Cyclic Lipopeptides of Bacillus amyloliquefaciens DHA6 Are the Determinants to Suppress Watermelon Fusarium Wilt by Direct Antifungal Activity and Host Defense Modulation
Abstract
1. Introduction
2. Materials and Methods
2.1. Growth Conditions for Fon, DHA6, and Watermelon Plants
2.2. Molecular Characterization of the Bacterial Strain DHA6
2.3. Extraction, Purification, and Characterization of CLPs from Strain DHA6
2.4. Antifungal Activity of CLPs against Fon
2.5. Optical and Electronic Microscopy Observation
2.6. Detection of Reactive Oxygen Species (ROS) Accumulation
2.7. Effect of CLPs on Plant Growth and Fusarium Wilt in Watermelon
2.8. Measurement of Antioxidative Enzyme Activity
2.9. RNA Extraction and RT-qPCR Analysis of Gene Expression
2.10. Experimental Design and Data Analysis
3. Results
3.1. Molecular Characterization of Strain DHA6
3.2. Identification of CLPs Produced by B. amyloliquefaciens Strain DHA6
3.3. Plant Growth Promotion and Fusarium Wilt Suppression in Watermelon by CLPs
3.4. Antifungal Activity of CLPs against Fon
3.5. Inhibitory Effect of CLPs on Fon Viability
3.6. Induction of ROS Accumulation in Fon by CLPs
3.7. Enhancement of Antioxidative Capacity and Upregulation of Defense Gene Expression by CLPs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Khan, A.R.; Mustafa, A.; Hyder, S.; Valipour, M.; Rizvi, Z.F.; Gondal, A.S.; Yousuf, Z.; Iqbal, R.; Daraz, U. Bacillus spp. as bioagents: Uses and application for sustainable agriculture. Biology 2022, 11, 1763. [Google Scholar] [CrossRef] [PubMed]
- Bonaterra, A.; Badosa, E.; Daranas, N.; Francés, J.; Roselló, G.; Montesinos, E. Bacteria as biological control agents of plant diseases. Microorganisms 2022, 10, 1759. [Google Scholar] [CrossRef] [PubMed]
- Tyśkiewicz, R.; Nowak, A.; Ozimek, E.; Jaroszuk-Ściseł, J. Trichoderma: The current status of its application in agriculture for the biocontrol of fungal phytopathogens and stimulation of plant growth. Int. J. Mol. Sci. 2022, 23, 2329. [Google Scholar] [CrossRef] [PubMed]
- Sarrocco, S. Biological disease control by beneficial (micro)organisms: Selected breakthroughs in the past 50 years. Phytopathology 2023, 113, 732–740. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.; Zhao, C.; Wang, E.; Raza, A.; Yin, C. Bacillus amyloliquefaciens as an excellent agent for biofertilizer and biocontrol in agriculture: An overview for its mechanisms. Microbiol. Res. 2022, 259, 127016. [Google Scholar] [CrossRef] [PubMed]
- Ngalimat, M.S.; Yahaya, R.S.R.; Baharudin, M.M.A.; Yaminudin, S.M.; Karim, M.; Ahmad, S.A.; Sabri, S. A review on the biotechnological applications of the operational group Bacillus amyloliquefaciens. Microorganisms 2021, 9, 614. [Google Scholar] [CrossRef]
- Blake, C.; Christensen, M.N.; Kovács, Á.T. Molecular aspects of plant growth promotion and protection by Bacillus subtilis. Mol. Plant-Microbe Interact. 2021, 34, 15–25. [Google Scholar] [CrossRef]
- Miljaković, D.; Marinković, J.; Balešević-Tubić, S. The significance of Bacillus spp. in disease suppression and growth promotion of field and vegetable crops. Microorganisms 2020, 8, 1037. [Google Scholar] [CrossRef]
- Khan, N.; Maymon, M.; Hirsch, A.M. Combating Fusarium infection using Bacillus-based antimicrobials. Microorganisms 2017, 5, 75. [Google Scholar] [CrossRef]
- Xu, W.; Yang, Q.; Yang, F.; Xie, X.; Goodwin, P.H.; Deng, X.; Tian, B.; Yang, L. Evaluation and genome analysis of Bacillus subtilis YB-04 as a potential biocontrol agent against Fusarium wilt and growth promotion agent of cucumber. Front. Microbiol. 2022, 13, 885430. [Google Scholar] [CrossRef]
- Fan, H.; Li, S.; Zeng, L.; He, P.; Xu, S.; Bai, T.; Huang, Y.; Guo, Z.; Zheng, S.J. Biological control of Fusarium oxysporum f. sp. cubense tropical race 4 using natively isolated Bacillus spp. YN0904 and YN1419. J. Fungi 2021, 7, 795. [Google Scholar] [CrossRef]
- Jiang, C.H.; Yao, X.F.; Mi, D.D.; Li, Z.J.; Yang, B.Y.; Zheng, Y.; Qi, Y.J.; Guo, J.H. Comparative transcriptome analysis reveals the biocontrol mechanism of Bacillus velezensis F21 against Fusarium wilt on watermelon. Front. Microbiol. 2019, 10, 652. [Google Scholar] [CrossRef]
- Karthika, S.; Remya, M.; Varghese, S.; Dhanraj, N.D.; Sali, S.; Rebello, S.; Jose, S.M.; Jisha, M.S. Bacillus tequilensis PKDN31 and Bacillus licheniformis PKDL10-As double headed swords to combat Fusarium oxysporum f. sp. lycopersici induced tomato wilt. Microb. Pathog. 2022, 172, 105784. [Google Scholar]
- Fisher, M.C.; Henk, D.A.; Briggs, C.J.; Brownstein, J.S.; Madoff, L.C.; McCraw, S.L.; Gurr, S.J. Emerging fungal threats to animal, plant and ecosystem health. Nature 2012, 484, 186–194. [Google Scholar] [CrossRef]
- Gordon, T.R. Fusarium oxysporum and the Fusarium wilt syndrome. Annu. Rev. Phytopathol. 2017, 55, 23–39. [Google Scholar] [CrossRef]
- Ongena, M.; Jacques, P. Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends Microbiol. 2008, 16, 115–125. [Google Scholar] [CrossRef]
- Caulier, S.; Nannan, C.; Gillis, A.; Licciardi, F.; Bragard, C.; Mahillon, J. Overview of the antimicrobial compounds produced by members of the Bacillus subtilis group. Front. Microbiol. 2019, 10, 302. [Google Scholar] [CrossRef]
- Penha, R.O.; Vandenberghe, L.P.S.; Faulds, C.; Soccol, V.T.; Soccol, C.R. Bacillus lipopeptides as powerful pest control agents for a more sustainable and healthy agriculture: Recent studies and innovations. Planta 2020, 251, 70. [Google Scholar] [CrossRef]
- Al-Mutar, A.M.A.; Abduljaleel, N.S.; Noman, M.; Azizullah; Li, D.; Song, F. Suppression of Fusarium wilt in watermelon by Bacillus amyloliquefaciens DHA55 through extracellular production of antifungal lipopolypeptides. J. Fungi 2023, 9, 336. [Google Scholar] [CrossRef]
- Wang, K.; Wang, Z.; Xu, W. Induced oxidative equilibrium damage and reduced toxin synthesis in Fusarium oxysporum f. sp. niveum by secondary metabolites from Bacillus velezensis WB. FEMS Microbiol. Ecol. 2022, 98, fiac080. [Google Scholar] [CrossRef]
- Moreno-Velandia, C.A.; Ongena, M.; Cotes, A.M. Effects of fengycins and iturins on Fusarium oxysporum f. sp. physali and root colonization by Bacillus velezensis Bs006 protect golden berry against vascular wilt. Phytopathology 2021, 111, 2227–2237. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Qiu, J.; Yang, X.; Yang, J.; Zhao, S.; Zhou, Q.; Chen, L. Identification of lipopeptide produced by Bacillus amyloliquefaciens NCPSJ7 and its antifungal activities against Fusarium oxysporum f. sp. niveum. Foods 2022, 11, 2996. [Google Scholar] [CrossRef] [PubMed]
- Kang, B.R.; Park, J.S.; Jung, W.J. Antifungal evaluation of fengycin isoforms isolated from Bacillus amyloliquefaciens PPL against Fusarium oxysporum f. sp. lycopersici. Microb. Pathog. 2020, 149, 104509. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.J.; Huang, J.W.; Deng, W.L. Phenylacetic acid and methylphenyl acetate from the biocontrol bacterium Bacillus mycoides BM02 suppress spore germination in Fusarium oxysporum f. sp. lycopersici. Front. Microbiol. 2020, 11, 569263. [Google Scholar] [CrossRef]
- Wang, H.; Wang, Z.; Liu, Z.; Wang, K.; Xu, W. Membrane disruption of Fusarium oxysporum f. sp. niveum induced by myriocin from Bacillus amyloliquefaciens LZN01. Microb. Biotechnol. 2021, 14, 517–534. [Google Scholar]
- Yamamoto, S.; Shiraishi, S.; Suzuki, S. Are cyclic lipopeptides produced by Bacillus amyloliquefaciens S13-3 responsible for the plant defence response in strawberry against Colletotrichum gloeosporioides? Lett. Appl. Microbiol. 2015, 60, 379–386. [Google Scholar] [CrossRef]
- Farace, G.; Fernandez, O.; Jacquens, L.; Coutte, F.; Krier, F.; Jacques, P.; Clément, C.; Barka, E.A.; Jacquard, C.; Dorey, S. Cyclic lipopeptides from Bacillus subtilis activate distinct patterns of defence responses in grapevine. Mol. Plant Pathol. 2015, 16, 177–187. [Google Scholar] [CrossRef]
- Chowdhury, S.P.; Uhl, J.; Grosch, R.; Alquéres, S.; Pittroff, S.; Dietel, K.; Schmitt-Kopplin, P.; Borriss, R.; Hartmann, A. Cyclic lipopeptides of Bacillus amyloliquefaciens subsp. plantarum colonizing the lettuce rhizosphere enhance plant defense responses toward the bottom rot pathogen Rhizoctonia solani. Mol. Plant-Microbe Interact. 2015, 28, 984–995. [Google Scholar] [CrossRef]
- Pazarlar, S.; Madriz-Ordeñana, K.; Thordal-Christensen, H. Bacillus cereus EC9 protects tomato against Fusarium wilt through JA/ET-activated immunity. Front. Plant Sci. 2022, 13, 1090947. [Google Scholar] [CrossRef]
- Ramírez, V.; Martínez, J.; Bustillos-Cristales, M.D.R.; Catañeda-Antonio, D.; Munive, J.A.; Baez, A. Bacillus cereus MH778713 elicits tomato plant protection against Fusarium oxysporum. J. Appl. Microbiol. 2022, 132, 470–482. [Google Scholar] [CrossRef]
- Sun, Y.; Huang, B.; Cheng, P.; Li, C.; Chen, Y.; Li, Y.; Zheng, L.; Xing, J.; Dong, Z.; Yu, G. Endophytic Bacillus subtilis TR21 improves banana plant resistance to Fusarium oxysporum f. sp. cubense and promotes root growth by upregulating the jasmonate and brassinosteroid biosynthesis pathways. Phytopathology 2022, 112, 219–231. [Google Scholar] [CrossRef]
- Jinal, N.H.; Amaresan, N. Evaluation of biocontrol Bacillus species on plant growth promotion and systemic-induced resistant potential against bacterial and fungal wilt-causing pathogens. Arch. Microbiol. 2020, 202, 1785–1794. [Google Scholar] [CrossRef]
- Akram, W.; Anjum, T.; Ali, B.; Ahmad, A. Screening of native bacillus strains to induce systemic resistance in tomato plants against fusarium wilt in split root system and its field applications. Int. J. Agric. Biol. 2013, 15, 1289–1294. [Google Scholar]
- Akram, W.; Anjum, T.; Ali, B. Phenylacetic acid is ISR determinant produced by Bacillus fortis IAGS162, which involves extensive re-modulation in metabolomics of tomato to protect against Fusarium wilt. Front. Plant Sci. 2016, 7, 498. [Google Scholar] [CrossRef]
- Kawagoe, Y.; Shiraishi, S.; Kondo, H.; Yamamoto, S.; Aoki, Y.; Suzuki, S. Cyclic lipopeptide iturin A structure-dependently induces defense response in Arabidopsis plants by activating SA and JA signaling pathways. Biochem. Biophys. Res. Commun. 2015, 460, 1015–1020. [Google Scholar] [CrossRef]
- Zhang, C.; Ou, X.; Wang, J.; Wang, Z.; Du, W.; Zhao, J.; Han, Y. Antifungal peptide P852 controls Fusarium wilt in faba bean (Vicia faba L.) by promoting antioxidant defense and isoquinoline alkaloid, betaine, and arginine biosyntheses. Antioxidants 2022, 11, 1767. [Google Scholar]
- Everts, K.L.; Himmelstein, J.C. Fusarium wilt of watermelon: Towards sustainable management of a re-emerging plant disease. Crop Prot. 2015, 73, 93–99. [Google Scholar] [CrossRef]
- Gao, Y.; Xiong, X.; Wang, H.; Wang, J.; Bi, Y.; Yan, Y.; Cao, Z.; Li, D.; Song, F. Ero1-Pdi1 module-catalysed dimerization of a nucleotide sugar transporter, FonNst2, regulates virulence of Fusarium oxysporum on watermelon. Environ. Microbiol. 2022, 24, 1200–1220. [Google Scholar] [CrossRef]
- Li, B.; Xu, L.; Lou, M.; Li, F.; Zhang, Y.; Xie, G.J. Isolation and characterization of antagonistic bacteria against bacterial leaf spot of Euphorbia pulcherrima. Lett. Appl. Microbiol. 2008, 46, 450–455. [Google Scholar] [CrossRef]
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.C.; Minton, M.A.; Sharma, M.M.; Georgiou, G. Structural and immunological characterization of a biosurfactant produced by Bacillus licheniformis JF-2. Appl. Environ. Microbiol. 1994, 60, 31–38. [Google Scholar] [CrossRef] [PubMed]
- Vater, J.; Gao, X.; Hitzeroth, G.; Wilde, C.; Franke, P. “Whole cell”—matrix-assisted laser desorption ionization-time of flight-mass spectrometry, an emerging technique for efficient screening of biocombinatorial libraries of natural compounds-present state of research. Comb. Chem. High Throughput Screen. 2003, 6, 557–567. [Google Scholar] [CrossRef] [PubMed]
- Masum, M.M.I.; Liu, L.; Yang, M.; Hossain, M.M.; Siddiqa, M.M.; Supty, M.E.; Ogunyemi, S.O.; Hossain, A.; An, Q.; Li, B. Halotolerant bacteria belonging to operational group Bacillus amyloliquefaciens in biocontrol of the rice brown stripe pathogen Acidovorax oryzae. J. Appl. Microbiol. 2018, 125, 1852–1867. [Google Scholar] [CrossRef] [PubMed]
- Tagg, J.; McGiven, A. Assay system for bacteriocins. Appl. Microbiol. 1971, 21, 943. [Google Scholar] [CrossRef]
- Wang, Y.; Sun, Y.; Zhang, Y.; Zhang, X.; Feng, J. Antifungal activity and biochemical response of cuminic acid against Phytophthora capsici Leonian. Molecules 2016, 21, 756. [Google Scholar] [CrossRef]
- Gong, A.D.; Li, H.P.; Yuan, Q.S.; Song, X.S.; Yao, W.; He, W.J.; Zhang, J.B.; Liao, Y.C. Antagonistic mechanism of iturin A and plipastatin A from Bacillus amyloliquefaciens S76-3 from wheat spikes against Fusarium graminearum. PLoS ONE 2015, 10, e0116871. [Google Scholar] [CrossRef]
- Noman, M.; Ahmed, T.; Ijaz, U.; Shahid, M.; Nazir, M.M.; Azizullah; White, J.C.; Li, D.; Song, F. Bio-functionalized manganese nanoparticles suppress Fusarium wilt in watermelon (Citrullus lanatus L.) by infection disruption, host defense response potentiation, and soil microbial community modulation. Small 2023, 19, e2205687. [Google Scholar] [CrossRef]
- Azizullah; Noman, M.; Gao, Y.; Wang, H.; Xiong, X.; Wang, J.; Li, D.; Song, F. The SUMOylation pathway components are required for vegetative growth, asexual development, cytotoxic responses, and programmed cell death events in Fusarium oxysporum f. sp. niveum. J. Fungi 2023, 9, 94. [Google Scholar] [CrossRef]
- Gu, Q.; Yang, Y.; Yuan, Q.; Shi, G.; Wu, L.; Lou, Z.; Huo, R.; Wu, H.; Borriss, R.; Gao, X. Bacillomycin D produced by Bacillus amyloliquefaciens is involved in the antagonistic interaction with the plant pathogenic fungus Fusarium graminearum. Appl. Environ. Microbiol. 2017, 83, e01075-17. [Google Scholar] [CrossRef]
- Liu, P.; Luo, L.; Guo, J.; Liu, H.; Wang, B.; Deng, B.; Long, C.A.; Cheng, Y. Farnesol induces apoptosis and oxidative stress in the fungal pathogen Penicillium expansum. Mycologia 2010, 102, 311–318. [Google Scholar] [CrossRef]
- Dai, Y.; Cao, Z.; Huang, L.; Liu, S.; Shen, Z.; Wang, Y.; Wang, H.; Zhang, H.; Li, D.; Song, F. CCR4-not complex subunit Not2 plays critical roles in vegetative growth, conidiation and virulence in watermelon Fusarium wilt pathogen Fusarium oxysporum f. sp. niveum. Front. Microbiol. 2016, 7, 1449. [Google Scholar] [CrossRef]
- Murage, E.N.; Masuda, M. Response of pepper and eggplant to continuous light in relation to leaf chlorosis and activities of antioxidative enzymes. Sci. Hortic. 1997, 70, 269–279. [Google Scholar] [CrossRef]
- Wang, C.Y. Effect of temperature preconditioning on catalase, peroxidase, and superoxide dismutase in chilled zucchini squash. Postharvest Biol. Technol. 1995, 5, 67–76. [Google Scholar] [CrossRef]
- Rhee, S.J.; Jang, Y.J.; Park, J.Y.; Ryu, J.; Lee, G.P. Virus-induced gene silencing for in planta validation of gene function in cucurbits. Plant Physiol. 2022, 190, 2366–2379. [Google Scholar] [CrossRef]
- Zhao, P.C.; Quan, C.S.; Wang, Y.G.; Wang, J.H.; Fan, S.D. Bacillus amyloliquefaciens Q-426 as a potential biocontrol agent against Fusarium oxysporum f. sp. spinaciae. J. Basic Microbiol. 2014, 54, 448–456. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, N.; Qiu, M.; Feng, H.; Vivanco, J.M.; Shen, Q.; Zhang, R. Enhanced rhizosphere colonization of beneficial Bacillus amyloliquefaciens SQR9 by pathogen infection. FEMS Microbiol. Lett. 2014, 353, 49–56. [Google Scholar] [CrossRef]
- Wu, K.; Fang, Z.; Wang, L.; Yuan, S.; Guo, R.; Shen, B.; Shen, Q. Biological potential of bioorganic fertilizer fortified with bacterial antagonist for the control of tomato bacterial wilt and the promotion of crop yields. J. Microbiol. Biotechnol. 2016, 26, 1755–1764. [Google Scholar] [CrossRef]
- Jiao, R.; Cai, Y.; He, P.; Munir, S.; Li, X.; Wu, Y.; Wang, J.; Xia, M.; He, P.; Wang, G.; et al. Bacillus amyloliquefaciens YN201732 produces lipopeptides with promising biocontrol activity against fungal pathogen Erysiphe cichoracearum. Front. Cell. Infect. Microbiol. 2021, 11, 598999. [Google Scholar] [CrossRef]
- Fan, Y.; Liu, K.; Lu, R.; Gao, J.; Song, W.; Zhu, H.; Tang, X.; Liu, Y.; Miao, M. Cell-free supernatant of Bacillus subtilis reduces kiwifruit rot caused by Botryosphaeria dothidea through inducing oxidative stress in the pathogen. J. Fungi 2023, 9, 127. [Google Scholar] [CrossRef]
- Sarwar, A.; Hassan, M.N.; Imran, M.; Iqbal, M.; Majeed, S.; Brader, G.; Sessitsch, A.; Hafeez, F.Y. Biocontrol activity of surfactin A purified from Bacillus NH-100 and NH-217 against rice bakanae disease. Microbiol. Res. 2018, 209, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Fujita, S.; Yokota, K. Disease suppression by the cyclic lipopeptides iturin A and surfactin from Bacillus spp. against Fusarium wilt of lettuce. J. Gen. Plant Pathol. 2019, 85, 44–48. [Google Scholar] [CrossRef]
- Han, Y.; Zhang, B.; Shen, Q.; You, C.; Yu, Y.; Li, P.; Shang, Q. Purification and identification of two antifungal cyclic peptides produced by Bacillus amyloliquefaciens L-H15. Appl. Biochem. Biotechnol. 2015, 176, 2202–2212. [Google Scholar] [CrossRef] [PubMed]
- Singh, P.; Xie, J.; Qi, Y.; Qin, Q.; Jin, C.; Wang, B.; Fang, W. A Thermotolerant marine Bacillus amyloliquefaciens S185 producing Iturin A5 for antifungal activity against Fusarium oxysporum f. sp. cubense. Mar. Drugs 2021, 19, 516. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Sun, C. Fengycins, cyclic lipopeptides from marine Bacillus subtilis strains, kill the plant-pathogenic fungus Magnaporthe grisea by inducing reactive oxygen species production and chromatin condensation. Appl. Environ. Microbiol. 2018, 84, e00418–e00445. [Google Scholar] [CrossRef]
- Han, Q.; Wu, F.; Wang, X.; Qi, H.; Shi, L.; Ren, A.; Liu, Q.; Zhao, M.; Tang, C. The bacterial lipopeptide iturins induce Verticillium dahliae cell death by affecting fungal signalling pathways and mediate plant defence responses involved in pathogen-associated molecular pattern-triggered immunity. Environ. Microbiol. 2015, 17, 1166–1188. [Google Scholar] [CrossRef]
- Farzand, A.; Moosa, A.; Zubair, M.; Khan, A.R.; Massawe, V.C.; Tahir, H.A.S.; Sheikh, T.M.M.; Ayaz, M.; Gao, X. Suppression of Sclerotinia sclerotiorum by the induction of systemic resistance and regulation of antioxidant pathways in tomato using fengycin produced by Bacillus amyloliquefaciens FZB42. Biomolecules 2019, 9, 613. [Google Scholar] [CrossRef]
- Pieterse, C.M.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.; Bakker, P.A. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef]
- Crouzet, J.; Arguelles-Arias, A.; Dhondt-Cordelier, S.; Cordelier, S.; Pršíc, J.; Hoff, G.; Mazeyrat-Gourbeyre, F.; Baillieul, F.; Clément, C.; Ongena, M.; et al. Biosurfactants in plant protection against diseases: Rhamnolipids and lipopeptides case study. Front. Bioeng. Biotechnol. 2020, 8, 1014. [Google Scholar] [CrossRef]
- Jourdan, E.; Henry, G.; Duby, F.; Dommes, J.; Barthélemy, J.P.; Thonart, P.; Ongena, M. Insights into the defense-related events occurring in plant cells following perception of surfactin-type lipopeptide from Bacillus subtilis. Mol. Plant-Microbe Interact. 2009, 22, 456–468. [Google Scholar] [CrossRef]
- Raaijmakers, J.; De Bruin, I.; Nybroe, O.; Ongena, M. Natural functions of cyclic lipopeptides from Bacillus and Pseudomonas: More than surfactants and antibiotics. FEMS Microbiol. Rev. 2010, 34, 1037–1062. [Google Scholar] [CrossRef]
- Ongena, M.; Jourdan, E.; Adam, A.; Paquot, M.; Brans, A.; Joris, B.; Arpigny, J.L.; Thonart, P. Surfactin and fengycin lipopeptides of Bacillus subtilis as elicitors of induced systemic resistance in plants. Environ. Microbiol. 2007, 9, 1084–1090. [Google Scholar] [CrossRef]
- Pei, D.; Zhang, Q.; Zhu, X.; Zhang, L. Biological control of Verticillium wilt and growth promotion in tomato by rhizospheric soil-derived Bacillus amyloliquefaciens Oj-2.16. Pathogens 2022, 12, 37. [Google Scholar] [CrossRef]
- Niu, D.D.; Liu, H.X.; Jiang, C.H.; Wang, Y.P.; Wang, Q.Y.; Jin, H.L. The plant growth-promoting rhizobacterium Bacillus cereus AR156 induces systemic resistance in Arabidopsis thaliana by simultaneously activating salicylate-and jasmonate/ethylene-dependent signaling pathways. Mol. Plant-Microbe Interact. 2011, 24, 533–542. [Google Scholar] [CrossRef]
- Dimopoulou, A.; Theologidis, I.; Liebmann, B.; Kalantidis, K.; Vassilakos, N.; Skandalis, N. Bacillus amyloliquefaciens MBI600 differentially induces tomato defense signaling pathways depending on plant part and dose of application. Sci. Rep. 2019, 9, 19120. [Google Scholar] [CrossRef]
- Chuang, C.Y.; Lin, S.T.; Li, A.T.; Li, S.H.; Hsiao, C.Y.; Lin, Y.H. Bacillus amyloliquefaciens PMB05 increases resistance to bacterial wilt by activating mitogen-activated protein kinase and reactive oxygen species pathway crosstalk in Arabidopsis thaliana. Phytopathology 2022, 112, 2495–2502. [Google Scholar] [CrossRef]
- Wu, L.; Huang, Z.; Li, X.; Ma, L.; Gu, Q.; Wu, H.; Liu, J.; Borriss, R.; Wu, Z.; Gao, X. Stomatal closure and SA-, JA/ET-signaling pathways are essential for Bacillus amyloliquefaciens FZB42 to restrict leaf disease caused by Phytophthora nicotianae in Nicotiana benthamiana. Front. Microbiol. 2018, 9, 847. [Google Scholar] [CrossRef]
- Li, Y.; Chen, S. Fusaricidin produced by Paenibacillus polymyxa WLY78 induces systemic resistance against Fusarium wilt of cucumber. Int. J. Mol. Sci. 2019, 20, 5240. [Google Scholar] [CrossRef]
Primers | Sequences (5′–3′) |
ClPR1-rt-1F | CTTGAGCTTTGCCATGCTGC |
ClPR1-rt-1R | GCGTTGGTTGGCATATTGTCG |
ClPR2-rt-1F | AACAACCTTCCAACCCAAAGAG |
ClPR2-rt-1R | ATTCTTTGGAGGTCGGTATTGG |
ClICS1-rt-1F | TAGGCAAAATTCAGCCACCG |
ClICS1-rt-1R | AAGCTACGGCTGCTGGAATG |
ClEDS5-rt-1F | GTGGCTTCACTTCATCTTCGTTC |
ClEDS5-rt-1R | GCTGAGAAGTGAAGGAAGCGAG |
ClAOS-rt-1F | TTCAACCCCACTTGCGATTTC |
ClAOS-rt-1R | GATTGGGCGTAGGGAAACG |
ClPDF1.2-rt-1F | GCTGCAATTTTGTTGCTCCTC |
ClPDF1.2-rt-1R | TGTCCTTGCGTCTGTCACCA |
ClCTR1-rt-1F | CCATTGTTGGCTTCCCTTATTG |
ClCTR1-rt-1R | CGATGCTTGTGAAGGATGGG |
ClEIN2-rt-1F | CTGCATACAACTCATCAGTCGGG |
ClEIN2-rt-1R | CCACTTTCCAGGGTCAACATAAC |
ClPAL2-rt-1F | TTGCGCCATTACTACTCATCCTG |
ClPAL2-rt-1R | CGACCATGCGCTTCACCTC |
qClGAPDH-F | ATGGGCAAAGTTAAGATCGGCATCA |
qClGAPDH-R | CCAATTCGATATCATCACTCTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Mutar, D.M.K.; Noman, M.; Abduljaleel Alzawar, N.S.; Azizullah; Li, D.; Song, F. Cyclic Lipopeptides of Bacillus amyloliquefaciens DHA6 Are the Determinants to Suppress Watermelon Fusarium Wilt by Direct Antifungal Activity and Host Defense Modulation. J. Fungi 2023, 9, 687. https://doi.org/10.3390/jof9060687
Al-Mutar DMK, Noman M, Abduljaleel Alzawar NS, Azizullah, Li D, Song F. Cyclic Lipopeptides of Bacillus amyloliquefaciens DHA6 Are the Determinants to Suppress Watermelon Fusarium Wilt by Direct Antifungal Activity and Host Defense Modulation. Journal of Fungi. 2023; 9(6):687. https://doi.org/10.3390/jof9060687
Chicago/Turabian StyleAl-Mutar, Dhabyan Mutar Kareem, Muhammad Noman, Noor Salih Abduljaleel Alzawar, Azizullah, Dayong Li, and Fengming Song. 2023. "Cyclic Lipopeptides of Bacillus amyloliquefaciens DHA6 Are the Determinants to Suppress Watermelon Fusarium Wilt by Direct Antifungal Activity and Host Defense Modulation" Journal of Fungi 9, no. 6: 687. https://doi.org/10.3390/jof9060687
APA StyleAl-Mutar, D. M. K., Noman, M., Abduljaleel Alzawar, N. S., Azizullah, Li, D., & Song, F. (2023). Cyclic Lipopeptides of Bacillus amyloliquefaciens DHA6 Are the Determinants to Suppress Watermelon Fusarium Wilt by Direct Antifungal Activity and Host Defense Modulation. Journal of Fungi, 9(6), 687. https://doi.org/10.3390/jof9060687