β-Glucan Enhances the Biocontrol Efficacy of Marine Yeast Scheffersomyeces spartinae W9 against Botrytis cinerea in Strawberries
Abstract
:1. Introduction
2. Materials and Methods
2.1. Antagonistic Yeast and Fungal Pathogen
2.2. Fruit
2.3. Biocontrol Efficacy of S. spartinae W9 Cultured with Different Concentrations of β-Glucan against B. cinerea in Strawberries
2.4. Antagonistic Activity of S. spartinae W9 Cultured with β-Glucan against B. cinerea In Vitro
2.5. Population of Yeasts in Strawberry Wounds
2.6. The Effect of 0.1% β-Glucan on the Growth of S. spartinae W9
2.7. Determination of Biofilm Formation
2.8. Measurement of Extracellular Hydrolases
2.9. Stress Resistance Assays of S. spartinae W9
2.10. Transcriptomic Analysis
2.11. Real-Time Quantitative PCR
2.12. Statistical Analysis
3. Results
3.1. Biocontrol Efficacy of S. spartinae W9 Cultured with β-Glucan against B. cinerea in Strawberries
3.2. In Vitro Inhibition of S. spartinae W9 Cultured with β-Glucan against B. cinerea
3.3. Effects of 0.1% β-Glucan on the Growth of S. spartinae W9 In Vitro
3.4. Effects of 0.1% β-Glucan on Colonization Ability in Strawberries and Biofilm Forming Ability of S. spartinae W9
3.5. Effects of 0.1% β-Glucan on Extracellular Hydrolase of S. spartinae W9
3.6. 0.1% β-Glucan Increased the Survival rate of S. spartinae W9 under Different Stresses
3.7. RNA-seq Analysis and RT-qPCR Validation
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Haile, Z.M.; Guzman, N.D.; Grace, E.; Moretto, M.; Sonego, P.; Engelen, K.; Zoli, L.; Moser, C.; Baraldi, E. Transcriptome Profiles of Strawberry (Fragaria vesca) Fruit Interacting With Botrytis cinerea at Different Ripening Stages. Front. Plant Sci. 2019, 10, 1131. [Google Scholar] [CrossRef] [PubMed]
- Janisiewicz, W.J.; Korsten, L. Biological control of postharvest diseases of fruits. Annu. Rev. Phytopathol. 2002, 40, 411–441. [Google Scholar] [CrossRef] [Green Version]
- Morales, H.; Marín, S.; Ramos, A.J.; Sanchis, V. Influence of post-harvest technologies applied during cold storage of apples in Penicillium expansum growth and patulin accumulation: A review. Food Control 2010, 21, 953–962. [Google Scholar] [CrossRef]
- Sharma, R.R.; Singh, D.; Singh, R. Biological control of postharvest diseases of fruits and vegetables by microbial antagonists: A review. Biol. Control 2009, 50, 205–221. [Google Scholar] [CrossRef]
- Zhang, X.; Li, B.; Zhang, Z.; Chen, Y.; Tian, S. Antagonistic Yeasts: A Promising Alternative to Chemical Fungicides for Controlling Postharvest Decay of Fruit. J. Fungi 2020, 6, 158. [Google Scholar] [CrossRef] [PubMed]
- Muccilli, S.; Restuccia, C. Bioprotective Role of Yeasts. Microorganisms 2015, 3, 588–611. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sadeghi, R.; Aminian, H.; Remize, F.; Sheikh, M.; Ebrahimi, L. Integrated control of blue and gray molds of apples with antagonistic yeasts combined with carbon dioxide or ozone. J. Plant Pathol. 2021, 103, 943–953. [Google Scholar] [CrossRef]
- Lanhuang, B.; Yang, Q.; Godana, E.A.; Zhang, H. Efficacy of the Yeast Wickerhamomyces anomalus in Biocontrol of Gray Mold Decay of Tomatoes and Study of the Mechanisms Involved. Foods 2022, 11, 720. [Google Scholar] [CrossRef]
- Millan, A.F.-S.; Gamir, J.; Farran, I.; Larraya, L.; Veramendi, J. Identification of new antifungal metabolites produced by the yeast Metschnikowia pulcherrima involved in the biocontrol of postharvest plant pathogenic fungi. Postharvest Biol. Technol. 2022, 192, 111995. [Google Scholar] [CrossRef]
- Zou, X.; Wei, Y.; Jiang, S.; Cao, Z.; Xu, F.; Wang, H.; Zhan, P.; Shao, X. Volatile organic compounds and rapid proliferation of Candida pseudolambica W16 are modes of action against gray mold in peach fruit. Postharvest Biol. Technol. 2021, 183, 111751. [Google Scholar] [CrossRef]
- Guigón-López, C.; Holguín-Ibarra, P.D.; Torres-Zapien, J.H.; Cruz, I.G.; Villapando, I.; Salas-Salazar, N.A. Metarhizium anisopliae reduces conidial germination and mycelium growth of the apple gray mold Botrytis cinerea. Biol. Control 2021, 160, 104660. [Google Scholar] [CrossRef]
- Zou, X.; Wei, Y.; Dai, K.; Xu, F.; Wang, H.; Shao, X. Yeasts from intertidal zone marine sediment demonstrate antagonistic activities against Botrytis cinerea in vitro and in strawberry fruit. Biol. Control 2021, 158, 104612. [Google Scholar] [CrossRef]
- Roca-Couso, R.; Flores-Félix, J.D.; Rivas, R. Mechanisms of Action of Microbial Biocontrol Agents against Botrytis cinerea. J. Fungi 2021, 7, 1045. [Google Scholar] [CrossRef] [PubMed]
- Dai, H.; Han, X.Q.; Gong, F.Y.; Dong, H.; Tu, P.F.; Gao, X.M. Structure elucidation and immunological function analysis of a novel beta-glucan from the fruit bodies of Polyporus umbellatus (Pers.) Fries. Glycobiology 2012, 22, 1673–1683. [Google Scholar] [CrossRef] [Green Version]
- Fu, D.; Zeng, L.; Zheng, X.; Yu, T. Effect of β-glucan on stress tolerances and biocontrol efficacy of Cryptococcus laurentii against Penicillium expansum in pear fruit. Biocontrol 2015, 60, 669–679. [Google Scholar] [CrossRef]
- Liu, X.Z.; Wang, G.M.; Göker, M.; Groenewald, M.; Kachalkin, A.V.; Lumbsch, H.T.; Millanes, A.M.; Wedin, M.; Yurkov, A.M.; Bai, F.Y.; et al. Towards an integrated phylogenetic classification of the Tremellomycetes. Stud. Mycol. 2015, 81, 85–147. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Li, Y.; Xu, W.; Zheng, X.; Zhang, X.; Abdelhai, M.H.; Zhao, L.; Li, H.; Diao, J.; Zhang, H. Exploring the effect of β-glucan on the biocontrol activity of Cryptococcus podzolicus against postharvest decay of apples and the possible mechanisms involved. Biol. Control 2018, 121, 14–22. [Google Scholar] [CrossRef]
- Zhao, L.; Wang, Y.; Wang, Y.; Li, B.; Gu, X.; Zhang, X.; Boateng, N.A.S.; Zhang, H. Effect of β-glucan on the biocontrol efficacy of Cryptococcus podzolicus against postharvest decay of pears and the possible mechanisms involved. Postharvest Biol. Technol. 2019, 160, 111057. [Google Scholar] [CrossRef]
- Hassan, H.; Mohamed, M.; Yusoff, S.; Hata, E.; Tajidin, N. Selecting Antagonistic Yeast for Postharvest Biocontrol of Colletotrichum gloeosporioides in Papaya Fruit and Possible Mechanisms Involved. Agronomy 2021, 11, 760. [Google Scholar] [CrossRef]
- Qiu, J.-E.; Zhao, L.; Jiang, S.; Godana, E.A.; Zhang, X.; Zhang, H. Efficacy of Meyerozyma caribbica in the biocontrol of blue mold in kiwifruit and mechanisms involved. Biol. Control 2022, 173, 105000. [Google Scholar] [CrossRef]
- Agirman, B.; Erten, H. Biocontrol ability and action mechanisms of Aureobasidium pullulans GE17 and Meyerozyma guilliermondii KL3 against Penicillium digitatum DSM2750 and Penicillium expansum DSM62841 causing postharvest diseases. Yeast 2020, 37, 437–448. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Zhang, L.; Zeng, K. Efficacy of Pichia membranaefaciens combined with chitosan against Colletotrichum gloeosporioides in citrus fruits and possible modes of action. Biol. Control 2016, 96, 39–47. [Google Scholar] [CrossRef]
- Huang, Y.; Fan, Z.; Cai, Y.; Jin, L.; Yu, T. The influence of N-acetylglucosamine: Inducing Rhodosporidium paludigenum to enhance the inhibition of Penicillium expansum on pears. Postharvest Biol. Technol. 2021, 176, 111486. [Google Scholar] [CrossRef]
- Zeng, L.; Yu, C.; Fu, D.; Lu, H.; Zhu, R.; Lu, L.; Zheng, X.; Yu, T. Improvement in the effectiveness of Cryptococcus laurentii to control postharvest blue mold of pear by its culture in β-glucan amended nutrient broth. Postharvest Biol. Technol. 2015, 104, 26–32. [Google Scholar] [CrossRef]
- Millan, A.F.-S.; Larraya, L.; Farran, I.; Ancin, M.; Veramendi, J. Successful biocontrol of major postharvest and soil-borne plant pathogenic fungi by antagonistic yeasts. Biol. Control 2021, 160, 104683. [Google Scholar] [CrossRef]
- Yu, T.; Yu, C.; Chen, F.; Sheng, K.; Zhou, T.; Zunun, M.; Abudu, O.; Yang, S.; Zheng, X. Integrated control of blue mold in pear fruit by combined application of chitosan, a biocontrol yeast and calcium chloride. Postharvest Biol. Technol. 2012, 69, 49–53. [Google Scholar] [CrossRef]
- Rivas-Garcia, T.; Murillo-Amador, B.; Nieto-Garibay, A.; Rincon-Enriquez, G.; Chiquito-Contreras, R.G.; Hernandez-Montiel, L.G. Enhanced biocontrol of fruit rot on muskmelon by combination treatment with marine Debaryomyces hansenii and Stenotrophomonas rhizophila and their potential modes of action. Postharvest Biol. Technol. 2019, 151, 61–67. [Google Scholar] [CrossRef]
- Di Francesco, A.; Ugolini, L.; D’Aquino, S.; Pagnotta, E.; Mari, M. Biocontrol of Monilinia laxa by Aureobasidium pullulans strains: Insights on competition for nutrients and space. Int. J. Food Microbiol. 2017, 248, 32–38. [Google Scholar] [CrossRef]
- Klein, M.N.; Kupper, K.C. Biofilm production by Aureobasidium pullulans improves biocontrol against sour rot in citrus. Food Microbiol. 2018, 69, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Dukare, A.S.; Paul, S.; Nambi, V.E.; Gupta, R.K.; Singh, R.; Sharma, K.; Vishwakarma, R.K. Exploitation of microbial antagonists for the control of postharvest diseases of fruits: A review. Crit. Rev. Food Sci. Nutr. 2018, 59, 1498–1513. [Google Scholar] [CrossRef]
- Wang, S.; Zhang, H.; Qi, T.; Deng, L.; Yi, L.; Zeng, K. Influence of arginine on the biocontrol efficiency of Metschnikowia citriensis against Geotrichum citri-aurantii causing sour rot of postharvest citrus fruit. Food Microbiol. 2021, 101, 103888. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Ge, L.; Chen, K.; Zhao, L.; Zhang, X. Enhanced Biocontrol Activity of Rhodotorula mucilaginosa Cultured in Media Containing Chitosan against Postharvest Diseases in Strawberries: Possible Mechanisms Underlying the Effect. J. Agric. Food Chem. 2014, 62, 4214–4224. [Google Scholar] [CrossRef]
- Masih, E.I.; Paul, B. Secretion of β-1,3-Glucanases by the Yeast Pichia membranifaciens and Its Possible Role in the Biocontrol of Botrytis cinerea Causing Grey Mold Disease of the Grapevine. Curr. Microbiol. 2002, 44, 391–395. [Google Scholar] [CrossRef]
- Sui, Y.; Wisniewski, M.; Droby, S.; Liu, J. Responses of Yeast Biocontrol Agents to Environmental Stress. Appl. Environ. Microbiol. 2015, 81, 2968–2975. [Google Scholar] [CrossRef] [Green Version]
- Schroeder, L.; Ikui, A.E. Tryptophan confers resistance to SDS-associated cell membrane stress in Saccharomyces cerevisiae. PLoS ONE 2019, 14, e0199484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kono, K.; Al-Zain, A.; Schroeder, L.; Nakanishi, M.; Ikui, A.E. Plasma membrane/cell wall perturbation activates a novel cell cycle checkpoint during G1 in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 2016, 113, 6910–6915. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nie, X.; Zhang, C.; Jiang, C.; Zhang, R.; Guo, F.; Fan, X. Trehalose increases the oxidative stress tolerance and biocontrol efficacy of Candida oleophila in the microenvironment of pear wounds. Biol. Control 2019, 132, 23–28. [Google Scholar] [CrossRef]
- Reverter-Branchat, G.; Cabiscol, E.; Tamarit, J.; Ros, J. Oxidative damage to specific proteins in replicative and chronological-aged Saccharomyces cerevisiae: Common targets and prevention by calorie restriction. J. Biol. Chem. 2004, 279, 31983–31989. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Luo, Y.; Sui, Y.; Xie, Z.; Liu, Y.; Jiang, M.; Liu, J. Exposure of Candida oleophila to sublethal salt stress induces an antioxidant response and improves biocontrol efficacy. Biol. Control 2018, 127, 109–115. [Google Scholar] [CrossRef]
- Goud, B.S.; Kim, J.H.; Ulaganathan, K. Identification of Genes Associated with Stress Tolerance of High Ethanol–Producing Saccharomyces cerevisiae Strain, NCIM3186, by Differential Gene Expression Analysis. BioEnergy Res. 2022, 15, 1459–1471. [Google Scholar] [CrossRef]
- Perez-Martinez, M.E.; Benet, M.; Alepuz, P.; Tordera, V. Nut1/Hos1 and Sas2/Rpd3 control the H3 acetylation of two different sets of osmotic stress-induced genes. Epigenetics 2020, 15, 251–271. [Google Scholar] [CrossRef] [PubMed]
- She, X.; Zhang, P.; Gao, Y.; Zhang, L.; Wang, Q.; Chen, H.; Calderone, R.; Liu, W.; Li, D. A mitochondrial proteomics view of complex I deficiency in Candida albicans. Mitochondrion 2018, 38, 48–57. [Google Scholar] [CrossRef] [PubMed]
- Horstmann, C.; Campbell, C.; Kim, D.S.; Kim, K. Transcriptome profile with 20 nm silver nanoparticles in yeast. FEMS Yeast Res. 2019, 19, foz003. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matiach, A.; Schröder-Köhne, S. Yeast cys3 and gsh1 mutant cells display overlapping but non-identical symptoms of oxidative stress with regard to subcellular protein localization and CDP-DAG metabolism. Mol. Genet. Genom. 2001, 266, 481–496. [Google Scholar] [CrossRef]
- Nguyen, P.-T.; Toh-E, A.; Nguyen, N.-H.; Imanishi-Shimizu, Y.; Watanabe, A.; Kamei, K.; Shimizu, K. Identification and characterization of a sulfite reductase gene and new insights regarding the sulfur-containing amino acid metabolism in the basidiomycetous yeast Cryptococcus neoformans. Curr. Genet. 2020, 67, 115–128. [Google Scholar] [CrossRef] [PubMed]
- Gu, Z.; Sun, Y.; Wu, F.; Wu, X. Mechanism of Growth Regulation of Yeast Involving Hydrogen Sulfide From S-Propargyl-Cysteine Catalyzed by Cystathionine-γ-Lyase. Front. Microbiol. 2021, 12, 679563. [Google Scholar] [CrossRef]
- Klis, F.M.; Mol, P.; Hellingwerf, K.; Brul, S. Dynamics of cell wall structure in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 2002, 26, 239–256. [Google Scholar] [CrossRef]
- Delgado, M.L.; O’Connor, J.E.; Azorín, I.; Renau-Piqueras, J.; Gil, M.L.; Gozalbo, D. The glyceraldehyde-3-phosphate dehydrogenase polypeptides encoded by the Saccharomyces cerevisiae TDH1, TDH2 and TDH3 genes are also cell wall proteins. Microbiology 2001, 147, 411–417. [Google Scholar] [CrossRef] [Green Version]
- Terzioğlu, E.; Alkım, C.; Arslan, M.; Balaban, B.G.; Holyavkin, C.; Kısakesen, H.I.; Topaloğlu, A.; Şahin, Y.; Işık, S.G.; Akman, S.; et al. Genomic, transcriptomic and physiological analyses of silver-resistant Saccharomyces cerevisiae obtained by evolutionary engineering. Yeast 2020, 37, 413–426. [Google Scholar] [CrossRef]
- Dai, Y.; Wang, Z.; Leng, J.; Wang, Q.; Liu, J. Heat stress alters the transcriptome of Debaryomyces hansenii and reduces its biocontrol activity against postharvest gray mold on kiwifruit. Postharvest Biol. Technol. 2021, 178, 111541. [Google Scholar] [CrossRef]
- van Rossum, H.M.; Kozak, B.U.; Niemeijer, M.S.; Duine, H.J.; Luttik, M.A.H.; Boer, V.M.; Kötter, P.; Daran, J.-M.G.; van Maris, A.J.A.; Pronk, J.T. Alternative reactions at the interface of glycolysis and citric acid cycle in Saccharomyces cerevisiae. FEMS Yeast Res. 2016, 16, fow017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhong, W.; Yang, M.; Hao, X.; Sharshar, M.M.; Wang, Q.; Xing, J. Improvement of D-Lactic acid productivity by introducing Escherichia coli acetyl-CoA synthesis pathway in engineered Saccharomyces cerevi. J. Chem. Technol. Biotechnol. 2021, 96, 2509–2519. [Google Scholar] [CrossRef]
- Thakre, P.K.; Sv, A.; Golla, U.R.; Chauhan, S.; Tomar, R.S. Previously uncharacterized amino acid residues in histone H3 and H4 mutants with roles in DNA damage repair response and cellular aging. FEBS J. 2018, 286, 1154–1173. [Google Scholar] [CrossRef] [PubMed]
Gene ID | Gene Name | Forward and Reverse Primers (5′ to 3′) |
---|---|---|
gene-KQ657_000363 | CYS3 | F: TGGGTGTTTTGGCAACCAAC R: ACCTCTGTGAGCCAACCAAG |
gene-KQ657_002550 | GRE2_4 | F: TTTCACATTGCGTCTCCCGT R: GCTGAGGTGCCTTATCCGTT |
gene-KQ657_002037 | ERG3 | F: CGGATGGTCTCTTCCACTCC R: CTGTTGCCCATATCGAGGGT |
gene-KQ657_001934 | ACH1 | F: CGTTTCTACGCCAACTGGGA R: GGTGGAGTTAGCATGAGCGT |
gene-KQ657_000095 | AOX2 | F: CATGCCGCACCTGTTTTAGT R: GGCTCTTTAACCGGTGGTGT |
gene-KQ657_001274 | TDH1 | F: ACAAGGACTGGAGAGGTGGT R: TTACCGACAGCCTTAGCAGC |
gene-KQ657_000537 | ECM4_1 | F: TTCGCTTCCGACCAAGAGAC R: TGACCACCAGCAGTGTGAAT |
gene-KQ657_001686 | KRI1 | F: AGGCCGAGACCATTGAAGTC R: CTGGTGCTTCTTGGTCGCTA |
gene-KQ657_001371 | IRS4 | F: GCTACGAAGCTTGTGGGAGT R: GCAGACAATCGAGCAGCAAC |
gene-KQ657_001105 | RRP36 | F: ACCTGTTTCGGTAGTCAGGG R: CATCTTGCTCCGTTGCTTGG |
gene-KQ657_000758 | ADH1_1 | F: ATGGGTTGCAGTCTCTGGTG R: CCTTCTCTTCGCCACCATCA |
gene-KQ657_003270 | RNR2 | F: AGATGCCCTTCCAGTGTCTT R: AGGAGAAAGCATTGGCTGCT |
gene-KQ657_004479 | ACT1 | F:CAGACCTGCTGACTTGGGTT R:AGAGGATGGGGCCAACAAAG |
Culture Conditions | OD600 | |||
---|---|---|---|---|
12 h | 24 h | 36 h | 48 h | |
NYDB | 1.25 ± 0.011 a | 2.22 ± 0.006 a | 2.42 ± 0.005 a | 2.51 ± 0.001 a |
NYDB with 0.1%β-glucan | 1.27 ± 0.009 a | 2.23 ± 0.014 a | 2.41 ± 0.007 a | 2.51 ± 0.018 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Wei, Y.; Zou, X.; Zhao, Z.; Jiang, S.; Chen, Y.; Xu, F.; Shao, X. β-Glucan Enhances the Biocontrol Efficacy of Marine Yeast Scheffersomyeces spartinae W9 against Botrytis cinerea in Strawberries. J. Fungi 2023, 9, 474. https://doi.org/10.3390/jof9040474
Chen X, Wei Y, Zou X, Zhao Z, Jiang S, Chen Y, Xu F, Shao X. β-Glucan Enhances the Biocontrol Efficacy of Marine Yeast Scheffersomyeces spartinae W9 against Botrytis cinerea in Strawberries. Journal of Fungi. 2023; 9(4):474. https://doi.org/10.3390/jof9040474
Chicago/Turabian StyleChen, Xueyan, Yingying Wei, Xiurong Zou, Zichang Zhao, Shu Jiang, Yi Chen, Feng Xu, and Xingfeng Shao. 2023. "β-Glucan Enhances the Biocontrol Efficacy of Marine Yeast Scheffersomyeces spartinae W9 against Botrytis cinerea in Strawberries" Journal of Fungi 9, no. 4: 474. https://doi.org/10.3390/jof9040474