Evaluation of the Thermal Processes on Changing the Phenotypic Characteristics of Escherichia coli Strains from Ice Cream Compared to Non-Pasteurized Milk

Abstract

Escherichia coli (E. coli) is shocked by various temperature processes in milk, which forces the organism to make proteins as a result of changes in the synthesis of enzymes that might give the strain special characteristics. The purpose of this study was to investigate the effects of the heat shock factor on changing the results of biochemical and molecular tests among E. coli strains obtained from ice cream and non-pasteurized milk when compared to a reference strain from the American-type culture collection (ATCC) in order to determine the phenotypic variation caused by the temperature conditions of the manufacturing process. Furthermore, isolates with characteristics similar to E. coli were discovered, but they were not E. coli and caused some ambiguity. To test the E. coli contamination of traditional and industrial ice cream, 82 samples were chosen at random. SDS-PAGE and 16S rDNA sequencing were carried out, as well as phenotypic testing. Isolated strains did not exactly match the reference strain. The results of biochemical testing and protein analysis revealed that the isolates were diverse. Samples E. coli phenons were classified. In the electrophoresis, the ice cream strain had two protein bands in the 20.75 and 23.59 kDa ranges that were distinct from the reference strain. These isolates appear to experience alterations in enzyme characteristics and structural proteins as a result of being exposed to various temperature conditions, such as pasteurization and frigidity. When compared to the reference strain, the calculated similarity percentage of the elicited isolate varied from 60 to 70%. The electrophoretic patterns of E. coli isolated elicited from milk samples differed from E. coli isolated obtained from the ice cream. The distinctions were in the intensity or position of the bands. The results also revealed that when isolates are subjected to thermal stresses, they exhibit a pattern similar to that of ice cream isolates. These considerations are made because a change in protein composition might result in a change in biochemical features, resulting in uncertainty in its identification. Sequences revealed that the sequences were related to E. coli 16S rDNA, despite differences in phenotypic and electrophoretic features between the isolated bacteria and the reference strain E. coli ATCC 25922. Our findings revealed that 16S rDNA could potentially be used to instantly implement an appropriate preventive measure for the purpose of identifying this type of bacteria and avoid some ambiguity.

1. Introduction

The first description of E. coli was provided by the German pediatrician, Theodor Escherichia. In 1885, he isolated the above bacteria from the stool of a child with enteritis, called Bacterium coli. It was called Bacterium colon due to its place in the large colon (bacterium means stretched and bacilliform) [1]. Escherichia demonstrated the presence of E. coli in all human feces, which is significant given its unique place among opportunistic bacteria due to its ability to cause intestinal infections. Its presence in the gut inhibits the growth of other proteolytic bacteria while also contributing to the synthesis of a number of B-group vitamins. Schardinger then proposed E. coli as a fecal contamination indicator. E. coli was identified as a food pathogen in 1971 [2]. Milk and its products derived from cows can harbor various microorganisms. These microorganisms play essential roles in facilitating dairy fermentations (e.g., Lactococcus, Lactobacillus, Streptococcus, Propionibacterium, and fungal populations), causing spoilage (e.g., Pseudomonas, Clostridium, Bacillus, and other spore-forming or thermoduric microorganisms), promoting health (e.g., Lactobacilli and Bifidobacteria), or causing disease (e.g., Listeria monocytogenes, Salmonella, E. coli, Campylobacter, S. aureus, and mycotoxin-producing fungi) [3]. Dairy products, such as ice cream, may give important nutrients to a variety of microbes. Gram-negative bacteria make up more than 90% of the microbial community in cold raw milk [4]. Furthermore, food is a major source of contamination by chemical and biological agents. More than 70% of infectious diseases are transferred to humans through contaminated food [5]. Milk contamination can occur directly from dairy animals shedding pathogens into the milk or indirectly during the milking, collecting, and transportation processes [6]. To destroy the bacteria, milk can be pasteurized at a certain temperature. Thus, one of the most major causes of contamination is a lack of hygiene during production [7]. The presence of E. coli is the first sign of fecal contamination. E. coli identification is so important as a hygiene measure that it is used to assess contamination by other pathogenic microbes [8]. Bacteria are commonly found in the colon and feces of humans and other warm-blooded animals. Diarrhea is caused by oral contamination with feces. E. coli is a resistant bacterium that may survive in water and food for weeks or months under natural conditions [9,10].

When bacteria are subjected to pH and temperature stresses, sublethal stresses are likely to occur. This results in variances in their tolerance to the subsequent heat treatment. Bacteria may be able to adapt to non-optimal conditions and require a longer time to be destroyed, depending on the pH and temperature of the environment. In diverse conditions, E. coli O157:H7 strains demonstrate a wide variety of heat tolerances, impacting their resistance to certain following procedures [11].

In nature, bacteria are subjected to a variety of harmful and severe stresses, including nutrient deficiency, osmotic pressure, extremely high or low temperatures, acid, and antimicrobial compounds. Bacterial adaptation to these unfavorable environmental conditions is accomplished through the utilization of defensive mechanisms. Bacterial stress responses are controlled at three levels: transcription, translation, and post-translational. This results in alterations in gene expression, protein activity, and cell metabolism. These bacterial stress responses result in stress tolerance and cellular damage repair [12].

Heat and cold are two of the most common environmental stresses for bacteria. HSR (heat shock response) and CSR (cold shock response) are biochemical responses that bacteria exhibit in response to sudden and significant temperature increases and decreases, respectively [13]. Heat shock proteins (HSPs) are synthesized by HSR when bacteria are subjected to heat [14]. Heat shock proteins are beneficial in restoring the native structure of thermally unfolded proteins and preventing proteasomal protein destruction [15]. Cold shock proteins (CSPs) are produced in response to a rapid considerable reduction in temperature [16].

The CSP family has nine homologous proteins (CspA to CspI). These CSPs are thought to be nucleic acid chaperones that enhance the trigger of bacterial translation when exposed to cold stress [17,18]. ClpL (a major HSP) influences cell wall biosynthesis, which enhances β-lactam resistance [19]. A ClpXP protease is believed to be a protein quality control system. This system is created by thermal shock and other stresses, and it is accompanied with antibiotic resistance. Furthermore, HSR increases the rate of genetic recombination and HGT in class 1 integrons, which contributes to Gram-negative multidrug resistance. E. coli is a commensal bacterium present in animal guts [20,21]. Because of the buffer and temperature conditions, ice cream is susceptible to bacterial contamination. A high number of anaerobic microorganisms, such as Bacteroides, influence this foodstuff [22]. The most common cause of diarrhea is bacteria. Despite the availability of simple effective therapies, more than 1400 children die of diarrhea every day, or over 480,000 children each year. It appears to be a greater threat than malaria, measles, and HIV/AIDS combined [23]. Diarrhea is defined as having watery stools and excreting more than three times a day on average. Diarrhea affects children under the age of five in underdeveloped nations 3.3 times per year, or even 9 times per year in some areas. The prevalence of intestinal pathogens is influenced by a number of epidemiological parameters, including host, environmental factors, and health care facilities [24]. E. coli is a pathogen found in humans and other animals’ intestines [25]. The presence of food-borne pathogens in raw cow milk varies, although it has been demonstrated in several surveys. Campylobacter, Salmonella spp., and human pathogenic verocytotoxin-producing E. coli have all been related to food-borne diseases. Several toxin-producing strains, including Vero toxigenic E. coli (VTEC), have been discovered in milk-derived foods. Some of them are resistant to drugs [26]. Milk-borne and milk product-borne outbreaks account for 2–6% of bacterial food-borne illnesses in developed nations [27]. However, nothing is known about the distinct E. coli isoforms found in traditional and industrial ice creams.

The objective of this study was to evaluate the findings of biochemical and molecular tests performed on E. coli strains isolated from ice cream in order to determine the phenotypic variation caused by the temperature conditions of the manufacturing process. To identify and characterize various E. coli isoforms, we utilized biochemical assays in conjunction with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of whole-bacteria proteins and sequenced 16S rDNA.

2. Material and Methods

2.1. Sampling

According to this research’s design, that of a descriptive cross-sectional study, three samples from each store were chosen at random and carried out in three steps. Without previous notification, ice cream was purchased as a regular customer from ice cream sale centers for sampling. The samples were put in the cool box at a temperature close to that maintained by the material suppliers and quickly transferred to the laboratory for microbiological tests. The presence of E. coli was then determined in all samples. To test E. coli contamination in ice creams, 82 samples were chosen at random from the province of Isfahan. The samples were kept at 10 °C. Microbial testing carried out in accordance with standard procedures [28].

2.2. Livestock Milk Sampling

A semi-mechanized livestock center was chosen to compare the isolates of ice cream derived from milk samples, and samples were analyzed for E. coli infection to determine the phenotypic variations in the isolates acquired from ice cream. Thirteen isolates were chosen, and their phenotypic and electrophoretic patterns were examined. The samples (10 mL) were diluted to 0.1 in a test tube containing 10 mL of double concentrated Fluorocult LMX Broth (LMX, Merck, Darmstadt, Germany) and a Durham microtube. The samples were then incubated for 8 h at 35 °C. The color change of the liquid medium to blue-green and the generation of gas were signs of E. coli in the medium. Subsequently, 0.5 mL of 5 M sodium hydroxide (NaOH) was added to each tube to induce blue fluorescence using a long-wave UV light source (366 nm). The presence of E. coli was confirmed by the appearance of a red ring with the addition of Kovac’s reagent (isoamyl alcohol, para-Dimethylaminobenzaldehyde, concentrated hydrochloric acid). The sample was cultured on Chromocult coliform agar (Merck, Darmstadt, Germany) for 24 h before being treated at 35 °C with indole reagent to separate the isolates. E. coli colonies ranged from dark blue to violet [29]. Meanwhile, coliform and microflora colonies were red and colorless, respectively. Blue and violet colonies were chosen, cultured on nutrient agar, kept at 35 °C for 24 h, and stored for supplementary testing at 4 °C. Each isolate’s fresh culture was transferred to a microtube containing sterile normal saline and kept at 4 °C. For long-term preservation, pure isolates were transferred to tubes containing nutritional agar (Merck, Darmstadt, Germany) for 24 h at 37 °C. Following that, sterile liquid paraffin was added to the culture tubes, and the tubes were kept at 4 °C [28,30,31].

2.3. Heat Shock in Bacteria Isolated from Raw Milk

Each isolate experienced six repetitions of this step. The bacterial sediment was separated using a centrifuge set at 1200 rpm, rinsed multiple times with sterile physiological serum, and then centrifuged once more. Additionally, 4 °C was used for the centrifugation process. The bacterial sediment was maintained in 1 mL of fetal bovine serum at 4 °C after being washed three times. The isolates were electrophoresed in SDS-PAGE after 7 days.

2.4. Phenotypic Tests

Biochemical assays were used to compare each isolate to the reference strain of E. coli ATCC 25922. Further biochemical tests were performed on the isolates to provide a more precise diagnosis. Biochemical tests were performed for the identification of the E. coli species isolated from ice cream and unpasteurized milk with the help of Bailey & Scott’s Diagnostic Microbiology [28]. In EC (Escherichia coli) broth, LMX broth, and lauryl tryptose broth, gas was sometimes generated from the lactose by the production of acid from a variety of substrates. Numerical taxonomy analysis was used to describe the 48 strains. The Jaccard coefficient was used to calculate a distance matrix, and the UPGMA algorithm was utilized to perform cluster analysis. The dendrogram was created using the NTYSYSPC Ver 2.02e program [32] (Figure 1).

2.5. Whole-Bacteria Protein Electrophoresis

SDS-PAGE in modified Laemmli method was used to process the vertical slab unit to compare whole-cell protein profiles [33]. The bacteria were incubated on nutrient agar at 35 °C for 24 h. The colonies were then suspended in sterile distilled water, and their OD was calibrated using a spectrophotometer at 2.8–3 units per 600 nm. SDS buffer was added to the samples. After the lysis of bacteria, 2-mercaptoethanol was added to the samples and left for 5 min at 95 °C. Proteins were extracted, and electrophoresis (Bio-rad, Hercules, CA, USA) was performed at 100 V in a 12% polyacrylamide gel. Finally, the molecular weight of proteins was evaluated using the LMW-SDS Marker Kit 14–97 kDa (Thermo Scientific, Waltham, MA, USA) as the molecular weight detection standard.

2.6. Calculating the Percentage of Similarity

The difference in the protein profile of the isolates produced from infected specimens was examined by the reference strain, and the degree of conformity between the isolates with the reference strain and with each other was calculated after determining the similarity. The presence of non-type specific isolates, showing the presence of variations between isolates and reference strains, may be determined using this approach. This might be due to environmental factors causing diversity. The percentage of similarity between isolates and standard subspecies was used to evaluate the similarity between isolates [34].

N_xy: Common protein bands between isolates x, y;

n_x: Total number of protein x bands;

n_y: Total number of protein y bands;

$$f=\frac{2n_{xy}}{\left(n_x+n_y\right)}\times 100$$

(1)

2.7. Investigating E. coli Strains via Sequencing of 16S rDNA

2.7.1. DNA Extraction

The DNA was extracted using bacterial suspension cultures. DNA was extracted and purified in this investigation using a QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). The extraction was carried out in accordance with the manufacturer’s instructions, with each extraction containing 100 µL of sample. A NanoDrop 1000 spectrophotometer was used to measure the concentrations of DNA isolated from bacterial isolates (Thermo Fisher Scientific, Wilmington, DE, USA). Based on DNA concentration, the equivalent of bacterial genomic DNA was estimated. Finally, by utilizing 16S rDNA reproduction with PCR, the acquired DNA was used to identify the bacteria.

2.7.2. PCR Method

PCR was performed using primer pairs 16s27f and 16s1492R [35]. The PCR program was conducted to reproduce 16S rDNA. The sequencing primers were (from 5′ to 3′): forward 16s27f, AGAGTTTGATCTTGGCTCAG, and reverse 16s1492R, TACGGTTACCTTGTTACGACTT, and Thermal Cycler (Bio-Rad, Hercules, CA, USA). One reaction provided as an E. coli positive control (DNA generated using the standard procedure), while another acted as a negative control (distilled water). PCR was performed in 50 µL of the total volume containing 20–30 ng of genomic DNA, 2.5 mM magnesium chloride, 2 U of Taq DNA polymerase, 0.6 mM dNTP Mix, and 0.3 mM primers. PCR thermal cycling conditions were as follows: 95 °C for 5 min, 35 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 5 min.

2.7.3. Agarose Gel Electrophoresis and PCR Product Purification

The reaction mixture (10 µL) was then electrophoretically separated using 1% agarose with ethidium bromide at a concentration of 10 µg/mL. The reaction product was visualized under the Gel doc/UV trans-illuminator. Finally, fragments accompanied by PCR products were detected using GeneRuler™ 100bp DNA Ladder Plus weight (ThermoScientific, Waltham, MA, USA) as a DNA ladder, and electrophoresis (BIO-RAD, Hercules, CA, USA) was performed at 100 V. The PCR product was purified by QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). The PCR amplified product of 16S rDNA (100 ng concentration) was used for sequencing with single 16S rDNA 27F. The forward primer was 5′-AGAGTTTGATCTTGGCTCAG-3′ by ABI (Applied Biosystem Inc., Seattle, WA, USA) DNA sequencer.

3. Results

3.1. Phenotypic Tests of Isolated Coliforms

From among the 82 tested samples, 48 isolates were obtained (Indole-positive). Isolates were classified due to the biochemical diversity of the isolates and the lack of a definite diagnosis. Important variables were used to classify clusters. Based on differences in biochemical tests, numerical analytical results revealed that isolates were transformed into eight phenons. The dendrogram illustrates the clustering patterns of 39 phenotypic traits (Figure 1). Using numerical analysis, the samples were transformed into eight phenons. These phenons resulted from the strains’ phenotypic differences and variation in acid production using different carbon sources.

Some isolates recorded in this test, however, were completely similar, close, or even different. Gram-negative bacteria, rod-shaped bacteria (with lengths of 2–6 µm and widths of 1–1.5 µm), movable bacteria, environmental flagella bacteria, non-spore forming, positive catalase and negative oxidase bacteria, nitrate reducing bacteria, and fermentation bacteria were all isolated from ice cream samples collected from various locations throughout Isfahan (

Table 1. Physiological properties of 48 isolates obtained from different regions for ice-cream.

Characteristics	Positive Isolates (%)	Characteristics	Positive Isolates (%)
Indole	100	Fluorescent color in LMX medium	71
Green metallic sheen (Eosine methylene blue)	71	Blue color in LMX medium	84
Violet blue colonies (Chromo cult Coliform agar)	83	Urease	13
Methyl red (MR)	95	Motility	88
Acetoin (Vogues-Proskauer Test)(VP)	2	Red colonies on MacConkey agar	85
Gelatin liquefaction	8

). Furthermore, some mucoid colonies with capsules but mostly without capsules, resembling E. coli and capable of producing indole, were isolated.

Table 2. Characteristics of coliform strains from ice cream compared with milk and reference strain of E. coli.

	Coliform Phenons from Ice Cream A								Reference	From Milk
Characteristics	1(34)	2(4)	3(2)	4(1)	5(1)	6(1)	7(4)	8(1)	E. coli	9(13)
Gram reaction	−	−	−	−	−	−	−	−	−	−
Catalase production	+	+	+	+	+	+	+	+	+	+
Oxidase production	−	−	−	−	−	−	−	−	−	−
KCN, growth	−	−	+	−	ND	ND	ND	ND	+	(+)
Dulcitol	+	+	+	−	ND	ND	ND	ND	+	(+)
Acetate utilization	+	+	+	+	ND	ND	ND	ND	+	(+)
Nitrate reduction	+	+	+	+	+	+	+	+	+	80
Fluorescence production on LMX	+	−	−	−	−	−	−	−	+	65
Bluish-green color on LMX	+	+	+	+	−	−	−	−	+	+
Fermentative metabolism	+	+	+	+	+	+	+	+	+	(+)
Lysine decarboxylase	+	50 *	−	+	−	+	50 *	−	+	(+)
Ornithine decarboxylase	+	+	+	25 *	ND	ND	ND	ND	+	(+)
Green metallic sheen colonies on Eosine methylen blue (EMB) agar	+	−	−	−	−	−	−	−	+	ND
Pigment production	−	−	+	−	−	−	−	−	−	−
Red colonies on MacConkey agar	+	+	+	−	−	+	−	−	+	+
Gelatin liquefaction	9 *	−	−	−	−	−	25 *	−	−	−
Dark blue and violet colonies on CC agar	+	+	50 *	+	−	−	−	−	+	+
Acidification (Acid /acid + gas)	+	+	+	−	−	+	−	−	+	+
Alkali form (alkaline/acid)	−	−	−	+	+	−	−	+	−	16 *
Methyl red (MR)	+	+	+	−	+	−	+	+	+	+
Acetoin production(Vogues-Proskauer) Test)(VP))	−	−	−	−	−	+	−	−	−	−
Gas from glucose	+	+	+	−	−	+	−	−	+	+
H2S from cystein	−	−	−	−	−	−	−	−	−	13 *
Indole production	+	+	+	+	+	+	+	+	+	+
Motility	+	+	+	−	+	−	−	+	+	+
Urease production	−	−	−	−	+	+	+	−	−	−
Glucose	+	+	+	+	+	+	+	+	+	+
Lactose	+	+	ND	−	−	+	−	ND	+	+
Sucrose	(+)	(+)	ND	−	−	+	−	ND	(+)	+
Maltose	(+)	(+)	ND	(+)	−	+	−	ND	(+)	+
Melibiose	(+)	(+)	ND	(+)	−	+	−	ND	(+)	+
Cellobiose	−	−	ND	−	−	+	−	ND	−	17 *
Trehalose	+	+	ND	+	−	+	−	ND	+	+
Sorbitol	(+)	(+)	ND	(+)	−	+	−	ND	(+)	ND
Citrate	−	−	−	−	+	+	−	−	−	ND
Malonolate	−	−	ND	−	−	+	−	ND	−	ND
Mucate	+	+	(+)	(+)	ND	ND	ND	ND	+	ND
d-Adonitol	−	−	−	−	ND	ND	ND	ND	−	−
d-Arabitol	−	−	−	−	ND	ND	ND	ND	−	−

^A Numbers of isolates in each phenon shown in parentheses. +: positive reaction, −: negative reaction, (+): delayed positive reaction, ND: not determined. * Each number gives the percentage of positive reactions after 2 days of incubation at 37 °C.

shows the results of these tests used to identify the coliform phenons isolated from ice cream. In contrast to analyses using the proposed method, such as using media containing chromogenic substances, for example, LMX broth and Chromocult coliform agar, and long-wave 366 nm UV light, positive indole isolates, such as inactive E. coli, E. hermanii, Providencia rettgeri, K. oxytoca, and M. morganii, could interfere with the final result. Colorful ice creams, such as those containing saffron, cacao, strawberry, etc., may cause errors because they alter the color of the environment and interfere with the resulting fluorescence. As a result, vanilla ice cream was frequently used in the research. Other, more colorful, ice creams were also used, but due to the high dilution needed to resolve the problem of interference, the time to obtain results for the recommended method was extended. The results show that traditional ice cream contaminations conformed to Pourmahmoodi’s results [5].

Phenon 1 isolates were able to form metallic green colonies on Eosin methylene blue (EMB) and violet colonies on Chromocult coliform agar, as well as fluorescence color against a 366 nm UV lamp and positive methyl red. The production of negative movable acetoin were not able to hydrolyze urea or consume citrate. They could, however, hydrolyze lysine and ferment glucose under anaerobic conditions. Only 9% of phenon 1 isolates were able to hydrolyze gelatin, which differed from the standard isolate.

The phenon 2 strain displayed a green metallic sheen on EMB agar, which was different from the standard isolate. On MacConkey agar, however, all cases produced a red colony. On LMX broth, all isolates were blue, but none fluoresced against 366 nm UV. All isolates were motile, unable to hydrolyze urea, and unable to consume citrate, despite being positive for methyl and negative for acetoin. Furthermore, the isolates were unable to hydrolyze gelatin, move, or react with acid/acid + gas, which was similar to the standard isolate and whole-bacteria protein profiles. Nonetheless, the isolates of phenon 2 were not excessively fermented.

Phenon 3 isolates were unable to produce a green metallic sheen on EMB agar or red colonies on MacConkey agar. On Chromocult coliform agar, 50% of the isolates formed violet colonies (Merck, Darmstadt, Germany). All isolates produced a blue color in the LMX broth but did not fluoresce when exposed to a 366 nm UV lamp. On nutrient agar, all isolates had yellow pigment. They were unable to consume urea, produce acetoin, hydrolyze gelatin, or hydrolyze lysine. Furthermore, the acid/acid+gas reaction on triple sugar iron (TSI) agar, they produce a positive methyl-red test. These activities were very similar to E. heramanii.

Phenon 4 isolates did not have a green metallic sheen on EMB agar and could not form red colonies on MacConkey agar. These isolates did not hydrolyze urea and did not produce pigment. Furthermore, they were unable to consume citrate, were negative for methyl red, could not produce acetoin, and were immovable, all of which were similar to metabolically inactive E. coli strains based on biochemical tests, but were not E. coli. Phenon 5 isolates did not produce a green metallic sheen on EMB agar and did not form red colonies on MacConkey agar. Moreover, on Chromocult coliform agar, this strain was unable to form violet colonies and was unable to produce blue color and fluorescence in LMX broth. Besides that, in TSI agar, Phenon 5 hydrolyzed urea, consumed citrate, was positive methyl red, movable, and produced an alkaline/acid reaction.

In terms of urea hydrolysis, citrate consumption, the production of red colonies on MacConkey agar, and being negative for methyl red, the isolates of phenon 6 were comparable to the isolate of Klebsiella oxytoca. These isolates were immobile, produced acetoin, acid/acid + gas, and lysine hydrolysis.

The isolates of phenon 7 were very similar to the Morganella morganii isolate in terms of urea hydrolysis, a lack of citrate consumption, and a production of mixed acid (positive red methyl). However, these isolates were unable to produce acetoin, react with alkaline/acid in TSI agar, produce red colonies on MacConkey agar, exhibit metallic green on EMB agar, and emit blue color fluorescence LMX broth.

In the dendrogram of phenotypic characteristics, the isolates of phenon 8 had similar characteristics to M. morganii isolation in terms of the production of mixed acid (positive methyl red) and the alkaline/acid reaction. Urea hydrolysis was variable between the isolates, however. Because M. morganii lacked certain metabolic features and interacted with other Enterobacteriaceae family members, such as by sharing characteristics with E. coli that were metabolically inert, it was not classified as a recognized phenon.

3.2. Electrophoresis of Bacteria Proteins

The regression equation was used to determine the molecular weight of unknown bacterial proteins. The isolate proteins electrophoretically compared favorably to each other and to the standard E. coli ATCC 25922 isolate. However, some variations were also observed. Three isolates contained protein bands with sizes of 80.95, 24.35, 22.15, 17.75, and 12.15 kDa, which were not present in typical isolates. The 20.75 and 23.59 kDa bands were seen in isolate 42. These features differentiated the isolation from the standard. Protein bands measuring 16.66 kDa were present in isolates 5 and 8, which further identified them from the typical strain. Protein bands with a 9.73 kDa size were present in isolates 2, 4, 6, and 8, and they were unique from the reference strain (Figure 2). Protein electrophoresis revealed distinct protein bands for the isolates from traditional and commercial ice creams. Protein bands with sizes of 80.95, 24.35, 22.15, 17.75, and 12.15 kDa were seen in isolate 3, in contrast to the standard isolates. To compare the electrophoretic patterns of E. coli isolates with non-shock isolates, milk samples of E. coli that were directly isolated from livestock centers were utilized (Figure 3). After that, isolates of E. coli were found in milk following a thermal shock (Figure 4). The percentage of similarity could not be calculated precisely since the bands’ positions or severities varied.

3.3. Sequencing of 16S rDNA

The PCR products were identified and analyzed using agarose gel electrophoresis and ethidium bromide staining. After PCR amplification, the size of the amplified fragments (bp) was around 1500 bp (Supplementary Figure S1). The PCR product was first purified before sequencing. Sequencing was conducted using forward primer 27f, which corresponded with the Sanger method by the Macrogen Company (Seoul, South Korean). Therefore, the first 1000 nucleotides were preserved, and the last ones were eliminated. E. coli strain verified for all species. Despite the variations in biochemical testing and protein electrophoresis, all strains of E. coli can be said to be related based on the results of the multiple alignment program blast for the thousand base pair sequence of the 16S rRNA gene fragment (Supplementary Figure S2). The following Genbank accession codes for our nucleotide sequences make it possible to observe the strain-related sequences that were entered into the NCBI’s nucleotide database:

Seq1-KJ660333 (GI: 657085785), Seq2-KJ660334 (GI: 657085786), Seq3-KJ660335 (GI: 657085787), Seq4-KJ660336 (GI: 657085788), Seq5-KJ660337 (GI: 657085789), Seq6-KJ660338 (GI: 657085790), and Seq7-KJ660339 (GI: 657085791).

4. Discussion

The bacteria E. coli is typically detected in the intestines of animals. It is also pathogenic in addition to causing gastroenteritis, bacteremia, and urinary tract infections. Studies have shown that the bacteria is highly susceptible to selection pressure. It has also been shown that it is capable of picking up and transferring antibiotic resistance genes to and from other bacterial strains [36]. There are a number of ways in which bacteria can adapt to adverse or damaging conditions, such as acidic, heat-induced damage, cold-induced damage, starvation-induced damage, oxidative damage, envelope damage, and osmotic stress. The stress-triggered regulatory mechanisms have an impact on all aspects of bacterial survival, including adaptability, physiological alterations, virulence potential, and antibiotic resistance [12].

E. coli is shocked by the various temperature processes in milk, which forces it to make proteins as a result of changes in the production of the strain’s unique set of enzymes. Cells are visibly prompted to produce heat shock proteins (hsps) when they are exposed to greater temperatures. Almost all species have been identified to induce hsps in this way. In E. coli, about 20 hsps are known [37]. The induction of hsps in E. coli is accomplished by increasing hsp gene transcription, which is mediated by the rpoH, htpR, and hin regulatory gene products [38]. One of the issues in the world has always been the prevalence of infectious foodborne diseases, and treating these illnesses costs a great deal each year [37]. Due to its constituent ingredients and the conditions of its manufacturing and maintenance, ice cream has a significant potential for microbial contamination. This study was conducted to determine the phenotypic diversity of E. coli bacteria that commonly cause food contamination in the food production process. The level of microbial contamination in ice cream has been the subject of significant research, but phenotypic diversity and protein profiles, which were the subjects of this study, have received little attention to date. The majority of studies have approached food sample contamination from a health perspective, as shown by the examples in this paper; however, additional molecular studies are required at various points of different food samples. Nearly 60% of raw milk samples were found to be contaminated with E. coli, according to studies by Somur in Pakistan, and these isolates may have changed properties due to thermal processes, making it harder to identify in the final product [39]. It appears that some approaches take into account the design of impedance-based prediction models because of these diagnostic disparities [40]. A total of 90% of the E. coli isolated from raw milk has a typical form, and 10% of the strains are E. coli enterotoxigenic and enteroaggregative strains, according to molecular investigations conducted by Baniadian et al. [41]. As a result, while it is simpler to identify the typical form, and when food is contaminated by the typical form, there is also a possibility that it will be contaminated with potentially hazardous microorganisms.

The 39 physiological and biochemical tests, as well as protein profiles, revealed that the isolates were diverse. Using the numerical analysis of phenotypic characteristics, the samples were divided into eight phenons. Despite the variations in the findings of the biochemical and protein electrophoresis tests, the results of the blast and multiple alignments for the first 1000 bp of the 16S rDNA revealed that all strains were related to E. coli. Because identical conditions were utilized to conduct the PCR reaction in all stages and the use of appropriate primers, only one band, corresponding to 16S rDNA, was detectable in this investigation, and non-specific bands could not be obtained [42]. Thus, our findings showed that it is essential to provide a technique to identify the strain of E. coli in samples. When the number of bacteria in milk is minimal, it is important to detect pathogens early on in the development of an infection [43]. To prevent false negative results brought on by a lack of bacterial growth, PCR can be used to detect bacteria in milk that contain preservatives or residual therapeutic antibiotics [29]. To identify the E. coli strain, high sensitivity, specificity, and speed are also required. The findings of the current investigation show that isolated strains did not match the reference strain exactly. E. coli is an opportunistic pathogen that lives in both other animals and the human colon. Their fecal contamination is brought on by the presence of this bacterium in food and water. The protein profile of the isolates derived from ice cream differs from that of the milk, thus requiring further study, as evidenced by a comparison of electrophoretic patterns between samples of milk and ice cream. Future research is required to determine how much these conditions can alter the bacteria’s biochemical characteristics by using molecular methods to detect genetic alterations carried on by various heat treatments. Furthermore, it is essential to conduct additional analyses of the protein profiles using more accurate techniques, such as two-dimensional electrophoresis, and to learn about the protein sequencing and potential applications of it in the industry as natural antifreeze. In order to ascertain the extent to which various temperature processes are efficient in biochemical modifications, this investigation should be conducted on other pathogenic bacteria, and its acquired results should be compared with reference strain.

5. Conclusions

Considering that food is affected by different temperature processes. It seems that thermal shock causes changes in phenotypic characteristics, especially biochemical tests, and this causes problems in diagnosis. Therefore, diagnostic characteristics that receive the least impact from temperature shocks should be used. Considering that E. coli is the best indicator of fecal contamination and is usually checked in most foods, the characteristics of this bacterium that have less change compared to the reference strain can be used for more reliable diagnosis. Of course, depending on the type of stress, including acid-stress, heat- and cold-stress, starvation-stress, oxidative-stress, envelope-stress-mediated preservative resistance, osmotic-stress, etc., its characteristics may change, which should be considered. The results of the present study indicated that isolated strains did not completely match the reference strain. Results from biochemical tests and protein showed heterogeneous isolates. Our findings revealed that only one band related to 16S rDNA was identifiable and non-specific bands could not be observed. Sensitivity, specificity, and the high rapidity in achieving results are regarded as the advantages of PCR. Based on this, it could be possible to immediately make use of a suitable protective measure for the purpose of diagnosing this type of bacteria, especially in especial environments.