Next Article in Journal
Hydrolase Production via Food Waste Fermentation and Its Application to Enhance Anaerobic Digestion of Sewage Sludge
Next Article in Special Issue
Enhancing Succinic Acid Production by Sequential Adaptation of Selected Basfia succiniciproducens Strains to Arundo donax Hydrolysate
Previous Article in Journal
Optimization of Esterase Production in Solid-State Fermentation of Agricultural Digestate
Previous Article in Special Issue
Dynamic Responses of Streptomyces albulus QLU58 and Its Acid-Tolerant Derivatives to the Autoacidification in ε-Poly-l-Lysine Production
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Adaptive Laboratory Evolution of Bacillus subtilis 168 for Efficient Production of Surfactin Using NH4Cl as a Nitrogen Source

1
College of Biotechnology and Pharmaceutical Engineering, Nanjing Tech University, Nanjing 211816, China
2
College of Food Science and Light Industry, Nanjing Tech University, Nanjing 211816, China
3
Research Institute of Petroleum Engineering and Technology, Sinopec Shengli Oilfield, Dongying 257000, China
*
Author to whom correspondence should be addressed.
Fermentation 2023, 9(6), 525; https://doi.org/10.3390/fermentation9060525
Submission received: 10 May 2023 / Revised: 26 May 2023 / Accepted: 27 May 2023 / Published: 29 May 2023
(This article belongs to the Special Issue Application of Microbial Fermentation in Organic Matter Production)

Abstract

Bacillus subtilis strain 168 is commonly used as a host to produce recombinant proteins and as a chassis for bio-based chemicals production. However, its preferred nitrogen source is organic nitrogen, which greatly increases production costs. In this study, adaptive laboratory evolution (ALE) was used to improve B. subtilis 168 growth using NH4Cl as the sole nitrogen source. The cell density (OD600) of a mutant strain LJ-3 was 208.7% higher than that of the original strain. We also optimized the metal ions in the medium and this resulted in a further increase in growth rate by 151.3%. Reintroduction of the sfp+ gene into strain LJ-3 led to the LJ-31 clone, which restored LJ-3’s ability to synthesize surfactin. The fermentation system was optimized (C/N, aeration, pH) in a 5 L bioreactor. Dry cell weight of 7.4 g/L and surfactin concentration of 4.1 g/L were achieved using the optimized mineral salt medium after 22 h of batch fermentation with a YP/S value of 0.082 g/g and a YP/X of 0.55 g/g. HPLC analysis identified the surfactin isoforms produced by strain LJ-31 in the synthetic medium as C13-surfactin 13.3%, C14-surfactin 44.02%, and C15-surfactin 32.79%. Hence, the variant LJ-3 isolated by ALE is a promising engineering chassis for efficient and cost-effective production of a variety of metabolites.

1. Introduction

In a vast majority of industry-based microbial metabolite production, carbon and nitrogen sources utilized by the microbes to produce raw materials often account for 50–90% of the production costs. Nitrogen sources are either organic or inorganic sources with significant price differences. Organic nitrogen sources are mainly tryptone and yeast extract, which typically cost between USD1800 and 5000/ton, while inorganic nitrogen sources are mainly ammonium salts and nitrates, with prices ranging between USD70 and 150/t. Ammonium chloride is the cheapest inorganic nitrogen source with costs ranging from USD70 to 80/t. Therefore, the price of organic nitrogen sources is usually 35–70 times higher than that of inorganic nitrogen sources and makes up a large proportion of the production costs for industrial microorganisms. Strains that can use ammonium chloride as a nitrogen source efficiently would provide a significant advantage in terms of lowering costs.
Bacillus subtilis 168 is a well-known domesticated strain that exhibits natural genetic competence. This strain has a defined genetic background and is a safe and harmless strain for industrial platforms. As this strain has strong protein expression and secretion abilities, it is widely used for the biosynthesis of enzymes [1], nucleosides [2], antibiotics [3], surfactants [4], lactic acid and isobutanol [5], N-acetylglucosamine [6], and other bio-based chemicals. However, B. subtilis strain 168 has a major disadvantage in that it prefers organic nitrogen (tryptone and yeast extract), which greatly increases production costs. Strains of B. subtilis that can utilize inorganic nitrogen are usually wild-type or parental strains, which are generally not amenable to gene editing. Therefore, the availability of B. subtilis 168, derived from B. subtilis Marburg, that can effectively utilize inorganic nitrogen, is highly desirable. However, not much is known about how B. subtilis, which prefers organic nitrogen, can be converted to efficiently utilize inorganic nitrogen. This may be because nitrogen assimilation is a complex system that is regulated by multiple gene products [7], making it difficult to alter the capacity for nitrogen assimilation by editing one or a few genes.
Adaptive laboratory evolution (ALE) is a narrow-range experimental evolutionary concept that artificially applies stress to stimulate the natural environment and obtain a desired phenotype. ALE was originally used by Dallinger in a 7-year high-temperature adaptation experiment [8]. Since then, ALE was widely used as an efficient tool for biological discovery and industrial biotechnology, such as substrate utilization, growth rate optimization, increasing tolerance, and increasing product yield/titer [9]. In the present study, a variant of B. subtilis 168 that can effectively utilize NH4Cl as a nitrogen source was isolated by ALE. Then, trace metal elements in the synthesis medium were optimized to further increase the biomass of the bacteria. Subsequently, the B. subtilis 168 sfp+ variant was created to produce surfactin in the optimized mineral salt medium. At the same time, the composition of the product was further analyzed, as shown in Figure 1.

2. Materials and Methods

2.1. Strains and Primers

The strains, plasmids, and primers used in this study are listed in Table 1 and Table 2.

2.2. Culture Media

The seed medium contained (per L): 10 g tryptone, 5 g yeast extract, and 10 g sodium chloride. ALE medium contained (per L): 20 g sucrose, 50 mM inorganic nitrogen (NaNO3 or NH4Cl), 3 g KH2PO4, 10 g K2HPO4·3H2O, 0.5 g MgSO4·7H2O, and 0.05 g FeSO4·7H2O. Agar (20 g/L) was added to make solid medium. Basic medium components for metal ion optimization contained (per L): 20 g sucrose, 50 mM NH4Cl, 3 g KH2PO4, and 10 g K2HPO4·3H2O; to optimize the metal ions in the synthetic medium, metal ions of different concentrations (mM) were added separately to the base medium: Fe2+ (0, 0.25, 0.5, 0.75, 1, and 1.25), Mn2+ (0, 0.002, 0.01, 0.05, 0.1, and 0.5), Mg2+ (0, 0.5, 1, 2, and 4), Cu2+ (0, 0.05, 0.1, 0.2, and 0.4), Zn2+ (0, 0.05, 0.1, 0.2, and 0.4). The fermentation medium for surfactin in a flask contained (per L): 50 g sucrose, 50 mM NH4Cl, 3 g KH2PO4, 10 g K2HPO4·3H2O, 0.5 mM FeSO4·7H2O, 0.01 mM MnSO4.H2O, and 2 mM MgSO4·7H2O. The fermentation medium for surfactin in a 5 L bioreactor contained (per L): 50 g sucrose, 50–250 mM NH4Cl, 3 g K2HPO4·3H2O, 0.5 mM FeSO4·7H2O, 0.01 mM MnSO4.H2O, 2 mM MgSO4·7H2O, and 1 g of the antifoam agent organic silicone oil. Minimum glycerol medium supplemented with 5 mM p-Cl-Phe (MGY-Cl medium) was the same as that used by Hu [13] et al. Chloramphenicol (5 μg/mL) was used to select transformants when necessary.

2.3. ALE of B. subtilis 168 and Optimization of Metal Ions in Synthetic Medium

B. subtilis 168 variants that use inorganic nitrogen sources efficiently were isolated by ALE. B. subtilis 168 stocks were streaked onto ALE medium plates and incubated for 24 h at 37 °C. Then, several single colonies were picked from the plates, inoculated into 50 mL liquid ALE medium in shake flasks, and incubated for 24 h at 37 °C in a shaker at 200 r/min. After 24 h, the cell density (OD600) was measured, and high cell density cultures were diluted and incubated for 24 h at 37 °C on solid ALE medium plates. The variants were selected by passaging through solid and liquid media over several generations.
To optimize the metal ions in the synthetic medium, metal ions (Fe2+, Mn2+, Mg2+, Cu2+, and Zn2+) of various concentrations (mM) were added separately to the basic medium. The B. subtilis 168 mutant strain (LJ-3) needed to be pre-cultured once. Single colonies were picked from the plates, transferred to 250 mL shake flasks supplemented with 50 mL of seed medium, and incubated for 12 h at 37 °C in a shaker at 200 r/min. Then, the seed culture was transferred to 50 mL basic medium at a 4% (v/v) inoculum and incubated at 37 °C in a shaker at 200 r/min. Cell density and substrate consumption during 30 h of cultivation were measured.

2.4. sfp+ Strain of B. subtilis 168 Variant (LJ-31)

The gene editing approach taken to perform marker-free knock-in gene replacement (Figure 2) was described in detail in our previous work [12,13]. B. subtilis containing the mutant alpha subunit of the phenylalanyl-tRNA synthetase gene (pheS*) will not survive in the presence of 4-chloro-DL-phenylalanine. The mutant gene (pheS*) was inserted within a counter-selectable cassette (containing a chloramphenicol resistance gene (cat) and pheS* gene, and this cassette is referred to as PC). The strains and plasmids are listed in Table 1 and primers listed in Table 2 were used to amplify the following gene fragments: left flanking of sfp gene (LJ-3, LF) (~1000 bp), Pveg strong promoter (B. subtilis 168, Pveg-GFP), insertion gene (B. velezensis BS-37, sfp+), direct repeat (LJ-3, DR) (~400 bp) sequence, counter-selectable cassette (PC), and right flanking of LF (LJ-3,RF) (~800 bp). These fragments were then fused by overlapping PCR in the order LF-Pveg-sfp+-DR-PC-RF. The PCR products were introduced into the LJ-3 and transformants were selected on chloramphenicol and MGY-Cl containing agar plates. The positive transformants were named LJ-31.

2.5. Surfactin Production in Shake Flasks

The LJ-31 strains from a frozen storage tube were picked out, streaked onto the solid seed medium plate, and incubated for 12 h at 37 °C. Single colonies were picked from the plates and inoculated into shake flasks containing 50 mL of seed medium and incubated for 12 h at 37 °C in a shaker at 200 r/min. The fresh cells were transferred to 50 mL of optimized synthetic medium at a 4% (v/v) inoculum and incubated at 37 °C in a shaker at 200 r/min. Cell density, pH, and surfactin concentrations were measured.

2.6. Batch Fermentation for Surfactin Production in a 5L Bioreactor

A pre-culture of strain LJ-31 was set up where cells were inoculated into 50 mL of seed medium, and incubated at 37 °C in a shaker at 200 r/min until the cell density reached OD600 of 3–4. The culture was then inoculated into the bioreactor at a 4% (v/v) inoculum. The working volume of the 5 L bioreactor was 3 L and industrial oxygen was used to replace air. The aeration rate was set to 200 mL/min and the stirring speed was 300 rpm. The pH was regulated with 1 M NaOH and 1 M HCl. Organic silicone oil was used as an antifoam agent at a concentration of 1/1000 (w/v).

2.7. Determination of Surfactin Concentration

Surfactin concentration was determined using the Shimadzu LC-20 (HPLC) SPD-20A detector equipped with a Venus ll XBP C18 column (4.6 × 150 mm, 5 μm) [13]. The mobile phase consisted of 90% (v/v) methanol and 10% (v/v) water, with 0.05% (v/v) formic acid at a flow rate of 0.6 mL/min. The sample size was 20 μL and the absorbance of the eluent was monitored at 214 nm. Pure surfactin (98%) was purchased from Sigma Aldrich (St. Louis, MO, USA).

2.8. Analysis

Sucrose concentration was determined using the Shimadzu LC-20 (HPLC) RID detector equipped with an Aminex HPX-87H, 300 mm × 7.8 mm column (250 mm × 4.6 mm, 5 μm) [14]. The mobile phase was 10 mM sulfuric acid, a column temperature of 30 °C, and a 10 μL injection volume at a flow rate of 0.5 mL/min. NH4+ concentration was determined using a test kit (Quanzhou Ruixin Biotechnology Co., Ltd., Quanzhou, China; item number: RXWB0375-96). Multiple 10 mL cell suspensions were centrifuged and washed with distilled water. The dry cell weight (DCW) of the cell biomass was determined by drying the cell pellet for 24 h at 70 °C to a constant weight.

2.9. Calculation of Dynamic Parameters

The main parameters were sucrose concentration (S, g/L), biomass DCW (X, g/L), and surfactin concentration (P, g/L). The product per substrate (YP/S) and product per biomass (YP/X) were determined at the maximum surfactant concentration using the Equations (1) and (2) [15]. The specific cell growth rate (µ, h−1) and specific surfactin production rate (qp, h−1) were estimated using Equations (3) and (4) based on the experimental or fitted data of cell growth (χ, g/L) [16].
Y P / S = p Δ S P = Pmax
Y P / X = p X P = Pmax
µ = 1 x d x dt = 1 x lim Δ t 0 Δ x Δ t
q p = 1 x d p d t = 1 x lim Δ t 0 Δ p Δ t
Calculation of theoretical yield:
A surfactin molecule contains four leucines, one glutamate, one valine, and one aspartate as well as a long-chain fatty acid. The surfactin synthesized by the LJ-31 strain has three major fatty acid chain lengths: C13-surfactin, C14-surfactin, and C15-surfactin. The average fatty acid length is 14 carbon atoms, and a fatty acid chain containing 14 carbon atoms was the most abundant. Therefore, we normalized the fatty acid chain length to 14 carbon atoms [17]. Thus, surfactin contained about 52 carbons with a relative molecular weight of Msur 1022 [10]. About 5.75 sucrose molecules are required to synthesize one molecule of surfactin.
The theoretical yield: 0.174 mol surfactin/mol sucrose.

3. Results and Discussion

3.1. ALE of B. subtilis 168

Ammonium salts and nitrates are two of the cheapest nitrogen sources, and B. subtilis is a safe, non-toxic strain with strong protein expression and secretion properties. As a cell factory, B. subtilis 168, which can efficiently utilize inorganic nitrogen, is an attractive choice for a host cell to produce functional products. In the present study, random mutants of B. subtilis 168 that efficiently utilized inorganic nitrogen were identified by ALE (Figure 1A). After twenty cycles of adaptive evolution of the parental strain in medium containing NH4+ or NO3, two variants were selected and their capacity for using NH4+ or NO3 was enhanced as expected (Figure 3). The two adapted strains were designated as LJ-2 and LJ-3, respectively. The LJ-2 strain was isolated in ALE medium containing NO3, and the LJ-3 strain was isolated in ALE medium containing NH4+.
As shown in Figure 3, cell density (OD600) of the two variants was measured after five cycles, ten cycles, and twenty cycles (one cycle represents one shift from solid to liquid medium). After twenty cycles of passaging, LJ-2 exhibited an increase in cell density from 2.1 ± 0.14 to 4.2 ± 0.12 (Figure 3A), whereas LJ-3 cell density was more significantly increased from 2.3 ± 0.13 to 7.1 ± 0.19 (Figure 3B). The cell density of LJ-2 and LJ-3 had an overall increase of 100% and 208.7%, respectively, in comparison to their starter strain. It is worth noting that the presence of NH4+ provided a better evolutionary adaptive effect compared to NO3. This may be because ammonium is an important precursor of glutamine and glutamate and is more easily available to the cells via diffusion or by the ammonium transporter (NrgA) [18]. Meanwhile, the poor adaptive evolutionary effect of nitrate may be related to host strain characteristics, ALE medium, or strain generation. Therefore, further studies are needed to isolate B. subtilis 168 that efficiently use nitrate. Overall, the ALE technique is a viable method to improve nitrogen assimilation by B. subtilis 168. The LJ-3 strain was next used as the engineering chassis to introduce the surfactin-encoding gene.

3.2. Effect of Metal Ions on Growth of LJ-3

Cell density and the yield of functional products usually show a positive linear correlation, and therefore, high cell density results in a high yield of functional products [19]. However, production strains that use inorganic nitrogen usually exhibit lower cell density [20]. Trace metal elements are essential for bacterial growth. Metal ions were also essential for bacteria to promote the uptake of NH4+ or NO3 [20,21,22]. To further promote LJ-3 cell growth, the effects of five metal ions (Fe2+, Mn2+, Mg2+, Cu2+, and Zn2+) on cell growth and the utilization of different substrates were examined (Figure 4).
As shown in Figure 4A, Fe2+ could promote the utilization of NH4+ and sucrose as well as cell growth. Fe2+ at 0.05 mM was optimal for LJ-3, and utilization of NH4+ and sucrose after 30 h of culture was 45.2% and 78.16%, respectively. These values were 80.8% and 106.8% higher relative to the control (0 mM Fe2+). In parallel, cell density achieved a reading of 7.41 (OD600), which was an increase of 131.5%. Mn2+ also promoted the utilization of substrates and cell growth (Figure 4B). Interestingly, we noted a significant difference in cell densities over different concentrations of Mn2+ at 30 h. Cell density was high in the presence of low concentrations of Mn2+ (0.002, 0.01, and 0.05 mM), but low cell density was observed with higher concentrations of Mn2+ (0.1, 0.5 mM). We also observed that higher concentrations of Mn2+ tended to accelerate cell senescence during cell growth (Figure 4F), similar to that previously reported by Mei [22] et al. Therefore, a concentration of 0.01 mM Mn2+ was selected to promote the utilization of substrates and cell growth while ensuring cell viability. The utilization of NH4+ and sucrose by LJ-3 in the presence of 0.01 mM Mn2+ over a period of 30 h was 44.4% and 78%, respectively, which were 77.6% and 106.4% higher relative to the control (0 mM Mn2+), and the cell density readout reached 5.5, an increase of 92.2%.
For Mg2+, cell density increased linearly relative to the increase in Mg2+ concentration, which helped to improve the utilization of substrates and cell growth (Figure 4C). However, the high concentrations of Mg2+ tended to precipitate during high-temperature treatment, resulting in the blockage of the gas distributor or difficulty in cleaning the bioreactor. Therefore, 2 mM Mg2+ was chosen (Figure 4C) and the utilization of NH4+ and sucrose at 30 h by LJ-3 was 34.6% and 57.4%, respectively, which were 38.4% and 51.8% higher relative to the control (0 mM Mg2+), while cell density reached 3.7, an increase of 15.6%. However, when different concentrations of Zn2+ were added (Figure 4D), utilization of NH4+ and sucrose as well as cell density did not change significantly compared to the control (0 mM Zn2+). On the other hand, when different concentrations of the Cu2+ were added, the utilization of NH4+ and sucrose as well as cell growth was inhibited (Figure 4E). Cell growth was inhibited at lower concentrations of Cu2+ (0.05 mM). When compared to the control cells (0 mM Mn2+), the utilization of NH4+ and sucrose was reduced by 70% and 53.7%, respectively, and the cell density was reduced by 53.1%.
Taken together, the results indicate that Fe2+, Mn2+, and Mg2+ could promote the uptake of NH4+ and sucrose as well as cell growth, but not Zn2+ and Cu2+. Among them, Fe2+ had the greatest effect, followed by Mn2+ and finally Mg2+. Iron homeostasis in bacteria is maintained by various iron uptake systems, which are indispensable for many key enzymes of the cell, such as ribonucleotide reductases, superoxide dismutases, and various energy-generating and regulatory proteins of heme or iron–sulfur cluster cofactors [23]. Mn2+ and Mg2+ enhance nitrogen assimilation by increasing glutamine synthetase (GS) and glutamate synthetase (GOGAT) activities [21,24,25].
When single metal ions were added, sucrose consumption was approximately 80%, which may eventually be a limiting factor for cell growth. When sucrose concentration was increased to 50 g/L with the addition of metal ions (0.5 mM Fe2+, 0.01 mM Mn2+, and 2 mM Mg2+), LJ-3 cell density (OD600) at 24 h reached 9.36, which was 291.6% higher relative to B. subtilis 168 (OD600 of 2.3) (Figure 5A). The maximum growth rate of LJ-3 was 0.47 h−1 with a lag phase of 7 h and it exhibited a 151.3% increase in growth rate compared with the reference strain (Figure 5B). This result confirmed that when cell growth was limited in media supplemented with NH4+, adding metal ions could promote substrate uptake and cell growth. The combination of ALE technology and metal ion screening and optimization could effectively solve the problem of nitrogen assimilation by certain bacterial hosts, and isolated mutant bacteria can be utilized to produce a variety of bio-based products at a low cost.

3.3. LJ-3 Was Used as Engineering Chassis to Produce Surfactin

Sfp protein (4-phosphopantothionyl transferase) is indispensable for the synthesis of surfactin. Sfp transfers the 4′-phosphopantothionyl moiety of coenzyme A to the serine residue of the peptidyl carrier protein (PCP) module to activate the synthesis of surfactin. However, the sfp gene sequence in B. subtilis 168 contains a termination codon that results in a truncated and inactive Sfp protein [17]. Therefore, in this study, the sfp+ gene from B. velezensis BS-37 [26], a wild-type strain that can produce surfactin efficiently, was transformed into LJ-3 to replace the mutant sfp gene and restore the ability to synthesize surfactin (Figure 2). This transformed strain is henceforth referred to as LJ-31. LJ-31 was incubated in shake flasks and the cell density reached 11.58, which was 23.7% higher relative to LJ-3 (Figure 6A). This confirmed that surfactin synthesis capacity was restored, but the concentration was low at only 0.77 g/L (Figure 6B). In addition, the concentration was depleted to 0.28 g/L at 18–48 h when the pH was maintained between 5 and 6. The culture pH had a significant impact on surfactin production with Bacillus strains [27]. Therefore, the most likely reason for the low yield of surfactin is pH. Hence, verification of the effect of pH on surfactin synthesis requires further studies at the bioreactor level.

3.4. Production of Surfactin by LJ-31 in a Bioreactor

We developed a non-overfoaming fermentation system for surfactin production in a 5 L bioreactor. Industrial oxygen was used to replace air as the gas supply. The initial parameters were set at a working volume of 3 L, aeration volume of 0.06 vvm (oxygen), stirring speed of 300 rpm, and pH 6.5 and organic silicone oil of 1/1000 (w/v) as antifoam agent. The yield of surfactin reached 1.64 g/L at 22 h, which was 113% higher than that in the shake flask (Figure 7A). As shown in Figure 7B, the maximum specific production rate qpmax was 0.2 h−1 at 10 h, and the strain reached the maximum specific growth rate µmax = 0.28 h−1 at 7.5 h, indicating that the strain grew rapidly at 7.5 h, and then initiated synthesis at a very rapid rate at 10 h. At 22 h of fermentation, the product per substrate (YP/S) value was 0.055 g/g, and product per biomass (YP/X) was 0.35 g/g. The surfactin yield reached 18.4 mmol/mol sucrose (10.6% of the theoretical yield). The results indicate that surfactin synthesis was sensitive to pH, and needed to be regulated when NH4Cl was used as a nitrogen source. Therefore, fermentation conditions were further optimized to maximize surfactin production.
Studies showed that C/N, dissolved oxygen, and pH are key factors affecting synthesis of surfactin [27,28,29,30]. We further optimized the C/N, dissolved oxygen, and pH to improve the efficiency of surfactin synthesis. The sucrose content was kept constant at 50 g/L, and the C/N ratio was changed by increasing the nitrogen source. Under the conditions of pH 6.5 and aeration volume of 0.06 vvm, the C/N ratio was set at four gradient values (35/1, 17.51/1, 11.68/1, and 7/1). The results are shown in Table 3, and a suitable ratio of C/N for surfactin synthesis is presented. When NH4Cl was added at 150 mM (C/N 11.68/1), surfactin yields achieved the highest reading of 3.82 g/L, which was 131.5% higher than before optimization (1.65 g/L), and the product per substrate (YP/S) was 0.076 g/g. The dry cell weight (DCW) reached 8.24 g/L, and product per biomass (YP/X) was 0.46 g/g. At this phase, substrate consumption was in a state of carbon source depletion and nitrogen source surplus. However, surfactin amounts decreased by 8.3% (3.5 g/L) and DCW increased by 30.1% (10.72 g/L) when the nitrogen source was increased to 200 mM (C/N 7/1), but the nitrogen source surplus was greater. The excess availability of nitrogen potentially directed the carbon source towards bacterial growth and metabolism. Therefore, the C/N ratio has a significant effect on surfactin synthesis, and an appropriate C/N needs to be regulated.
At a fixed C/N ratio of 11.68/1 and pH 6.5, the aeration volume was optimized. The results show that aeration volume was also a key factor affecting surfactin synthesis. As shown in Table 3, the optimal aeration volume for surfactin production was 0.03 vvm, whereby the surfactin yield reached 4.10 g/L, which was 7.3% higher than that of the control (3.82 g/L) and the DCW was 7.4 g/L, which was a slight decrease of 10.2%, but the residual nitrogen source showed a slight increase of 11.1%. The product per substrate (YP/S) was at 0.082 g/g, and product per biomass (YP/X) was at 0.5 g/g. However, surfactin yield and DCW (1.6 g/L, 6.68 g/L, respectively) decreased sharply under high aeration volume (0.13 vvm), where the values were 58.1% and 18.9% lower than those for the control (3.82 g/L, 8.24 g/L). The yield of surfactin (2.55 g/L) and DCW (6.1 g/L) decreased by 33.2% and 26%, respectively, at the lower aeration volume (0.02 vvm).
As noted above, pH is a key factor affecting the synthesis of surfactin by LJ-31. Hence, the pH was optimized under the conditions of C/N 11.68/1 and aeration volume of 0.03 vvm. The results shown in Table 3 indicate that surfactin synthesis was possible under weak acidic (pH 6.5) conditions. Surfactin synthesis was severely inhibited at a pH below or above 6.5. When pH was maintained at 6, the yield of surfactin decreased sharply by 37.6% compared with that at pH 6.5 (4.1 g/L), and when pH was maintained at 7–7.5, surfactin yield slightly decreased by 6–10%. Therefore, pH has a significant effect on surfactin synthesis, and this finding is similar to the conclusions reported by Cosby et al. [27] and Yi [29] et al.
When all the results are taken together, LJ-31 can effectively synthesize surfactin under the following conditions: C/N ratio of 11.68/1, aeration volume of 0.03 vvm, and pH of 6.5. At these conditions, changes in cell growth, surfactin yield, and kinetic parameters are shown in Figure 8. The product per substrate (YP/S) at 22 h was 0.082 g/g, an increase of 49%, while product per biomass (YP/X) was 0.55 g/g, an increase of 57.1% (Figure 8A). At 10 h, the maximum specific production rate (qpmax) for surfactin was 0.2 h−1. The maximum specific growth rate at 5 h was 0.38 h−1 (Figure 8B) and increased by 35.7%. The surfactin yield reached 27.5 mmol/mol sucrose (15.8% of the theoretical yield). Interestingly, when the pH is maintained at its initial value (pH 6.5), surfactin synthesis was most amenable and the specific growth rate only changed after optimization of the C/N ratio and dissolved oxygen. Therefore, regulation and optimization of the first two conditions (C/N and dissolved oxygen) affected the specific growth rate of the strain, indicating that when the strain is provided with an appropriate growth environment, this accelerates accumulation of the strain (DCW) ahead of initiating protein expression, thus improving strain productivity and increasing the surfactin yield. We suggest that pH affects strain characteristics in terms of surfactin production. When the pH was maintained at 6.5 to eliminate the effect of ammonium chloride, the yield of surfactin was significantly improved (Figure 7A). At the same time, the results provide some ideas for improving the yield of surfactin in the later period of fermentation; for example, modifying the anabolic pathways of the strain, such as the precursor supply module, transcription module, and repressor competition pathway, could improve the yield. Thus, a combination of ALE and genetic engineering techniques can obtain strains with performance advantages.
As shown in Table 4, recombinant strain LJ-31 has a significant advantage compared with most wild-type and commercial bacteria that can use inorganic nitrogen in terms of production or growth performance, while also allowing for gene editing. Overall, B. subtilis 168, a lab strain with a preference for organic nitrogen, was successfully transformed into a chassis strain with efficient utilization of NH4Cl and able to effectively produce surfactin.

3.5. Composition of Surfactin Synthesized by LJ-31

Surfactin components produced from LJ-31 were analyzed by HPLC. As shown in Figure 9, the main components of surfactin synthesized by recombinant strain LJ-31 were the same as the standard surfactin (CAS:24730-31-2; Sigma Company), but the proportion of each component was significantly different. Peaks labeled with a, b, c, and d correspond to (a) C13-surfactin, (b) iso-C14-surfactin, (c) nC14-surfactin, and (d) anteiso-C15-surfactin as identified in our previous work [10,33]. The proportion of surfactin isoforms produced by strain LJ-31 in the synthetic medium was C13-surfactin 13.3% ± 1.5, C14-surfactin 44.02% ± 1.55, and C15-surfactin 32.79% ± 1.6. Our previous work also showed that surfactin with a higher proportion of C14-surfactin had better surface activity, higher oil washing efficiency and better emulsification activity, and improved the water wettability of solid surfaces [10]. Therefore, the recombinant strain LJ-31 produces surfactin at a low cost, and in addition, the synthesized surfactin performs well in its proposed applications.

4. Conclusions

The adaptive laboratory evolution (ALE) can be used to improve B. subtilis 168 growth using NH4Cl as the sole nitrogen source. The variant LJ-3 isolated by ALE is a promising engineering chassis that can efficiently use NH4Cl as the sole nitrogen source. Reintroduction of the sfp gene into strain LJ-3 led to restoring its ability to synthesize surfactin, and the highest surfactin titer reached 4.1 g/L after 22 h fermentation. Our study contributes to producing lower cost surfactin.

Author Contributions

Conceptualization, J.L. and S.L.; methodology, J.L., W.T. and S.L.; formal analysis, J.L., S.Y. and S.L.; investigation, data curation, J.L., W.T., Z.Y. and S.L.; resources, S.Y. and Z.Y.; writing—original draft preparation, J.L. and S.L.; writing—review and editing J.L., W.T., S.L., S.Y. and Z.Y.; supervision, W.T., S.L., S.Y. and Z.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (grant no. 2022YFC2105202) and the Jiangsu Synergetic Innovation Center for Advanced Bio-Manufacture.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The research data are not shared.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Westers, L.; Westers, H.; Quax, W.J. Bacillus subtilis as cell factory for pharmaceutical proteins: A biotechnological approach to optimize the host organism. Biochim. Biophys. Acta-Mol. Cell Res. 2004, 1694, 299–310. [Google Scholar] [CrossRef]
  2. He, L.L.; Liu, L.; Ban, R. Construction of a mutant Bacillus subtilis strain for high purity poly-gamma-glutamic acid production. Biotechnol. Lett. 2022, 44, 991–1000. [Google Scholar] [CrossRef]
  3. Stein, T. Bacillus subtilis antibiotics: Structures, syntheses and specific functions. Mol. Microbiol. 2005, 56, 845–857. [Google Scholar] [CrossRef]
  4. Rahman, F.B.; Sarkar, B.; Moni, R.; Rahman, M.S. Molecular genetics of surfactin and its effects on different sub-populations of Bacillus subtilis. Biotechnol. Rep. 2021, 32, e00686. [Google Scholar] [CrossRef]
  5. Li, S.S.; Huang, D.; Li, Y.; Wen, J.P.; Jia, X.Q. Rational improvement of the engineered isobutanol-producing Bacillus subtilis by elementary mode analysis. Microb. Cell Factories 2012, 11, 101. [Google Scholar] [CrossRef]
  6. Gu, Y.; Deng, J.Y.; Liu, Y.F.; Li, J.H.; Shin, H.D.; Du, G.C.; Chen, J.; Liu, L. Rewiring the glucose transportation and central metabolic pathways for overproduction of N-Acetylglucosamine in Bacillus subtilis. Biotechnol. J. 2017, 12, 1700020. [Google Scholar] [CrossRef]
  7. Mirouze, N.; Bidnenko, E.; Noirot, P.; Auger, S. Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis. Microbiologyopen 2015, 4, 423–435. [Google Scholar] [CrossRef]
  8. Bennett, A.F.; Hughes, B.S. Microbial experimental evolution. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 2009, 297, R17–R25. [Google Scholar] [CrossRef]
  9. Sandberg, T.E.; Salazar, M.J.; Weng, L.L.; Palsson, B.O.; Feist, A.M. The emergence of adaptive laboratory evolution as an efficient tool for biological discovery and industrial biotechnology. Metab. Eng. 2019, 56, 1–16. [Google Scholar] [CrossRef]
  10. Hu, F.X.; Cai, W.J.; Lin, J.Z.; Wang, W.D.; Li, S. Genetic engineering of the precursor supply pathway for the overproduction of the nC(14)-surfactin isoform with promising MEOR applications. Microb. Cell Factories 2021, 20, 96. [Google Scholar] [CrossRef]
  11. Liu, Q.; Lin, J.Z.; Wang, W.D.; Huang, H.; Li, S. Production of surfactin isoforms by Bacillus subtilis BS-37 and its applicability to enhanced oil recovery under laboratory conditions. Biochem. Eng. J. 2015, 93, 31–37. [Google Scholar] [CrossRef]
  12. Zhou, C.Y.; Shi, L.L.; Ye, B.; Feng, H.C.; Zhang, J.; Zhang, R.F.; Yan, X. pheS*, an effective host-genotype-independent counter-selectable marker for marker-free chromosome deletion in Bacillus amyloliquefaciens. Appl. Microbiol. Biotechnol. 2017, 101, 217–227. [Google Scholar] [CrossRef]
  13. Hu, F.X.; Liu, Y.Y.; Lin, J.Z.; Wang, W.D.; Li, S. Efficient production of surfactin from xylose-rich corncob hydrolysate using genetically modified Bacillus subtilis 168. Appl. Microbiol. Biotechnol. 2020, 104, 4017–4026. [Google Scholar] [CrossRef]
  14. Duarte-Delgado, D.; Narvaez-Cuenca, C.E.; Restrepo-Sanchez, L.P.; Kushalappa, A.; Mosquera-Vasquez, T. Development and validation of a liquid chromatographic method to quantify sucrose, glucose, and fructose in tubers of Solanum tuberosum Group Phureja. J. Chromatogr. B-Anal. Technol. Biomed. Life Sci. 2015, 975, 18–23. [Google Scholar] [CrossRef]
  15. Klausmann, P.; Hennemann, K.; Hoffmann, M.; Treinen, C.; Aschern, M.; Lilge, L.; Heravi, K.M.; Henkel, M.; Hausmann, R. Bacillus subtilis High Cell Density Fermentation Using a Sporulation-Deficient Strain for the Production of Surfactin. Appl. Microbiol. Biotechnol. 2021, 105, 4141–4151. [Google Scholar] [CrossRef]
  16. Li, H.; Xu, H.; Xu, H.; Li, S.; Ying, H.J.; Ouyang, P.K. Enhanced welan gum production using a two-stage agitation speed control strategy in Alcaligenes sp. CGMCC2428. Bioprocess Biosyst. Eng. 2011, 34, 95–102. [Google Scholar] [CrossRef]
  17. Wu, Q.; Zhi, Y.; Xu, Y. Systematically engineering the biosynthesis of a green biosurfactant surfactin by Bacillus subtilis 168. Metab. Eng. 2019, 52, 87–97. [Google Scholar] [CrossRef]
  18. Detsch, C.; Stulke, J. Ammonium utilization in Bacillus subtilis: Transport and regulatory functions of NrgA and NrgB. Microbiology 2003, 149, 3289–3297. [Google Scholar] [CrossRef]
  19. Zhang, B.; Li, Y.; Zhang, Y.Y.; Qiao, H.T.; He, J.T.; Yuan, Q.; Chen, X.N.; Fan, J.F. High-cell-density culture enhances the antimicrobial and freshness effects of Bacillus subtilis S1702 on table grapes (Vitis vinifera cv. Kyoho). Food Chem. 2019, 286, 541–549. [Google Scholar] [CrossRef]
  20. Zhou, Q.; Takenaka, S.; Murakami, S.; Seesuriyachan, P.; Kuntiya, A.; Aoki, K. Screening and characterization of bacteria that can utilize ammonium and nitrate ions simultaneously under controlled cultural conditions. J. Biosci. Bioeng. 2007, 103, 185–191. [Google Scholar] [CrossRef]
  21. Huang, X.F.; Liu, J.N.; Wang, Y.H.; Liu, J.; Lu, L.J. The positive effects of Mn2+ on nitrogen use and surfactin production by Bacillus subtilis ATCC 21332. Biotechnol. Biotechnol. Equip. 2015, 29, 381–389. [Google Scholar] [CrossRef] [PubMed]
  22. Mei, Y.W.; Yang, Z.Y.; Kang, Z.H.; Yu, F.; Long, X.W. Enhanced surfactin fermentation via advanced repeated fed-batch fermentation with increased cell density stimulated by EDTA-Fe (II). Food Bioprod. Process. 2021, 127, 288–294. [Google Scholar] [CrossRef]
  23. Lau, C.K.Y.; Krewulak, K.D.; Vogel, H.J. Bacterial ferrous iron transport: The Feo system. FEMS Microbiol. Rev. 2016, 40, 273–298. [Google Scholar] [CrossRef] [PubMed]
  24. Kimura, K.; Tanaka, E.; Nakano, Y. Purification and characterization on glutamine synthetase from Alkalophilic Bacillus No. 170. J. Gen. Appl. Microbiol. 2006, 41, 269–279. [Google Scholar] [CrossRef]
  25. Tanaka, E.; Kimura, K. Identification of amino acid residues modified by two ATP analogs in Bacillus subtilis glutamine synthetase. J. Biochem. 1991, 110, 780–784. [Google Scholar] [CrossRef]
  26. Zhou, D.Y.; Hu, F.X.; Lin, J.Z.; Wang, W.D.; Li, S. Genome and transcriptome analysis of Bacillus velezensis BS-37, an efficient surfactin producer from glycerol, in response to d-/l-leucine. Microbiologyopen 2019, 8, e794. [Google Scholar] [CrossRef] [PubMed]
  27. Cosby, W.M.; Vollenbroich, D.; Lee, O.H.; Zuber, P. Altered srf expression in Bacillus subtilis resulting from changes in culture pH is dependent on the Spo0K oligopeptide permease and the ComQX system of extracellular control. J. Bacteriol. 1998, 180, 1438–1445. [Google Scholar] [CrossRef] [PubMed]
  28. Wang, Q.; Yu, H.M.; Wang, M.M.; Yang, H.; Shen, Z.Y. Enhanced biosynthesis and characterization of surfactin isoforms with engineered Bacillus subtilis through promoter replacement and Vitreoscilla hemoglobin co-expression. Process Biochem. 2018, 70, 36–44. [Google Scholar] [CrossRef]
  29. Yi, G.B.; Liu, Q.; Lin, J.Z.; Wang, W.D.; Huang, H.; Li, S. Repeated batch fermentation for surfactin production with immobilized Bacillus subtilis BS-37: Two-stage pH control and foam fractionation. J. Chem. Technol. Biotechnol. 2017, 92, 520–525. [Google Scholar] [CrossRef]
  30. Ghribi, D.; Ellouze-Chaabouni, S. Enhancement of Bacillus subtilis Lipopeptide Biosurfactants Production through Optimization of Medium Composition and Adequate Control of Aeration. Biotechnol. Res. Int. 2011, 2011, 653654. [Google Scholar] [CrossRef]
  31. Liu, X.Y.; Ren, B.A.; Chen, M.; Wang, H.B.; Kokare, C.R.; Zhou, X.L.; Wang, J.D.; Dai, H.Q.; Song, F.H.; Liu, M. Production and characterization of a group of bioemulsifiers from the marine Bacillus velezensis strain H3. Appl. Microbiol. Biotechnol. 2010, 87, 1881–1893. [Google Scholar] [CrossRef] [PubMed]
  32. Durval, I.J.B.; Resende, A.H.M.; Figueiredo, M.A.; Luna, J.M.; Rufino, R.D.; Sarubbo, L.A. Studies on Biosurfactants Produced using Bacillus cereus Isolated from Seawater with Biotechnological Potential for Marine Oil-Spill Bioremediation. J. Surfactants Deterg. 2019, 22, 349–363. [Google Scholar] [CrossRef]
  33. Zhu, L.Y.; Xu, Q.; Jiang, L.; Huang, H.; Li, S. Polydiacetylene-Based High-Throughput Screen for Surfactin Producing Strains of Bacillus subtilis. PLoS ONE 2014, 9, e88207. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Experimental design process diagram. (A) Isolation of a B. subtilis 168 mutant that efficiently utilizes inorganic nitrogen. (B) Optimization of trace metals in the culture medium. (C) The sfp+ gene from B. velezensis BS-37 was transformed into LJ-3 to restore the ability of LJ-3 to synthesize surfactin. (D) Fermentation regulation. (E) Analysis of surfactin composition: a—C13—surfactin, b—iso-C14-surfactin, c—nC14-surfactin, and d—anteiso-C15-surfactin.
Figure 1. Experimental design process diagram. (A) Isolation of a B. subtilis 168 mutant that efficiently utilizes inorganic nitrogen. (B) Optimization of trace metals in the culture medium. (C) The sfp+ gene from B. velezensis BS-37 was transformed into LJ-3 to restore the ability of LJ-3 to synthesize surfactin. (D) Fermentation regulation. (E) Analysis of surfactin composition: a—C13—surfactin, b—iso-C14-surfactin, c—nC14-surfactin, and d—anteiso-C15-surfactin.
Fermentation 09 00525 g001
Figure 2. The sfp+ version of variant. The sfp gene of LJ-3 was replaced with the sfp+ gene from B. velezensis BS-37. LF—sfp (LJ-3) gene left flanking (~1000 bp); DR—sfp (LJ-3) gene right flanking (~400 bp); Pveg—strong promoter; sfp+ gene (B. velezensis BS-37); RF—right flanking of LF (~800 bp); and PC—counter-selectable cassette (containing chloramphenicol resistance gene (cat) and pheS* gene, named PC).
Figure 2. The sfp+ version of variant. The sfp gene of LJ-3 was replaced with the sfp+ gene from B. velezensis BS-37. LF—sfp (LJ-3) gene left flanking (~1000 bp); DR—sfp (LJ-3) gene right flanking (~400 bp); Pveg—strong promoter; sfp+ gene (B. velezensis BS-37); RF—right flanking of LF (~800 bp); and PC—counter-selectable cassette (containing chloramphenicol resistance gene (cat) and pheS* gene, named PC).
Fermentation 09 00525 g002
Figure 3. ALE of B. subtilis 168 incubated in medium with NO3 or NH4+. (A) The adaptive evolution of LJ-2 strain in ALE medium with NO3 (solid to liquid for one cycle). (B) The adaptive evolution of LJ-3 strain in ALE medium with NH4+ (solid to liquid for one cycle).
Figure 3. ALE of B. subtilis 168 incubated in medium with NO3 or NH4+. (A) The adaptive evolution of LJ-2 strain in ALE medium with NO3 (solid to liquid for one cycle). (B) The adaptive evolution of LJ-3 strain in ALE medium with NH4+ (solid to liquid for one cycle).
Fermentation 09 00525 g003
Figure 4. Effects of different metal ions on LJ-3 substrate utilization and cell growth. (A) Effect of different concentrations of Fe2+. (B) Effect of different concentrations of Mn2+. (C) Effect of different concentrations of Mg2+. (D) Effects of different concentrations of Zn2+. (E) Effects of different concentrations of Cu2+. (F) Cell density varies with time under different concentrations of Mn2+. Consumption of NH4+ (%) (black squares), residual NH4+ (%) (white squares), consumption of sucrose (%) (red squares), residual sucrose (%) (grey squares), and cell density (yellow squares) were measured.
Figure 4. Effects of different metal ions on LJ-3 substrate utilization and cell growth. (A) Effect of different concentrations of Fe2+. (B) Effect of different concentrations of Mn2+. (C) Effect of different concentrations of Mg2+. (D) Effects of different concentrations of Zn2+. (E) Effects of different concentrations of Cu2+. (F) Cell density varies with time under different concentrations of Mn2+. Consumption of NH4+ (%) (black squares), residual NH4+ (%) (white squares), consumption of sucrose (%) (red squares), residual sucrose (%) (grey squares), and cell density (yellow squares) were measured.
Fermentation 09 00525 g004
Figure 5. Beneficial metal ions (0.5 mM Fe2+, 0.01 mM Mn2+, and 2 mM Mg2+) were added to promote cell growth in the presence of NH4+ after adaptive laboratory evolution. (A) The growth of LJ-3 and B. subtilis 168 in optimized medium. (B) Growth rates of LJ-3 and B. subtilis 168.
Figure 5. Beneficial metal ions (0.5 mM Fe2+, 0.01 mM Mn2+, and 2 mM Mg2+) were added to promote cell growth in the presence of NH4+ after adaptive laboratory evolution. (A) The growth of LJ-3 and B. subtilis 168 in optimized medium. (B) Growth rates of LJ-3 and B. subtilis 168.
Fermentation 09 00525 g005
Figure 6. The ability of LJ-3 to synthesize surfactant was restored in the LJ-31 transformant, and the cell density, pH, and surfactin yield were monitored. (A) Growth curves of LJ-3 and LJ-31. (B) The change in pH in medium and accumulation of surfactin.
Figure 6. The ability of LJ-3 to synthesize surfactant was restored in the LJ-31 transformant, and the cell density, pH, and surfactin yield were monitored. (A) Growth curves of LJ-3 and LJ-31. (B) The change in pH in medium and accumulation of surfactin.
Fermentation 09 00525 g006
Figure 7. Effect of pH on the synthesis of surfactin by LJ-31 using NH4Cl and variation in relevant kinetic parameters (µ, qp). (A) Changes in substrate, dry cell weight, and surfactin yield at pH 6.5. (B) Changes in specific yield of surfactin (qp) and specific growth rate (µ) of LJ-31.
Figure 7. Effect of pH on the synthesis of surfactin by LJ-31 using NH4Cl and variation in relevant kinetic parameters (µ, qp). (A) Changes in substrate, dry cell weight, and surfactin yield at pH 6.5. (B) Changes in specific yield of surfactin (qp) and specific growth rate (µ) of LJ-31.
Fermentation 09 00525 g007
Figure 8. The fermentation process and related kinetic parameters (µ, qp) in an optimized fermentation system. (A) Changes in substrate, DCW, and surfactin yield. (B) The specific yield of surfactin (qp) and specific growth rate (µ).
Figure 8. The fermentation process and related kinetic parameters (µ, qp) in an optimized fermentation system. (A) Changes in substrate, DCW, and surfactin yield. (B) The specific yield of surfactin (qp) and specific growth rate (µ).
Fermentation 09 00525 g008
Figure 9. Composition analysis of surfactin products: a-C13-surfactin, b-iso-C14-surfactin, c-nC14-surfactin, and d-anteiso-C15-surfactin.
Figure 9. Composition analysis of surfactin products: a-C13-surfactin, b-iso-C14-surfactin, c-nC14-surfactin, and d-anteiso-C15-surfactin.
Fermentation 09 00525 g009
Table 1. Strains and plasmids used in this study.
Table 1. Strains and plasmids used in this study.
NamesCharacteristicsReferences
Strains
B. subtilis 168start strainThis paper
B. subtilis 168 (Pveg-GFP)B. subtilis 168 derivative, containing Pveg promoter (Strong promoter of Bacillus subtilis)[10]
Bacillus. velezensis BS-37Wild-type, surfactin producer[11]
LJ-3B. subtilis 168 variantThis study
LJ-31LJ-3 derivative, sfp+, Overexpression of the sfp gene derived from B. velezensis BS-37 was regulated by the promoter PvegThis study
Plasmid
pNZT1-pheS*pNZT1 with Pbc-pheS*-cat cassette[12]
Table 2. Primers used in this study.
Table 2. Primers used in this study.
PrimersPrimer Sequence (5′-3′)Gene Fragment
LF-FTTTGTGATTTTCAGCGTGATTGAAAACCTLF
LF-RCTGTGTAAGATAGATCTCTAGATCCTCCGTCTGCAAAAGATTGT
Pveg-FAGACGGAGGATCTAGAGATCTATCTTACACAGCATCACACTGGPveg
Pveg-RACTCCGTAAATCTTCATGTTTGTCCTCCTTATTAGTTAATCTACA
TTTAT
Sfp-FAATAAGGAGGACAAACATGAAGATTTACGGAGTATATATGGACCGCSfp+
Sfp-RGCGCACTGAAAAGGAATTATAACAGCTCTTCATACGTTTTCATC
TCAATC
DR-FGAGATGAAAACGTATGAAGAGCTGTTATAATTCCTTTTCAGTG
CGCCTGC
DR
DR-RTCATTTGTATACATACTTTAAAAATAGATTATCCGAAAGAAAAT
CTATTA
PC-FTAATAGATTTTCTTTCGGATAATCTATTTTTAAAGTATGTATACA
AATGA
PC
PC-RATAAATTCCGTAAATCTTCATTTATAAAAGCCAGTCATTAGGCCTATCTG
RF-FCCTAATGACTGGCTTTTATAAATGAAGATTTACGGAATTTATAT
GGACCG
RF
RF-RTCTCCTTGAGGCGATAGACCG
Underlined letters represent homologous sequences for fusion PCR.
Table 3. The C/N, dissolved oxygen, and pH were optimized in a bioreactor. Substrate, DCW, and surfactin were measured, and the product per substrate and product per biomass were calculated at 22 h.
Table 3. The C/N, dissolved oxygen, and pH were optimized in a bioreactor. Substrate, DCW, and surfactin were measured, and the product per substrate and product per biomass were calculated at 22 h.
ConditionsSucroseNH4+DCWPmaxYP/SYP/X
(g/L)(g/L)(g/L)(g/L)(g/g)(g/g)
pH 6.5
Oxygen supply (vvm): 0.06
C/N
(mol/mol)
3520 ± 1.204.70 ± 0.201.65 ± 0.050.0550.35
17.517.6 ± 2.00.55 ± 0.186.62 ± 0.121.90 ± 0.040.0450.29
11.6800.81 ± 0.128.24 ± 0.233.82 ± 0.060.0760.46
702.30 ± 0.1810.72 ± 0.173.50 ± 0.070.0700.33
pH 6.5
C/N (mol/mol): 11.68
Oxygen supply (vvm)0.136.4 ± 1.51.29 ± 0.116.68 ± 0.211.60 ± 0.080.0370.24
0.0600.81 ± 0.128.24 ± 0.333.82 ± 0.060.0760.29
0.0300.90 ± 0.107.40 ± 0.254.10 ± 0.040.0820.55
0.026.93 ± 1.31.27 ± 0.176.10 ± 0.212.55 ± 0.050.0590.42
C/N (mol/mol): 11.68
Oxygen supply (vvm): 0.03
pH61.50 ± 1.20.94 ± 0.128.11 ± 0.232.56 ± 0.050.0530.32
6.500.90 ± 0.107.40 ± 0.354.10 ± 0.040.0820.55
70.17 ± 2.10.90 ± 0.158.29 ± 0.323.85 ± 0.060.0770.46
7.50.19 ± 1.90.70 ± 0.188.97 ± 0.263.70 ± 0.070.0740.41
Table 4. Synthesis of surfactin by different strains using inorganic nitrogen sources.
Table 4. Synthesis of surfactin by different strains using inorganic nitrogen sources.
Process, StrainsNitrogen SourceBiomassPmaxReference
LJ-31 (B. subtilis 168 derivative bacteria) batch fermentation in bioreactorNH4Cl7.4 g/L (DCW)4.1 (g/L)This study
B. subtilis ATCC 21332 (commercial strain) batch fermentation in shake flasksNaNO3, KNO310.2 (OD600)3.054 (g/L)[22]
Bacillus subtilis SPB1 strain wild-type batch fermentation in bioreactorUrea, NH4Cl, kerosene20 × 108 (cells/mL)4.922 (g/L)[30]
Bacillus velezensis H3 (wild-type) batch fermentation in shake flasks(NH4)2SO40.4–0.5 (g/L)[31]
B. cereus BCS0 (wild-type) batch fermentation in shake flasksUrea, NH4Cl, NaNO30.7–1.22 (g/L)[32]
B. cereus BCS1 (wild-type) batch fermentation in shake flasksUrea, NH4Cl, NaNO30.11–0.5 (g/L)[32]
B. cereus BCS2 (wild-type) batch fermentation in shake flasksUrea, NH4Cl, NaNO30.51–2.71 (g/L)[32]
B. cereus BCS3 (wild-type) batch fermentation in shake flasksUrea, NH4Cl, NaNO31.7–2.91 (g/L)[32]
168 (JABs24) and 3NA (JABs32) batch fermentation in bioreactor(NH4)2SO42.56–2.68 (g/L)[15]
(—) Not mentioned in the article.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Tao, W.; Yue, S.; Yuan, Z.; Li, S. Adaptive Laboratory Evolution of Bacillus subtilis 168 for Efficient Production of Surfactin Using NH4Cl as a Nitrogen Source. Fermentation 2023, 9, 525. https://doi.org/10.3390/fermentation9060525

AMA Style

Li J, Tao W, Yue S, Yuan Z, Li S. Adaptive Laboratory Evolution of Bacillus subtilis 168 for Efficient Production of Surfactin Using NH4Cl as a Nitrogen Source. Fermentation. 2023; 9(6):525. https://doi.org/10.3390/fermentation9060525

Chicago/Turabian Style

Li, Jie, Weiyi Tao, Shenghui Yue, Zhangzhong Yuan, and Shuang Li. 2023. "Adaptive Laboratory Evolution of Bacillus subtilis 168 for Efficient Production of Surfactin Using NH4Cl as a Nitrogen Source" Fermentation 9, no. 6: 525. https://doi.org/10.3390/fermentation9060525

APA Style

Li, J., Tao, W., Yue, S., Yuan, Z., & Li, S. (2023). Adaptive Laboratory Evolution of Bacillus subtilis 168 for Efficient Production of Surfactin Using NH4Cl as a Nitrogen Source. Fermentation, 9(6), 525. https://doi.org/10.3390/fermentation9060525

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop