Influence of Essential Oils on Inhibiting Biogenic Amine-Producing Bacteria in Xinjiang Smoked Horsemeat Sausage

Abstract

(1) Background: Xinjiang smoked horsemeat sausage is a popular food; however, bio-genic amine (BA) production is a concern for food safety. (2) Methods: the present study selected the three most toxic BAs for food safety (histamine, tyramine, and putrescine) and determined the bacteria that produce them. (3) Results: After 24 h of incubation, fifteen isolated strains, especially Enterobacter ludwigii MT705841 and Enterobacter bugandensis MT705832 produced putrescine (485.52 μg/mL and 408.95 μg/mL, respectively, p < 0.05); eight isolated strains, especially Proteus vulgaris MT705833 and Bacillus subtilis MT705839 produced histamine (63.86 μg/mL and 30.40 μg/mL, respectively, p < 0.05); and 14 isolated strains, especially Staphylococcus saprophyticus MT705831 and Proteus penneri MT705835 produced tyramine (482.26 μg/mL and 497.76 μg/mL, respectively, p > 0.05). Artemisia oil moderately inhibited P. vulgaris MT705833 and B. subtilis MT705839 after 48 h of in vitro incubation, decreasing histamine production by 44.83% and 47.92% for these two bacteria after 24 h and 20 h of incubation, respectively. Cinnamon oil strongly inhibited putrescine production by E. bugandensis MT705832 and E. ludwigii MT705841, decreasing production by 96.63% and 92.03% for these two bacteria after 24 h of incubation, respectively. Grapeseed oil slightly inhibited P. penneri MT705835 tyramine production (only after 4 h of incubation) and had an unstable inhibitory effect on Citrobacter freundii MT705836 tyramine production. (4) Conclusions: the results of this study suggest that cinnamon oil can be an effective food additive for the prevention of BA production in Xinjiang smoked sausages.

1. Introduction

Xinjiang smoked horsemeat sausage is popular because of its taste and flavor; how-ever, harmful substances—such as biogenic amines (BAs)—are produced during natural fermentation, creating concern for food safety [1]. During sausage fermentation, BAs primarily respond to decarboxylation by certain microorganisms [2]. After fermentation, BAs are still present in food during storage, and some BAs, such as histamine, exceed the toxicity limit [3]. Histamine and tyramine are the most studied biogenic amines because of their causative effects (scombroid poisoning) and food-induced migraines, respectively, followed by putrescine, which can increase toxicity in the body [4].

Histamine formation in meat products is mainly due to specific histidine decarboxylase (HDC) activity in the Enterobacteriaceae family [5]; however, other genera, such as Pseudomonas and Staphylococcus, can also produce histamine [6]. Putrescine formation in fermented sausages is likely through phenylalanine decarboxylation by some bacteria, such as Enterobacter and Lactobacilli [7]. In addition, some bacteria show high tyramine formation activity, and have a moderate capacity to decarboxylate phenylalanine [3]. Essential oils are a major source of antimicrobial compounds that can be used for food preservation [8]. The main constituents of many essential oils are terpenes [9], which show strong activity against Escherichia coli, Staphylococcus aureus, Bacillus subtilis, and Proteus mirabilis [10,11]. Essential oils are extracted from different plants, such as Mentha spicata, Rosmarinus officinalis, and Origanum vulgare, and have a strong ability to decrease histamine, tyramine, and putrescine formation [8]. However, few studies have investigated BA production in smoked horsemeat sausages. Therefore, the present study selected the three most toxic BAs, which are histamine, tyramine, and putrescine, to determine which bacteria produce them and elucidate the mechanism of production through gene expression. Second, this study aimed to investigate the effect of essential oils on BA production.

2. Materials and Methods

Fifty samples of smoked horsemeat sausages (average of pH was 5.69, contained 38.54% of moisture) were collected from different areas (Ili, Bole, Tacheng, Altay, Changji, and Urumqi) in North Xinjiang, China. The average fermentation time of these sausages was 30 days, and the specific methods for sausage pro-duction are presented in the Supplementary Materials. All reagents were purchased from Sigma-Aldrich (Beijing, China) unless otherwise stated.

2.1. Isolation and Identification of the Dominant Bacteria Producing BAs in Xinjiang Smoked Horsemeat Sausage

Twenty grams of each sausage sample was collected in a sterile environment. Using the screening plate method for bacterial BA production selection [4]. Briefly, 20 g of each sample was added 180 mL of distill water, the 1 mL of these mixture was collected after enrichment of these microbial at 30 °C for 24 h (Lab-Lemco, Thermo Scientific, Waltham, MA, USA). Then, diluted concentration of mixture at 10⁻⁵–10⁻¹ and plated into lower layer isolation medium of amine producing bacteria and culture at 30 °C for 72 h, pour one layer of corresponding upper culture medium (50 °C) onto the lower culture medium for color reaction for 5 min, the positive bacteria (color reaction: purple) were collected for the next bacterial isolation test. The bacteria were collected for 16S rRNA sequence analysis by Sangon Biotechnology (Shanghai, China). The primers used for polymerase chain reaction (PCR) amplification were 27F: 5′-GCAGAGTTCTCGGAGTCACGAAGAGTTTGATCCTGGCTCAG-3′ and 1492R: 5′-AGCGGATCACTTCACACAGGACTACGGGTACCTTGTTACGA-3′. Nucleotide sequence data for these bacteria have been deposited at the National Center for Biotechnology Information. The specific numbers of these bacteria are presented in Table S1.

2.2. Detection of Genes for Amino Acid Decarboxylase in Bacteria

Three amino acid decarboxylases were detected by PCR using a PCR-Cycler (Bio-Rad, Model: T100 Thermal Cycler), as shown in

Table 1. Procedures of PCR for amino acid decarboxylases.

Enzymes	Primer	Sequence (5′-3′)	Procedures of PCR
agmatine deiminase [12]	AguA-F/R	GACTGGACDTTYAAGGS/YTGGGG TGYTGRGTRATRCARTGR	A
histidine decarboxylase [13]	Hdc_2F/R	TGGGGTTATGTSACCATTGG GTRTGGCCGTTACGYGARCC	B
tyrosine decarboxylase [14]	Tdc-F/R	AACTATCGTATGGATATCAACG TAGTCAACCATATTGAAATCTGG	C

A: 5 min at 95 °C for denaturation, 40 cycles at 94 °C for 1 min, 1 min at 53 °C, and 72 °C for 2 min followed by 10 min at 72 °C; B: 35 cycles consisting of denaturation at 94 °C for 1 min, annealing at 54 °C for 1 min, and extension at 72 °C for 1 min; C: 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 60 °C for 30 s.

.

2.3. Analysis BA Production in Isolated Bacterial Strains from Xinjiang Smoked Horsemeat Sausage

Isolated strains were inoculated in nutrition broth (containing 0.05% of arginine, histidine, and tyrosine and 0.005% of pyridoxal phosphate, v:v). Broth (5 mL) was collected after 24 h of incubation at 37 °C. The supernatant (1 mL) was centrifuged at 12,000 r/min for 10 min. Then, 1 mL of perchloric acid (concentration: 0.4 mol/L) was added, and histamine, tyramine, and putrescine were detected using high-performance liquid chromatography (HPLC, Waters, Model: E2998), as previously described [1]. The HPLC conditions were as follows: chromatographic column (Agilent, Model: ZORBAX Eclipse XDB-C18, 4.6 mm × 250 mm, 5 µm), mobile phase A was water, and mobile phase B was acetonitrile; flow rate of 0.4 mL/min; injection volume of 5 μL; column temperature of 30 °C; wave-length of 254 nm.

2.4. Determining the Minimal Inhibitory Concentration of Essential Oils on Specific Bacterial BA Production

Bacteria with a high BA production capacity were selected based on the results of BA production by specific bacteria. Artemisia, cinnamon, and grapeseed essential oils inhibit bacterial histamine, putrescine, and tyramine production. The broth dilution method [15] was used to determine the minimum inhibitory concentration (MIC) of essential oils against each bacterial strain, cultured at 30 °C for 24 h (Artemisia oil treatment was used strain of P. vulgaris MT705833 and B. subtilis MT705839, cinnamon oil treatment was used strain of E. bugandensis MT705832 and E. ludwigii MT705841, and grapeseed oil treatment was used strain of P. penneri MT705835 and C. freundii MT705836).

2.5. Determining the Effect of Essential Oil on Specific Bacterial Growth

Bacteria with a high BA production capacity were selected based on the results of BA production by specific bacteria. Artemisia, cinnamon, and grapeseed are essential oils that inhibit histamine, putrescine, and tyramine production. Grapeseed oil contains two main components 1,2-benzenedicarboxylic acid (67.13%) and dioctyl phthalate (22.87%). Artemisia oil contain four main components including capillene (73.38%), β-pinene (8.51%), trans-ocimene (4.11%) and eugenol (3.24%). Cinnamon oil contain four main components, including E-cnnamaldehyde (62.96%), α-cubebene (6.76%), α-calacorene (6.12%) and copaene (5.33%). These essential oils were purchased from local market (Shihezi, China). Each isolate was cultured in nutrient broth (containing 0.05% of arginine, histidine, and tyrosine, respectively, and 0.005% of pyridoxal phosphate, v:v). Control and essential oil (artemisia, cinnamon, and grapeseed essential oil)-treated groups were established. Each essential oil concentration was determined according to the MIC results. The OD600 and pH (PH Meter [DENVER INSTRUMENT, Model: UB-7]) were determined after incubating each strain for 0, 4, 8, 12, 16, 20, 24, 28, 32, 36, 40, 44, and 48 h, respectively.

2.6. Determining the Effect of Essential Oil on Gene Expression in Specific Bacteria

RT-qPCR was used to quantify gene expression relative to histamine, tyramine, and putrescine production in specific bacteria using a multiplex quantitative PCR system (STRATAGENE, Model: Mx 3000P). The reagents included TRIzol (Invitrogen), EvaGreen 2× qPCR MasterMix-No Dye (ABM), and 5× All-In-One RT Master Mix (ABM). Primer information for each gene is provided in the Supplementary Materials. Results were obtained using the 2^−ΔΔCt method [16].

2.7. Statistical Analysis

The characteristic data from the present study were analyzed using a one-way analysis of variance. Data were analyzed using SPSS software (IBM SPSS 22.0, New York, NY, USA). Data were analyzed using IBM SPSS 22 Statistics (IBM Corp., Armonk, NY, USA). Significant differences between treatments were determined using Tukey’s t-test, and significance was set at p < 0.05.

3. Results

3.1. Dominant Bacteria Producing BA in Xinjiang Smoked Horsemeat Sausage

As shown in Figure 1, a total of 16 strains of bacteria (biogenic amines production) were identified.

Fifteen strains (Enterococcus faecalis MT705828, Enterobacter hormaechei MT705829, Enterobacter hormaechei MT705830, Staphylococcus saprophyticus MT705831, Enterobacter bugandensis MT705832, Proteus vulgaris MT705833, Proteus penneri MT705834, Citrobacter freundii MT705836, Enterobacter cloacae MT705837, Enterococcus faecalis MT705838, Bacillus subtilis MT705839, Enterobacter bugandensis MT705840, Enterobacter ludwigii MT705841, Enterobacter hormaechei MT705842, and Bacillus subtilis MT705843) produced putrescine because they had the AguA gene (750–1000 bp) (Figure 2, original gel can be found in Figure S2). Eight strains (S. taphylococcus saprophyticus MT705831, P. vulgaris MT705833, P. penneri MT705834, P. penneri MT705835, E. cloacae MT705837, E. faecalis MT705838, B. subtilis MT705839, and E. hormaechei MT705842) harbored the Hdc_2 gene (1380 bp) and produced histamine. Fourteen strains (E. faecalis MT705828, E. hormaechei MT705829, E. hormaechei MT705830, S. saprophyticus MT705831, E. bugandensis MT705832, P. vulgaris MT705833, P. penneri MT705835, C. freundii MT705836, E. cloacae MT705837, E. faecalis MT705838, B. subtilis MT705839, E. bugandensis MT705840, E. hormaechei MT705842, and B. subtilis MT705843) produced tyramine, as these bacteria had the Tdc gene (720 bp).

Most of the isolated bacteria showed a higher capacity to produce tyramine (68.75% produced > 170 μg/mL of tyramine) (Figure 3). S. saprophyticus MT705831, P. vulgaris MT705833, E. cloacae MT705837, E. faecalis MT705838, B. subtilis MT705839, and E. hormaechei MT705842 produced putrescine, histamine, and tyramine. E. ludwigii MT705841 showed the highest capacity to produce putrescine, followed by E. bugandensis MT705832 (p < 0.05). P. vulgaris MT705833 showed the highest capacity to produce histamine, followed by E. faecalis MT705838 and B. subtilis MT705839 (p < 0.05). S. saprophyticus MT705831 and P. penneri MT705835 showed the highest capacity to produce tyramine (482.26 μg/mL and 497.76 μg/mL, respectively, p > 0.05), followed by C. freundii MT705836 (p > 0.05).

The MIC of cinnamon oil was 0.0391% (v:v), which showed inhibitory effects against E. bugandensis MT705832 and E. ludwigii MT705841. The MIC of artemisia oil was 0.0195% (v:v), which inhibited P. vulgaris MT705833 and B. subtilis MT705839 growth, and the MIC of grapeseed essential oil was 0.0391% (v:v), which had inhibitory effects against P. penneri MT705835 and C. freundii MT705836.

Compared to each control, cinnamon oil treatment decreased the OD600 value in E. bugandensis MT705832 after 48 h of incubation, but increased the OD600 value in E. ludwigii MT705841 after 48 h of incubation (Figure S3). Artemisia oil treatment decreased the OD600 value in P. vulgaris MT705833 during 48 h of incubation but increased it in B. subtilis MT705839 after 36 h of incubation. Grape-seed oil treatment decreased the OD600 value in P. penneri MT705835 and C. freundii MT705836 after 48 h of incubation. Cinnamon oil treatment decreased the pH of E. bugandensis MT705832 after 12 h and 24–32 h of incubation and decreased the pH of E. ludwigii MT705841 after 8 h of incubation (Figure S4). Artemisia oil treatment did not affect the pH of P. vulgaris MT705833 during 48 h of incubation, but decreased the pH of B. subtilis MT705839 after 16 and 20 h of incubation, respectively. Grapeseed essential oil increased the pH of P. penneri MT705835 after 4 and 16 h of incubation but decreased it after 36–44 h of incubation; however, no effect was observed on C. freundii MT705836.

3.2. Effect of Essential Oils on BA Production by Strains Isolated from Xinjiang Smoked Horsemeat Sausage

When only considering the strain, E. ludwigii MT705841 had a greater capacity to produce putrescine than Enterobacter bugandensis MT705832, as it still produced higher levels of putrescine after incubation for 28 h (p < 0.05) (Figure 4). The same effect was observed after cinnamon oil treatment, which inhibited putrescine production in E. ludwigii MT705841, as putrescine production was only inhibited in this strain when compared with the control after 28 h of incubation (p < 0.05).

When considering the strain only, P. vulgaris MT705833 had a high capacity for histamine production after 4 h of incubation when compared with B. subtilis MT705839 (281.28 μg/mL vs. 11.87 μg/mL, p < 0.05). The histamine concentration was 100 μg/mL in B. subtilis MT705839 after 20 h of incubation. Treatment with artemisia oil inhibited histamine production after 4, 8, 24, and 28 h, but increased it after 12, 16, and 20 h of incubation in P. vulgaris MT705833. However, essential oil treatment only had an inhibitory effect on B. subtilis MT705839 after 20 h of incubation when compared with the control (p < 0.05).

When considering the strain only, C. freundii MT705836 had a higher capacity for tyramine production during 20 h of incubation than P. penneri MT705835 (133.72–4761.23%, p < 0.05). Treatment with grapeseed oil only decreased 38.88% of tyramine production after 4 h of incubation in P. penneri MT705835 when compared to the control (p < 0.05). However, tyramine production decreased by 42.09% and 45.05% after 4 and 8 h of incubation in C. freundii MT705836, respectively, when compared with the control (p < 0.05).

For putrescine, cinnamon oil treatment reduced AguR gene expression, and the reduced level of gene expression in E. bugandensis MT705832 was higher than that in E. ludwigii MT705841 (p < 0.05). In contrast, essential oil treatment increased AguB expression in E. ludwigii MT705841 but decreased it in E. bugandensis MT705832 (Figure 5). For histamine, artemisia treatment decreased hdcA, hdcP, and hdcRS expression and had a higher impact on B. subtilis MT705839 than on P. vulgaris MT705833 (p < 0.05). In contrast, artemisia oil treatment increased hdcB expression in P. vulgaris MT705833 but decreased it in B. subtilis MT705839. For tyramine, grapeseed oil treatment decreased tyrDC, tyrP, and nhaC ex-pression, whereas it increased tyrS expression in P. penneri MT705835 but decreased it in C. freundii MT705836.

4. Discussion

Enterobacteriaceae are the most common bacteria used for BA production in sausage [3]. In this study, 68.75% of isolated strains that produced BAs belonged to the Enterobacteriaceae family (mainly Enterobacter spp.). Among these, 27.27% of strains produced histamine, tyramine, and putrescine, and 45.46% produced tyramine and putrescine. Enterobacteriaceae strains produce BAs during the first step of sausage production or in fermented products [3]. In addition, Staphylococcus is the dominant genus during fermentation and storage in Xinjiang smoked horsemeat sausages [1]. In the present study, one Staphylococcus strain MT705831 was isolated, and it produced histamine, tyramine, and putrescine. These results indicate that Staphylococcus is the most crucial bacterium for food safety when considering BA levels in smoked horsemeat sausage.

Tyramine and histamine are the most toxic BAs in terms of food safety [17]. Normal metabolic mechanisms cannot detoxify histamine when a high concentration of this BA (>100 mg/kg) is consumed, resulting in neurological and gastrointestinal reactions such as headache, nausea, and vomiting. Furthermore, tyramine has a rapid effect on the body, such as migraine, neurological disorders, and respiratory reactions [18]. Legislation for fish and its products was only set for histamine by the European Union (EU) and the US Food and Drug Administration (200–400 mg/kg and 500 mg/kg, respectively) [19]. In this study, seven strains (including S. saprophyticus MT705831, P.vulgaris MT705833, P. penneri MT705835, E. cloacae MT705837, E. faecalis MT705838, B. subtilis MT705839, and E. hormaechei MT705842) produced histamine, ranging from 8.42 to 63.85 mg/L. These results suggest that the isolated strains were safe for use in sausage. However, in the present study, 43.75% of isolated strains produced >400 mg/L of tyramine under culture conditions, which could reach the limit recommended by the EU for food safety [17]. Histamine usually leads to cell death through apoptosis, whereas tyramine has a rapid effect on cell necrosis [20]. Synergistic toxicity to cells was observed between histamine and tyramine, which was probably due to tyramine facilitating the access of histamine into the cells. Toxicity increased when histamine was below the legal limit; however, tyramine reached the safety limit [19]. In the present study, bacteria produced high levels of tyramine (>400 mg/L) and low levels of histamine (8.42–63.85 mg/L). These results suggest that S. saprophyticus MT705831, P. penneri MT705835, E. faecalis MT705838, and E. hormaechei MT705842 are essential for sausage safety. Staphylococcus saprophyticus is one of the species that is frequently used in commercial starter cultures in dry sausage processing [21]. Forty-nine S. saprophyticus strains from meju and doenjang (Korean fermented soybean foods that are used as starters) were tested, and showed no capacity to produce histamine. However, the strains produced a low level of tyramine and a high level of putrescine [22]. In contrast, S. saprophyticus isolated from fish samples produced histamine [23]. Thus, S. saprophyticus isolated from different materials has various capacities to produce BAs. Therefore, the results of the present study suggest that S. saprophyticus requires attention when used as a starter in sausage production. Notably, BA production was significantly decreased by combined inoculation of Lactobacilli farciminis and S. saprophyticus in sausage production after 28 days of fermentation (decreased by 66.14%, 99.08%, and 83.41% for putrescine, histamine, and tyramine, respectively) [24]. However, the synergistic effect of these bacteria in sausage production requires further study.

Putrescine is less toxic than histamine and tyramine, usually because of its long-term effects. Putrescine is a potential precursor of carcinogenic nitrosamines, especially in meat products with added nitrate and nitrite salts [25]. Furthermore, putrescine increases histamine and tyramine toxicity by inhibiting BA degradation and decreasing the activity of related metabolic enzymes [26]. In the present study, 15 strains isolated from Xinjiang sausages produced putrescine, and strains E. faecalis MT705838, E. bugandensis MT705832, and E. ludwigii MTMT705841 showed the greatest capacity.

In this study, artemisia oil treatment was used to inhibit histamine production by strains of P. vulgaris MT705833 and B. subtilis MT705839, cinnamon oil was used to inhibit putrescine production by strains of E. bugandensis MT705832 and E. ludwigii MT705841, and grapeseed oil was used to inhibit tyramine production by strains of P. penneri MT705835 and C. freundii MT705836. Histamine production by HDC involves the hdcA, hdcB, hdcP, and hdcRS genes, which respond to HDC, histidine/histamine protein, and histidyl-tRNA synthetase [27]. Various factors affect histamine production via the expression of the HDC gene cluster, with pH being the main factor [28]. Under low pH conditions, bacteria resist prevailing acidic stress through the histamine production pathway to consume intracellular protons [29]. In the present study, the pH was greater than six, and was not affected by artemisia oil treatment. Artemisia oil treatment decreased hdcA, hdcP, and hdcRS gene expression in P. vulgaris MT705833 and B. subtilis MT705839, whereas it increased hdcB expression in P. vulgaris MT705833 but decreased it in B. subtilis MT705839. Similarly, hdcA and hdcP expression was highly inhibited in P. bacillus strain when thyme essential oil was inoculated into Xinjiang sausages [28]. Notably, artemisia oil showed an unstable inhibitory effect on P. vulgaris MT705833 and B. subtilis MT705839 in vitro incubation, which decreased histamine production by 44.83% and 47.92% after 24 and 20 h of incubation, respectively. Artemisia extract maintains low levels of histamine-forming bacteria during fish storage [30]. Thus, the results of the present study suggest that artemisia oil treatment inhibits histamine production by different bacteria during sausage processing.

Putrescine is produced through the agmatine deiminase (AGDI) pathway by the AguR and AguBDAC gene clusters. AguR acts as a regulator of agmatine concentration in the medium and regulates AguBDAC expression, which is commonly observed in lactic acid bacteria [31]. However, these genes are rarely observed in Enterobacter spp., and only one study has reported that AGDI (AguA) genes are present in Enterobacter spp. during wine fermentation [32]. To the best of our knowledge, this study is the first to report AguR and AguB genes in Enterobacter spp. isolated from sausages. In the present study, cinnamon oil treatment decreased AguR gene expression in E. bugandensis MT705832 and E. ludwigii MT705841 increased AguB expression in E. ludwigii MT705841, and decreased it in E. bugandensis MT705832. The AGDI pathway plays a vital role in the defense against acidic environments [33]. AguR expression was not affected; however, AguB was upregulated 170-fold under acidic conditions (pH 5) compared to neutral pH in Lactococcus lactis [31]. In the present study, the pH was >5 in the control and cinnamon oil-treated E. bugandensis MT705832 and E. ludwigii MT705841 after 48 h of incubation. Thus, the essential oil was assumed to be the primary factor affecting gene expression relative to the AGDI pathway. Consequently, cinnamon oil showed a stabilized inhibitory effect on E. bugandensis MT705832 and E. ludwigii MT705841, decreasing putrescine production by 96.63% and 92.03% after 24 h of incubation, respectively. These results suggest that cinnamon oil has an excellent inhibitory effect on BA production in E. bugandensis MT705832 compared to E. ludwigii MT705841 through decreased AguR and AguB expression.

Tyrosine decarboxylase (TDC) enzymes mediate tyramine production, and TDC enzymes have only been identified and characterized in Gram-positive bacteria [34]. Proteus penneri and C. freundii are Gram-negative bacteria [35,36]. Thus, the present study is the first to observe relative TDC genes in Gram-negative bacteria isolated from sausages. Similarly to the gene expression results, few studies have observed that these strains could pro-duce BAs, especially P. penneri. Only one previous study has reported that some P. penneri strains can produce tyramine in brain heart infusion broth [37]. Citrobacter freundii produces tyramine [37,38,39]. In the present study, grapeseed oil treatment decreased TyrDC, TyrP, and NhaC gene expression in one P. penneri MT705835 and C. freundii MT705836, whereas it increased TyrS expression in P. penneri MT705835 but decreased it in C. freundii MT705836. However, grapeseed oil treatment showed little inhibitory effect on P. penneri MT705835 tyramine production and had an un-stable inhibitory effect on C. freundii MT705836.

5. Conclusions

Most of the isolated strains from Xinjiang sausage had a high capacity to produce BAs, some of which, such as S. saprophyticus MT705831 and P. penneri MT705835, must be considered for food safety. In particular, S. saprophyticus MT705831, P. penneri MT705835, and C. freundii MT705836 had a high capacity to produce tyramine; E. bugandensis MT705832 and E. ludwigii MT705841 showed a high capacity to produce putrescine; and P. vulgaris MT705833 and B. subtilis MT705839 showed a high capacity to produce histamine.

Artemisia oil treatment moderately inhibited histamine production by inhibiting hdcA and hdcP expression in P. vulgaris MT705833 and B. subtilis MT705839. Cinnamon oil treatment strongly inhibited putrescine production by inhibiting AguR and AguB expression in E. bugandensis MT705832 and E. ludwigii MT705841. Grapeseed oil treatment had a mild inhibitory effect on tyramine production by inhibiting TyrDC, TyrP, and NhaC expression in P. penneri MT705835 and C. freundii MT705836.