossRef]
  65. Bulger, M.A.; Ellis, M.A.; Madden, L.V. Influence of Temperature and Wetness Duration on Infection of Strawberry Flowers by Botrytis cinerea and Disease Incidence of Fruit Originating from Infected. Am. Phytopathol. Soc. 1987, 77, 1225–1230. [Google Scholar] [CrossRef]
  66. Wang, S.Y.; Tzeng, D.D.-S. Methionine-Riboflavin Mixtures with Surfactants and Metal Ions Reduce Powdery Mildew Infection in Strawberry Plants. J. Am. Soc. Hortic. Sci. 1998, 123, 987–991. [Google Scholar] [CrossRef]
  67. Meyers, K.J.; Watkins, C.B.; Pritts, M.P.; Liu, R.H. Antioxidant and Antiproliferative Activities of Strawberries. J. Agric. Food Chem. 2003, 51, 6887–6892. [Google Scholar] [CrossRef]
  68. Wolfe, K.; Wu, X.; Liu, R.H. Antioxidant Activity of Apple Peels. J. Agric. Food Chem. 2003, 51, 609–614. [Google Scholar] [CrossRef]
  69. Cellini, A.; Buriani, G.; Rocchi, L.; Rondelli, E.; Savioli, S.; Rodriguez Estrada, M.T.; Cristescu, S.M.; Costa, G.; Spinelli, F. Biological Relevance of Volatile Organic Compounds Emitted during the Pathogenic Interactions between Apple Plants and Erwinia amylovora. Mol. Plant Pathol. 2017, 19, 158–168. [Google Scholar] [CrossRef] [PubMed]
  70. Hammer, K.A.; Carson, C.F. Antibacterial and Antifungal Activities of Essential Oils. In Lipids and Essential Oils as Antimicrobial Agents; Thormar, H., Ed.; John Wiley & Sons, Ltd.: Chichester, UK, 2010. [Google Scholar]
  71. Sivakumar, D.; Bautista-Baños, S. A Review on the Use of Essential Oils for Postharvest Decay Control and Maintenance of Fruit Quality during Storage. Crop Prot. 2014, 64, 27–37. [Google Scholar] [CrossRef]
  72. Bhatia, R.; Shreaz, S.; Khan, N.; Muralidhar, S.; Basir, S.F.; Manzoor, N.; Khan, L.A. Proton Pumping ATPase Mediated Fungicidal Activity of Two Essential Oil Components. J. Basic Microbiol. 2011, 52, 504–512. [Google Scholar] [CrossRef]
  73. Freiesleben, S.H.; Jager, A. Correlation between Plant Secondary Metabolites and Their Antifungal Mechanisms—A Review. Med. Aromat. Plants 2014, 3. [Google Scholar] [CrossRef]
  74. Ghannoum, M.A.; Rice, L.B. Antifungal Agents: Mode of Action, Mechanisms of Resistance, and Correlation of These Mechanisms with Bacterial Resistance. Clin. Microbiol. Rev. 1999, 12, 501–517. [Google Scholar] [CrossRef]
  75. Li, D.; Calderone, R. Exploiting Mitochondria as Targets for the Development of New Antifungals. Virulence 2017, 8, 159–168. [Google Scholar] [CrossRef]
  76. Nazzaro, F.; Fratianni, F.; Coppola, R.; Feo, V.D. Essential Oils and Antifungal Activity. Pharmaceuticals 2017, 10, 86. [Google Scholar] [CrossRef]
  77. Tian, J.; Ban, X.; Zeng, H.; He, J.; Chen, Y.; Wang, Y. The Mechanism of Antifungal Action of Essential Oil from Dill (Anethum graveolens L.) on Aspergillus flavus. PLoS ONE 2012, 7, e30147. [Google Scholar] [CrossRef]
  78. Benhamou, N.; Bélanger, R.R. Benzothiadiazole-Mediated Induced Resistance to Fusarium oxysporum f. sp. radicis-lycopersici in Tomato. Plant Physiol. 1998, 118, 1203–1212. [Google Scholar] [CrossRef]
  79. Hien Dao, T.T.; Puig, R.C.; Kim, H.K.; Erkelens, C.; Lefeber, A.W.M.; Linthorst, H.J.M.; Choi, Y.H.; Verpoorte, R. Effect of Benzothiadiazole on the Metabolome of Arabidopsis thaliana. Plant Physiol. Biochem. 2009, 47, 146–152. [Google Scholar] [CrossRef]
  80. Liu, H.; Jiang, W.; Bi, Y.; Luo, Y. Postharvest BTH Treatment Induces Resistance of Peach (Prunus persica L. cv. Jiubao) Fruit to Infection by Penicillium Expansum and Enhances Activity of Fruit Defense Mechanisms. Postharvest Biol. Technol. 2005, 35, 263–269. [Google Scholar] [CrossRef]
  81. Skłodowska, M.; Gajewska, E.; Kuźniak, E.; Mikiciński, A.; Sobiczewski, P. BTH-Mediated Antioxidant System Responses in Apple Leaf Tissues. Sci. Hortic. 2010, 125, 34–40. [Google Scholar] [CrossRef]
  82. Terry, L.A.; Joyce, D.C. Suppression of Grey Mould on Strawberry Fruit with the Chemical Plant Activator Acibenzolar. Pest Manag. Sci. Former. Pestic. Sci. 2000, 56, 989–992. [Google Scholar] [CrossRef]
  83. Zhu, Y.J.; Qiu, X.; Moore, P.H.; Borth, W.; Hu, J.; Ferreira, S.; Albert, H.H. Systemic Acquired Resistance Induced by BTH in Papaya. Physiol. Mol. Plant Pathol. 2003, 63, 237–248. [Google Scholar] [CrossRef]
  84. Cellini, A.; Fiorentini, L.; Buriani, G.; Yu, J.; Donati, I.; Cornish, D.A.; Novak, B.; Costa, G.; Vanneste, J.L.; Spinelli, F. Elicitors of the Salicylic Acid Pathway Reduce Incidence of Bacterial Canker of Kiwifruit Caused by Pseudomonas syringae pv. actinidae. Ann. Appl. Biol. 2014, 165, 441–453. [Google Scholar] [CrossRef]
  85. Bokshi, A.I.; Jobling, J.; McConchie, R. A Single Application of Milsana® Followed by Bion® Assists in the Control of Powdery Mildew in Cucumber and Helps Overcome Yield Losses. J. Hortic. Sci. Biotechnol. 2008, 83, 701–706. [Google Scholar] [CrossRef]
  86. Wei, Y.; Wei, Y.; Xu, F.; Shao, X. The Combined Effects of Tea Tree Oil and Hot Air Treatment on the Quality and Sensory Characteristics and Decay of Strawberry. Postharvest Biol. Technol. 2018, 136, 139–144. [Google Scholar] [CrossRef]
  87. Soppelsa, S.; Kelderer, M.; Testolin, R.; Zanotelli, D.; Andreotti, C. Effect of Biostimulants on Apple Quality at Harvest and After Storage. Agronomy 2020, 10, 1214. [Google Scholar] [CrossRef]
  88. Sturchio, E.; Donnarumma, L.; Annesi, T.; Milano, F.; Casorri, L.; Masciarelli, E.; Zanellato, M.; Meconi, C.; Boccia, P. Essential Oils: An Alternative Approach to Management of Powdery Mildew Diseases. Phytopathol. Mediterr. 2014, 53, 385–395. [Google Scholar]
  89. Mostafa, Y.S.; Hashem, M.; Alshehri, A.M.; Alamri, S.; Eid, E.M.; Ziedan, E.-S.H.E.; Alrumman, S.A. Effective Management of Cucumber Powdery Mildew with Essential Oils. Agriculture 2021, 11, 1177. [Google Scholar] [CrossRef]
  90. Iriti, M.; Vitalini, S.; Di Tommaso, G.; D’Amico, S.; Borgo, M.; Faoro, F. New Chitosan Formulation Prevents Grapevine Powdery Mildew Infection and Improves Polyphenol Content and Free Radical Scavenging Activity of Grape and Wine. Aust. J. Grape Wine Res. 2011, 17, 263–269. [Google Scholar] [CrossRef]
  91. Faoro, F.; Maffi, D.; Cantu, D.; Iriti, M. Chemical-Induced Resistance against Powdery Mildew in Barley: The Effects of Chitosan and Benzothiadiazole. BioControl 2008, 53, 387–401. [Google Scholar] [CrossRef]
  92. Jayaraj, J.; Wan, A.; Rahman, M.; Punja, Z.K. Seaweed Extract Reduces Foliar Fungal Diseases on Carrot. Crop Prot. 2008, 27, 1360–1366. [Google Scholar] [CrossRef]
  93. Franssen, H.J.; Bisseling, T. Peptide Signaling in Plants. Proc. Natl. Acad. Sci. USA 2001, 98, 12855–12856. [Google Scholar] [CrossRef]
  94. Lindsey, K.; Casson, S.; Chilley, P. Peptides: New Signalling Molecules in Plants. Trends Plant Sci. 2002, 7, 78–83. [Google Scholar] [CrossRef] [PubMed]
  95. Sonawala, U.; Dinkeloo, K.; Danna, C.H.; McDowell, J.M.; Pilot, G. Review: Functional Linkages between Amino Acid Transporters and Plant Responses to Pathogens. Plant Sci. 2018, 277, 79–88. [Google Scholar] [CrossRef]
  96. Cappelletti, M.; Perazzolli, M.; Nesler, A.; Giovannini, O.; Pertot, I. The Effect of Hydrolysis and Protein Source on the Efficacy of Protein Hydrolysates as Plant Resistance Inducers against Powdery Mildew. J. Bioprocess. Biotech. 2017, 7, 1000306.1–1000306.10. [Google Scholar] [CrossRef]
  97. Burt, S. Essential Oils: Their Antibacterial Properties and Potential Applications in Foods—A Review. Int. J. Food Microbiol. 2004, 94, 223–253. [Google Scholar] [CrossRef]
Horticulturae 10 01044 g001
Figure 1. Climatic conditions: average daily temperature (T °C) and relative humidity (RH %) in the greenhouse during the experimental period.
Figure 1. Climatic conditions: average daily temperature (T °C) and relative humidity (RH %) in the greenhouse during the experimental period.
Horticulturae 10 01044 g001
Horticulturae 10 01044 g002
Figure 2. Incidence of flowers affected by natural infections by Botrytis cinerea at the end of harvest (56 days after flowering; Experiment 1). Different letters at the top of each bar indicate significant differences among treatments according to LSD test at p < 0.05 (mean ± SE, n = 4). Treatments’ legend: CON, control; FUN, fungicide; BTH, benzothiadiazole; CHI, chitosan; SEA, seaweed extract; APH, alfalfa protein hydrolysate; THY, thyme essential oil; JUN, juniper essential oil.
Figure 2. Incidence of flowers affected by natural infections by Botrytis cinerea at the end of harvest (56 days after flowering; Experiment 1). Different letters at the top of each bar indicate significant differences among treatments according to LSD test at p < 0.05 (mean ± SE, n = 4). Treatments’ legend: CON, control; FUN, fungicide; BTH, benzothiadiazole; CHI, chitosan; SEA, seaweed extract; APH, alfalfa protein hydrolysate; THY, thyme essential oil; JUN, juniper essential oil.
Horticulturae 10 01044 g002
Horticulturae 10 01044 g003
Figure 3. Powdery mildew incidence on strawberry leaves after inoculation (A) and severity at 56 days after inoculation (B). Tested products were applied 7 days before inoculation at BBCH 71 (Experiment 2). Different letters at the top of each bar indicate significant differences among treatments according to LSD test at p < 0.05 (mean ± SE, n = 8). ns: not significant.
Figure 3. Powdery mildew incidence on strawberry leaves after inoculation (A) and severity at 56 days after inoculation (B). Tested products were applied 7 days before inoculation at BBCH 71 (Experiment 2). Different letters at the top of each bar indicate significant differences among treatments according to LSD test at p < 0.05 (mean ± SE, n = 8). ns: not significant.
Horticulturae 10 01044 g003
Horticulturae 10 01044 g004
Figure 4. Powdery mildew incidence on strawberry leaves after inoculation (A) and severity at 56 days after inoculation (B). Tested products were applied 24 h after inoculation at BBCH 73 (Experiment 3). Different letters at the top of each bar indicate significant differences among treatments according to LSD test at p < 0.05 (mean ± SE, n = 8). ns: not significant.
Figure 4. Powdery mildew incidence on strawberry leaves after inoculation (A) and severity at 56 days after inoculation (B). Tested products were applied 24 h after inoculation at BBCH 73 (Experiment 3). Different letters at the top of each bar indicate significant differences among treatments according to LSD test at p < 0.05 (mean ± SE, n = 8). ns: not significant.
Horticulturae 10 01044 g004
Horticulturae 10 01044 g005aHorticulturae 10 01044 g005bHorticulturae 10 01044 g005c
Figure 5. Expression of defense-related genes (FaPR1 (A), FaPR5 (B), FaPR10 (C), FaEDS1 (D) and FaLOX (E)) in strawberry leaves treated with benzothiadiazole, seaweed extracts, chitosan and thyme essential oil. RT-qPCR was performed using FaGPDH2 as housekeeping gene. For gene expression, we adopted the 2(−DDCT) method, in which a ‘0’ fold change corresponds to ‘no change’. Values were normalized to the control at each time point. Data are expressed as mean ± SE.
Figure 5. Expression of defense-related genes (FaPR1 (A), FaPR5 (B), FaPR10 (C), FaEDS1 (D) and FaLOX (E)) in strawberry leaves treated with benzothiadiazole, seaweed extracts, chitosan and thyme essential oil. RT-qPCR was performed using FaGPDH2 as housekeeping gene. For gene expression, we adopted the 2(−DDCT) method, in which a ‘0’ fold change corresponds to ‘no change’. Values were normalized to the control at each time point. Data are expressed as mean ± SE.
Horticulturae 10 01044 g005aHorticulturae 10 01044 g005bHorticulturae 10 01044 g005c
Table 1. Product characteristics and mode of application.
Table 1. Product characteristics and mode of application.
TreatmentNameActive IngredientConcentrationCommercial Name
CONUntreatedwater--
FUNFungicidepenconazole0.25 mL L−1Topas® 200 EW, Syngenta Crop protection, Basel, Switzerland
BTHBenzothiadiazoleacibenzolar-S-methyl0.4 g L−1Bion® 50 WG, Syngenta Crop protection, Basel, Switzerland
CHIChitosan solutionchitosan10 mL L−1ChitoPlant Solution®, Agritalia, Italy
SEASeaweed extract
(Ascophyllum nodosum)		mix of components4 g L−1Experimental product, ILSA S.p.a., Arzignano, Italy
APHAlfalfa protein hydrolysatemix of components4 g L−1Experimental product, ILSA S.p.a., Arzignano, Italy
THYThyme essential oil
(Thymus vulgaris) 		thymol1 mL L−1Essential oil, Vitalis Dr. Joseph, Brunico, Italy
JUNJuniper essential oil
(Juniperus communis) 		α-pinene1 mL L−1Essential oil, Vitalis Dr. Joseph, Brunico, Italy
Table 2. List of primers used for RT-qPCR analysis.
Table 2. List of primers used for RT-qPCR analysis.
Gene NameGene DescriptionForward Primer Sequence
[5′-3′]		Reverse Primer Sequence
[5′-3′]
FaPR1Pathogenesis-related protein 1TGCTAATTCACATTATGGCG GTTAGAGTTGTAATTATAGTAGG
FaPR5Pathogenesis-related protein 5CGATGCCCCTGCTTACAGTTACCCTAAGGATGCCTCGTAATTGCTTCAAGGGCAGAACACAACC
FaPR10Pathogenesis-related protein 10CGAGGAATACAACTAAACCTTGCCGTCTTACAATTTGCCACACATACACCGAAGTG
FaEDS1Enhanced disease susceptibility 1 AAAAGAGAGACTTCAATGCCAATGTGCTTCGTTCTTTGCGTGTCTGTAGTAGTT
FaLOXLipoxygenase CGACGACGACTGGATACACCGCAGGGGAGGTTGGCCGCTGTTTCTTGCACCGTA
FaGAPDH2(housekeeping)CCCAAGTAAGGATGCCCCCATGTTCGTTGGCAAGGGGAGCAAGACAGTTGGTAG
Table 3. Yield parameters (total yield per plant, number of fruits per plant and mean fruit weight) and fruits’ quality attributes as affected by tested products.
Table 3. Yield parameters (total yield per plant, number of fruits per plant and mean fruit weight) and fruits’ quality attributes as affected by tested products.
TreatmentTotal Yield
(kg plant−1)		Number Fruits Plant−1
(N°)		Mean Fruit Weight
(g)		Total Soluble Solids
(°Brix)		Titratable Acidity
(g citric acid L−1)		Total Phenol Content
(mg GAE 100 g−1 DW)
CON0.120 ± 0.002e11.63 ± 0.71de10.62 ± 0.5713.13 ± 0.274.29 ± 0.492139.09 ± 63.54
FUN0.161 ± 0.004a14.00 ± 0.46ab11.57 ± 0.3811.43 ± 0.523.75 ± 0.612602.84 ± 303.15
BTH0.121 ± 0.003de12.00 ± 0.60cde10.21 ± 0.2912.73 ± 1.063.48 ± 0.172250.58 ± 145.74
CHI0.135 ± 0.007c12.38 ± 0.80bcde11.10 ± 0.4811.23 ± 1.622.95 ± 0.332286.84 ± 125.48
SEA0.133 ± 0.003cd13.13 ± 0.90abcd10.44 ± 0.7210.68 ± 0.723.11 ± 0.172204.47 ± 92.48
APH0.127 ± 0.005cde11.25 ± 0.67e11.54 ± 0.5412.53 ± 0.173.24 ± 0.142431.74 ± 57.76
THY0.148 ± 0.003b13.50 ± 0.63abc11.17 ± 0.5511.60 ± 0.693.12 ± 0.242499.77 ± 256.05
JUN0.157 ± 0.005ab14.38 ± 0.32a10.98 ± 0.2611.38 ± 0.362.91 ± 0.142235.11 ± 114.87
Means ± SE within the same column followed by the same letter, do not significantly differ according to LSD test at p < 0.05 (n = 4).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Soppelsa, S.; Cellini, A.; Donati, I.; Buriani, G.; Spinelli, F.; Andreotti, C. Green Alternatives for the Control of Fungal Diseases in Strawberry: In-Field Optimization of the Use of Elicitors, Botanical Extracts and Essential Oils. Horticulturae 2024, 10, 1044. https://doi.org/10.3390/horticulturae10101044

AMA Style

Soppelsa S, Cellini A, Donati I, Buriani G, Spinelli F, Andreotti C. Green Alternatives for the Control of Fungal Diseases in Strawberry: In-Field Optimization of the Use of Elicitors, Botanical Extracts and Essential Oils. Horticulturae. 2024; 10(10):1044. https://doi.org/10.3390/horticulturae10101044

Chicago/Turabian Style

Soppelsa, Sebastian, Antonio Cellini, Irene Donati, Giampaolo Buriani, Francesco Spinelli, and Carlo Andreotti. 2024. "Green Alternatives for the Control of Fungal Diseases in Strawberry: In-Field Optimization of the Use of Elicitors, Botanical Extracts and Essential Oils" Horticulturae 10, no. 10: 1044. https://doi.org/10.3390/horticulturae10101044

APA Style

Soppelsa, S., Cellini, A., Donati, I., Buriani, G., Spinelli, F., & Andreotti, C. (2024). Green Alternatives for the Control of Fungal Diseases in Strawberry: In-Field Optimization of the Use of Elicitors, Botanical Extracts and Essential Oils. Horticulturae, 10(10), 1044. https://doi.org/10.3390/horticulturae10101044

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop