A Multiplex PCR Melting-Curve-Analysis-Based Detection Method for the Discrimination of Five Aspergillus Species
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Species and Biological Material
2.2. Primer Design
2.3. qPCR Reaction
2.4. Efficiency and Sensitivity of the Method
2.5. Specificity of the Method
2.6. In Silico Evaluation of Primers
3. Results
3.1. Optimization of Multiplex Real-Time PCR
3.2. Sensitivity of Multiplex qPCR
3.3. Specificity
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Paulussen, C.; Hallsworth, J.E.; Álvarez-Pérez, S.; Nierman, W.C.; Hamill, P.G.; Blain, D.; Rediers, H.; Lievens, B. Ecology of Aspergillosis: Insights into the Pathogenic Potency of Aspergillus fumigatus and Some Other Aspergillus Species. Microb. Biotechnol. 2017, 10, 296–322. [Google Scholar]
- Mousavi, B.; Hedayati, M.T.; Hedayati, N.; Ilkit, M.; Syedmousavi, S. Aspergillus Species in Indoor Environments and Their Possible Occupational and Public Health Hazards. Curr. Med. Mycol. 2016, 2, 36–42. [Google Scholar] [CrossRef] [PubMed]
- Latgé, J.-P.; Chamilos, G. Aspergillus fumigatus and Aspergillosis in 2019. Clin. Microbiol. Rev. 2019, 33, e00140-18. [Google Scholar] [CrossRef] [PubMed]
- CDC. CDC: Aspergillosis Statistics; Centers for Disease Control and Prevention: Atlanta, GA, USA, 2017. [Google Scholar]
- Cadena, J.; Thompson, G.R., 3rd; Patterson, T.F. Aspergillosis: Epidemiology, Diagnosis, and Treatment. Infect. Dis. Clin. N. Am. 2021, 35, 415–434. [Google Scholar] [CrossRef]
- Lai, C.-C.; Yu, W.-L. COVID-19 Associated with Pulmonary Aspergillosis: A Literature Review. J. Microbiol. Immunol. Infect. 2021, 54, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Jenks, J.D.; Nam, H.H.; Hoenigl, M. Invasive Aspergillosis in Critically Ill Patients: Review of Definitions and Diagnostic Approaches. Mycoses 2021, 64, 1002–1014. [Google Scholar] [CrossRef] [PubMed]
- Kariyawasam, R.M.; Dingle, T.C.; Kula, B.E.; Vandermeer, B.; Sligl, W.I.; Schwartz, I.S. Defining COVID-19-Associated Pulmonary Aspergillosis: Systematic Review and Meta-Analysis. Clin. Microbiol. Infect. 2022, 28, 920–927. [Google Scholar] [CrossRef]
- Chong, W.H.; Neu, K.P. Incidence, Diagnosis and Outcomes of COVID-19-Associated Pulmonary Aspergillosis (CAPA): A Systematic Review. J. Hosp. Infect. 2021, 113, 115–129. [Google Scholar] [CrossRef]
- Verweij, P.E.; Rijnders, B.J.A.; Brüggemann, R.J.M.; Azoulay, E.; Bassetti, M.; Blot, S.; Calandra, T.; Clancy, C.J.; Cornely, O.A.; Chiller, T.; et al. Review of Influenza-Associated Pulmonary Aspergillosis in ICU Patients and Proposal for a Case Definition: An Expert Opinion. Intensive Care Med. 2020, 46, 1524–1535. [Google Scholar] [CrossRef] [PubMed]
- Feys, S.; Gonçalves, S.M.; Khan, M.; Choi, S.; Boeckx, B.; Chatelain, D.; Cunha, C.; Debaveye, Y.; Hermans, G.; Hertoghs, M.; et al. Lung Epithelial and Myeloid Innate Immunity in Influenza-Associated or COVID-19-Associated Pulmonary Aspergillosis: An Observational Study. Lancet Respir. Med. 2022, 10, 1147–1159. [Google Scholar] [CrossRef]
- Harun, S.N.; Holford, N.H.G.; Grimwood, K.; Wainwright, C.E.; Hennig, S. Pseudomonas Aeruginosa Eradication Therapy and Risk of Acquiring Aspergillus in Young Children with Cystic Fibrosis. Thorax 2019, 74, 740–748. [Google Scholar] [CrossRef] [PubMed]
- De Baets, F.; De Keyzer, L.; Van Daele, S.; Schelstraete, P.; Van Biervliet, S.; Van Braeckel, E.; Thomas, M.; Wanyama, S.S. Risk Factors and Impact of Allergic Bronchopulmonary Aspergillosis in Pseudomonas Aeruginosa-Negative CF Patients. Pediatr. Allergy Immunol. 2018, 29, 726–731. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Xiong, X.; Han, Q.; Zhuo, K.; Wang, K.; Cheng, D. Instillation of Amphotericin B by Bronchoscopy Combined with Systemic Voriconazole in Advanced Non-Small Cell Lung Cancer Patients with Chronic Cavitary Pulmonary Aspergillosis: A Case Series and Literature Review. J. Mycol. Med. 2023, 33, 101385. [Google Scholar] [CrossRef] [PubMed]
- Allwood, B.W.; Byrne, A.; Meghji, J.; Rachow, A.; van der Zalm, M.M.; Schoch, O.D. Post-Tuberculosis Lung Disease: Clinical Review of an Under-Recognised Global Challenge. Respiration 2021, 100, 751–763. [Google Scholar] [CrossRef]
- Gaffney, S.; Kelly, D.M.; Rameli, P.M.; Kelleher, E.; Martin-Loeches, I. Invasive Pulmonary Aspergillosis in the Intensive Care Unit: Current Challenges and Best Practices. APMIS 2023. [Google Scholar] [CrossRef]
- Sugui, J.A.; Kwon-Chung, K.J.; Juvvadi, P.R.; Latgé, J.-P.; Steinbach, W.J. Aspergillus fumigatus and Related Species. Cold Spring Harb. Perspect. Med. 2014, 5, a019786. [Google Scholar] [CrossRef]
- Buzina, W. Aspergillus–Classification and Antifungal Susceptibilities. Curr. Pharm. Des. 2013, 19, 3615–3628. [Google Scholar] [CrossRef]
- Altayyar, I.A.; Farge Elbreki, M.; Alsharef, S.A.; Mohammed, H.M.; Alemam, R. Incidence of Aspergillus Species in Hospital Environment. Int. J. Appl. Med. Biol. Res. 2017, 2, 22–27. [Google Scholar]
- Anaissie, E.J.; Stratton, S.L.; Dignani, M.C.; Summerbell, R.C.; Rex, J.H.; Monson, T.P.; Spencer, T.; Kasai, M.; Francesconi, A.; Walsh, T.J. Pathogenic Aspergillus Species Recovered from a Hospital Water System: A 3-Year Prospective Study. Clin. Infect. Dis. 2002, 34, 780–789. [Google Scholar] [CrossRef]
- Martínez-Herrera, E.O.; Frías-De-León, M.G.; Duarte-Escalante, E.; Calderón-Ezquerro, M.d.C.; Jiménez-Martínez, M.d.C.; Acosta-Altamirano, G.; Rivera-Becerril, F.; Toriello, C.; Reyes-Montes, M.d.R. Fungal Diversity and Aspergillus Species in Hospital Environments. Ann. Agric. Environ. Med. 2016, 23, 264–269. [Google Scholar] [CrossRef]
- Mandel, G.L.; Bennet, J.E. Bennett’s Principles and Practice of Infectious Diseases. Phila. Churchill Livingstone 2010, 3495, 522. [Google Scholar]
- Reichert-Lima, F.; Lyra, L.; Pontes, L.; Moretti, M.L.; Pham, C.D.; Lockhart, S.R.; Schreiber, A.Z. Surveillance for Azoles Resistance in Aspergillus spp. Highlights a High Number of Amphotericin B-Resistant Isolates. Mycoses 2018, 61, 360–365. [Google Scholar] [CrossRef] [PubMed]
- Perrone, G.; Susca, A.; Cozzi, G.; Ehrlich, K.; Varga, J.; Frisvad, J.C.; Meijer, M.; Noonim, P.; Mahakamchanakul, W.; Samson, R.A. Biodiversity of Aspergillus Species in Some Important Agricultural Products. Stud. Mycol. 2007, 59, 53–66. [Google Scholar] [CrossRef]
- Mahato, D.K.; Lee, K.E.; Kamle, M.; Devi, S.; Dewangan, K.N.; Kumar, P.; Kang, S.G. Aflatoxins in Food and Feed: An Overview on Prevalence, Detection and Control Strategies. Front. Microbiol. 2019, 10, 2266. [Google Scholar] [PubMed]
- Varga, J.; Baranyi, N.; Chandrasekaran, M.; Vágvölgyi, C.; Kocsubé, S. Mycotoxin Producers in the Aspergillus Genus: An Update. Acta Biol. Szeged. 2015, 59, 151–167. [Google Scholar]
- Medina, A.; Gilbert, M.K.; Mack, B.M.; OBrian, G.R.; Rodríguez, A.; Bhatnagar, D.; Payne, G.; Magan, N. Interactions between Water Activity and Temperature on the Aspergillus flavus Transcriptome and Aflatoxin B1 Production. Int. J. Food Microbiol. 2017, 256, 36–44. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Zheng, L.; Zhu, Y.; Zhang, J.; Wen, H.; Huang, J.; Niu, J.; Zhao, X.; Li, Q. Multicolor Combinatorial Probe Coding for Real-Time PCR. PLoS ONE 2011, 6, e16033. [Google Scholar] [CrossRef] [PubMed]
- Saunders, N.A. Real-Time PCR BT—Genomics, Proteomics, and Clinical Bacteriology: Methods and Reviews; Woodford, N., Johnson, A.P., Eds.; Humana Press: Totowa, NJ, USA, 2004; pp. 191–211. ISBN 978-1-59259-763-5. [Google Scholar]
- Kralik, P.; Ricchi, M. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything. Front. Microbiol. 2017, 8, 108. [Google Scholar] [CrossRef] [PubMed]
- Tsuji, S.; Iguchi, Y.; Shibata, N.; Teramura, I.; Kitagawa, T.; Yamanaka, H. Real-Time Multiplex PCR for Simultaneous Detection of Multiple Species from Environmental DNA: An Application on Two Japanese Medaka Species. Sci. Rep. 2018, 8, 9138. [Google Scholar] [CrossRef]
- Gudnason, H.; Dufva, M.; Bang, D.D.; Wolff, A. Comparison of Multiple DNA Dyes for Real-Time PCR: Effects of Dye Concentration and Sequence Composition on DNA Amplification and Melting Temperature. Nucleic Acids Res. 2007, 35, e127. [Google Scholar] [CrossRef]
- Murray, J.L.; Hu, P.; Shafer, D.A. Seven Novel Probe Systems for Real-Time PCR Provide Absolute Single-Base Discrimination, Higher Signaling, and Generic Components. J. Mol. Diagn. 2014, 16, 627–638. [Google Scholar] [CrossRef]
- Nagy, A.; Vitásková, E.; Černíková, L.; Křivda, V.; Jiřincová, H.; Sedlák, K.; Horníčková, J.; Havlíčková, M. Evaluation of TaqMan QPCR System Integrating Two Identically Labelled Hydrolysis Probes in Single Assay. Sci. Rep. 2017, 7, 41392. [Google Scholar] [CrossRef]
- Wong, M.L.; Medrano, J.F. Real-Time PCR for MRNA Quantitation. Biotechniques 2005, 39, 75–85. [Google Scholar] [CrossRef]
- Wong, W.; Farr, R.; Joglekar, M.; Januszewski, A.; Hardikar, A. Probe-Based Real-Time PCR Approaches for Quantitative Measurement of MicroRNAs. J. Vis. Exp. 2015, e52586. [Google Scholar] [CrossRef]
- Zhang, H.; Yan, Z.; Wang, X.; Gaňová, M.; Chang, H.; Laššáková, S.; Korabecna, M.; Neuzil, P. Determination of Advantages and Limitations of QPCR Duplexing in a Single Fluorescent Channel. ACS Omega 2021, 6, 22292–22300. [Google Scholar] [CrossRef] [PubMed]
- Libert, X.; Packeu, A.; Bureau, F.; Roosens, N.H.; De Keersmaecker, S.C.J. Discrimination of Three Genetically Close Aspergillus Species by Using High Resolution Melting Analysis Applied to Indoor Air as Case Study. BMC Microbiol. 2017, 17, 84. [Google Scholar] [CrossRef] [PubMed]
- Xanthopoulou, A.; Ganopoulos, I.; Tryfinopoulou, P.; Panagou, E.Z.; Osanthanunkul, M.; Madesis, P.; Kizis, D. Rapid and Accurate Identification of Black Aspergilli from Grapes Using High-Resolution Melting (HRM) Analysis. J. Sci. Food Agric. 2019, 99, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Al-Doory, Y. Laboratory Medical Mycology; Lea & Febiger: Washington, DC, USA, 1980; ISBN 0812106954. [Google Scholar]
- Klich, M.A.; Pitt, J.I. A Laboratory Guide to the Common Aspergillus Species and Their Teleomorphs; Commonwealth Scientific and Industrial Research Organization: Canberra, ACT, Australia, 1988. [Google Scholar]
- Samson, R.A.; Visagie, C.M.; Houbraken, J.; Hong, S.-B.; Hubka, V.; Klaassen, C.H.W.; Perrone, G.; Seifert, K.A.; Susca, A.; Tanney, J.B. Phylogeny, Identification and Nomenclature of the Genus Aspergillus. Stud. Mycol. 2014, 78, 141–173. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, R.H.; Anslan, S.; Bahram, M.; Wurzbacher, C.; Baldrian, P.; Tedersoo, L. Mycobiome Diversity: High-Throughput Sequencing and Identification of Fungi. Nat. Rev. Microbiol. 2019, 17, 95–109. [Google Scholar] [PubMed]
- Edgar, R.C. MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [PubMed]
- Okonechnikov, K.; Golosova, O.; Fursov, M.; Ugene Team. Unipro UGENE: A Unified Bioinformatics Toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed]
- Richardson, R.T.; Sponsler, D.B.; McMinn-Sauder, H.; Johnson, R.M. MetaCurator: A Hidden Markov Model-Based Toolkit for Extracting and Curating Sequences from Taxonomically-Informative Genetic Markers. Methods Ecol. Evol. 2020, 11, 181–186. [Google Scholar] [CrossRef]
- Shen, W.; Ren, H. TaxonKit: A Practical and Efficient NCBI Taxonomy Toolkit. J. Genet. Genom. 2021, 48, 844–850. [Google Scholar] [CrossRef] [PubMed]
- Gans, J.D.; Wolinsky, M. Improved Assay-Dependent Searching of Nucleic Acid Sequence Databases. Nucleic Acids Res. 2008, 36, e74. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
- Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A Novel Method for Rapid Multiple Sequence Alignment Based on Fast Fourier Transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef] [PubMed]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, Interactive, Scalable and Extensible Microbiome Data Science Using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree 2—Approximately Maximum-Likelihood Trees for Large Alignments. PLoS ONE 2010, 5, e9490. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (ITOL) v5: An Online Tool for Phylogenetic Tree Display and Annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Malekinejad, H.; Fink-Gremmels, J. Mycotoxicoses in Veterinary Medicine: Aspergillosis and Penicilliosis. In Veterinary Research Forum; Faculty of Veterinary Medicine, Urmia University: Urmia, Iran, 2020; Volume 11, p. 97. [Google Scholar]
- Kemboi, D.C.; Antonissen, G.; Ochieng, P.E.; Croubels, S.; Okoth, S.; Kangethe, E.K.; Faas, J.; Lindahl, J.F.; Gathumbi, J.K. A Review of the Impact of Mycotoxins on Dairy Cattle Health: Challenges for Food Safety and Dairy Production in Sub-Saharan Africa. Toxins 2020, 12, 222. [Google Scholar] [CrossRef] [PubMed]
- Peles, F.; Sipos, P.; Győri, Z.; Pfliegler, W.P.; Giacometti, F.; Serraino, A.; Pagliuca, G.; Gazzotti, T.; Pócsi, I. Adverse Effects, Transformation and Channeling of Aflatoxins into Food Raw Materials in Livestock. Front. Microbiol. 2019, 10, 2861. [Google Scholar]
- Lemaire, B.; Normand, A.-C.; Forel, J.-M.; Cassir, N.; Piarroux, R.; Ranque, S. Hospitalized Patient as Source of Aspergillus fumigatus, 2015. Emerg. Infect. Dis. 2018, 24, 1524. [Google Scholar] [CrossRef] [PubMed]
- Patterson, T.F.; Thompson, G.R.; Denning, D.W.; Fishman, J.A.; Hadley, S.; Herbrecht, R.; Kontoyiannis, D.P.; Marr, K.A.; Morrison, V.A.; Nguyen, M.H.; et al. Practice Guidelines for the Diagnosis and Management of Aspergillosis: 2016 Update by the Infectious Diseases Society of America. Clin. Infect. Dis. 2016, 63, e1–e60. [Google Scholar] [PubMed]
- Hutcheson, P.S.; Knutsen, A.P.; Rejent, A.J.; Slavin, R.G. A 12-Year Longitudinal Study of Aspergillus Sensitivity in Patients with Cystic Fibrosis. Chest 1996, 110, 363–366. [Google Scholar] [CrossRef] [PubMed]
- Barnes, P.D.; Marr, K.A. Aspergillosis: Spectrum of Disease, Diagnosis, and Treatment. Infect. Dis. Clin. 2006, 20, 545–561. [Google Scholar] [CrossRef] [PubMed]
- Lass-Flörl, C.; Rath, P.-M.; Niederwieser, D.; Kofler, G.; Würzner, R.; Krezy, A.; Dierich, M.P. Aspergillus terreus Infections in Haematological Malignancies: Molecular Epidemiology Suggests Association with in-Hospital Plants. J. Hosp. Infect. 2000, 46, 31–35. [Google Scholar] [CrossRef] [PubMed]
- Steinbach, W.J.; Benjamin, D.K.; Kontoyiannis, D.P.; Perfect, J.R.; Lutsar, I.; Marr, K.A.; Lionakis, M.S.; Torres, H.A.; Jafri, H.; Walsh, T.J. Infections Due to Aspergillus terreus: A Multicenter Retrospective Analysis of 83 Cases. Clin. Infect. Dis. 2004, 39, 192–198. [Google Scholar] [CrossRef]
- Segal, B.H.; DeCarlo, E.S.; Kwon-Chung, K.J.; Malech, H.L.; Gallin, J.I.; Holland, S.M. Aspergillus nidulans Infection in Chronic Granulomatous Disease. Medicine 1998, 77, 345–354. [Google Scholar] [CrossRef]
- Kontoyiannis, D.P.; Lewis, R.E.; May, G.S.; Osherov, N.; Rinaldi, M.G. Aspergillus nidulans Is Frequently Resistant to Amphotericin B. Mycoses 2002, 45, 406–407. [Google Scholar] [CrossRef] [PubMed]
- Walsh, T.J.; Anaissie, E.J.; Denning, D.W.; Herbrecht, R.; Kontoyiannis, D.P.; Marr, K.A.; Morrison, V.A.; Segal, B.H.; Steinbach, W.J.; Stevens, D.A. Treatment of Aspergillosis: Clinical Practice Guidelines of the Infectious Diseases Society of America. Clin. Infect. Dis. 2008, 46, 327–360. [Google Scholar] [PubMed]
- Pravin Charles, M.V.; Joseph, N.M.; Easow, J.M.; Ravishankar, M. Invasive Pulmonary Aspergillosis Caused by Aspergillus Versicolor in a Patient on Mechanical Ventilation. Australas. Med. J. 2011, 4, 632–634. [Google Scholar] [CrossRef]
- Sutton, D.A.; Sanche, S.E.; Revankar, S.G.; Fothergill, A.W.; Rinaldi, M.G. In Vitro Amphotericin B Resistance in Clinical Isolates of Aspergillus terreus, with a Head-to-Head Comparison to Voriconazole. J. Clin. Microbiol. 1999, 37, 2343–2345. [Google Scholar] [CrossRef] [PubMed]
- Cole, D.C.; Govender, N.P.; Chakrabarti, A.; Sacarlal, J.; Denning, D.W. Improvement of Fungal Disease Identification and Management: Combined Health Systems and Public Health Approaches. Lancet Infect. Dis. 2017, 17, e412–e419. [Google Scholar] [PubMed]
- Shah, A.; Panjabi, C. Allergic Bronchopulmonary Aspergillosis: A Perplexing Clinical Entity. Allergy Asthma Immunol. Res. 2016, 8, 282–297. [Google Scholar]
- Lou, B.; Xu, Z.; Yang, G.; Guo, C.; Zheng, S.; Lou, H.; Ma, G.; Sadhukhan, A.; Lin, S.; Chen, Y. Role of Aspergillus fumigatus-Specific IgE in the Diagnosis of Allergic Bronchopulmonary Aspergillosis. Int. Arch. Allergy Immunol. 2019, 178, 338–344. [Google Scholar] [CrossRef] [PubMed]
- De Pauw, B.; Walsh, T.J.; Donnelly, J.P.; Stevens, D.A.; Edwards, J.E.; Calandra, T.; Pappas, P.G.; Maertens, J.; Lortholary, O.; Kauffman, C.A. Revised Definitions of Invasive Fungal Disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group. Clin. Infect. Dis. 2008, 46, 1813–1821. [Google Scholar] [PubMed]
- Sun, W.; Wang, K.; Gao, W.; Su, X.; Qian, Q.; Lu, X.; Song, Y.; Guo, Y.; Shi, Y. Evaluation of PCR on Bronchoalveolar Lavage Fluid for Diagnosis of Invasive Aspergillosis: A Bivariate Metaanalysis and Systematic Review. PLoS ONE 2011, 6, e28467. [Google Scholar]
- Suanthie, Y.; Cousin, M.A.; Woloshuk, C.P. Multiplex Real-Time PCR for Detection and Quantification of Mycotoxigenic Aspergillus, Penicillium and Fusarium. J. Stored Prod. Res. 2009, 45, 139–145. [Google Scholar] [CrossRef]
- Logotheti, M.; Kotsovili-Tseleni, A.; Arsenis, G.; Legakis, N.I. Multiplex PCR for the Discrimination of A. fumigatus, A. flavus, A. niger and A. terreus. J. Microbiol. Methods 2009, 76, 209–211. [Google Scholar] [CrossRef] [PubMed]
- Erali, M.; Pounder, J.I.; Woods, G.L.; Petti, C.A.; Wittwer, C.T. Multiplex Single-Color PCR with Amplicon Melting Analysis for Identification of Aspergillus Species. Clin. Chem. 2006, 52, 1443. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′-3′) | Location | Amplicon Size (bp) | Primer Tm (°C) |
---|---|---|---|---|
A. niger Forward | CGTTTTCCAACCATTC | ITS2 | 58 | 46.6 |
A. flavus Forward | CTTGCCGAACGCAAATCAATC | ITS2 | 65 | 57.9 |
A. nidulans Forward | TTTGTCACCCGCTCGAT | ITS2 | 98 | 52.8 |
A. fumigatus Forward | TATGCAGTCTGAGTTGATTATCGT | ITS1 | 371 | 56.9 |
A. terreus Forward | CCGAGTGCGGGTCTTTA | ITS1 | 554 | 55.2 |
Universal Reverse | GTTCAGCGGGTATCCCTA | LSU | - | 58.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tokamani, M.; Figgou, E.; Papamichail, L.; Sakka, E.; Toros, A.; Bouchorikou, A.; Giannakakis, A.; Matthaiou, E.I.; Sandaltzopoulos, R. A Multiplex PCR Melting-Curve-Analysis-Based Detection Method for the Discrimination of Five Aspergillus Species. J. Fungi 2023, 9, 842. https://doi.org/10.3390/jof9080842
Tokamani M, Figgou E, Papamichail L, Sakka E, Toros A, Bouchorikou A, Giannakakis A, Matthaiou EI, Sandaltzopoulos R. A Multiplex PCR Melting-Curve-Analysis-Based Detection Method for the Discrimination of Five Aspergillus Species. Journal of Fungi. 2023; 9(8):842. https://doi.org/10.3390/jof9080842
Chicago/Turabian StyleTokamani, Maria, Eleftheria Figgou, Lito Papamichail, Eleni Sakka, Athanasios Toros, Anastasia Bouchorikou, Antonis Giannakakis, Efthymia Iliana Matthaiou, and Raphael Sandaltzopoulos. 2023. "A Multiplex PCR Melting-Curve-Analysis-Based Detection Method for the Discrimination of Five Aspergillus Species" Journal of Fungi 9, no. 8: 842. https://doi.org/10.3390/jof9080842
APA StyleTokamani, M., Figgou, E., Papamichail, L., Sakka, E., Toros, A., Bouchorikou, A., Giannakakis, A., Matthaiou, E. I., & Sandaltzopoulos, R. (2023). A Multiplex PCR Melting-Curve-Analysis-Based Detection Method for the Discrimination of Five Aspergillus Species. Journal of Fungi, 9(8), 842. https://doi.org/10.3390/jof9080842