Selenium Improved Phenylacetic Acid Content in Oilseed Rape and Thus Enhanced the Prevention of Sclerotinia sclerotiorum by Dimethachlon
Abstract
:1. Introduction
2. Materials and Methods
2.1. Pathogens and Reagent Preparation
2.2. Metabolite Note and KEGG Pathway Analysis
2.3. EC50 of DIM and PA
2.4. Mycelial Growth Assay and Sclerotial Formation
2.5. Measurement of Pathogenicity on Detached Leaves of Rape
2.6. Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM) Analysis
2.7. Electrical Conductivity Assay
2.8. Acid Production Determination
2.9. Oxalic Acid (OA) Content Measurement
2.10. RNA Isolation and Quantitative Real-Time PCR (qRT-PCR) Analysis
2.11. Statistical Analysis
3. Results
3.1. Metabolic Pathway Analysis
3.2. Inhibitory EC50 of PA and DIM on S. sclerotiorum
3.3. Effects of PA on S. sclerotiorum Growth and Sclerotial Formation
3.4. Effect of PA on Lesion Development on Detached Leaves
3.5. Morphological Structure Changes of S. sclerotiorum
3.6. Electrical Conductivity, Acid Production and Oxalic Acid Content of Mycelia Analysis
3.7. Changes of Pathogenic Gene-Expression Levels
4. Discussion
4.1. PA Related-Metabolic Pathway of Rape Regulated by Se Was Relevant to Disease Resistance
4.2. PA Reduced Application Amount of DIM and Enhanced Inhibition Effect for S. sclerotiorum
4.3. The Inhibitory Effect Mechanism of PA and DIM on S. sclerotiorum
- (1)
- PA and DIM damaged the cell structure and inhibited the growth of S. sclerotiorum.
- (2)
- PA and DIM reduced pathogenicity of S. sclerotiorum by changing pathogenic factors and growth environment.
- (3)
- PA and DIM regulated the expression level of the pathogenicity gene and affected the pathogenicity of S. sclerotiorum.
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hou, Y.-P.; Mao, X.-W.; Qu, X.-P.; Wang, J.-X.; Chen, C.-J.; Zhou, M.-G. Molecular and biological characterization of Sclerotinia sclerotiorum resistant to the anilinopyrimidine fungicide cyprodinil. Pestic. Biochem. Physiol. 2018, 146, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Wei, W.; Pierre-Pierre, N.; Peng, H.; Ellur, V.; Vandemark, G.J.; Chen, W. The D-galacturonic acid catabolic pathway genes differentially regulate virulence and salinity response in Sclerotinia sclerotiorum. Fungal Genet. Biol. 2020, 145, 103482. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.; Ji, R.; Guo, X.; Foster, S.J.; Chen, H.; Dong, C.; Liu, Y.; Hu, Q.; Liu, S. Expressing a gene encoding wheat oxalate oxidase enhances resistance to Sclerotinia sclerotiorum in oilseed rape (Brassica napus). Planta 2008, 228, 331–340. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Peltier, A.J.; Meng, J.; Osborn, T.C.; Grau, C.R. Evaluation of Sclerotinia stem rot resistance in oilseed Brassica napus using a petiole inoculation technique under greenhouse conditions. Plant Dis. 2004, 88, 1033–1039. [Google Scholar] [CrossRef] [Green Version]
- Li, C.X.; Li, H.U.A.; Sivasithamparam, K.; Fu, T.D.; Li, Y.C.; Liu, S.Y.; Barbetti, M.J. Expression of field resistance under Western Australian conditions to Sclerotinia sclerotiorum in Chinese and Australian Brassica napus and Brassica juncea germplasm and its relation with stem diameter. Aust. J. Agric. Res. 2006, 57, 1131–1135. [Google Scholar] [CrossRef]
- Peltier, A.J.; Bradley, C.A.; Chilvers, M.I.; Malvick, D.K.; Mueller, D.S.; Wise, K.A.; Esker, P.D. Biology, Yield loss and Control of Sclerotinia Stem Rot of Soybean. J. Integr. Pest Manag. 2012, 3, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Wang, Z.; Fang, H.; Chen, Y.; Chen, K.; Li, G.; Gu, S.; Tan, X. Overexpression ofBnWRKY33in oilseed rape enhances resistance to Sclerotinia sclerotiorum: Enhanced resistance to Sclerotinia sclerotiorum. Mol. Plant Pathol. 2014, 15, 677–689. [Google Scholar] [CrossRef]
- Zhou, F.; Zhang, X.-L.; Li, J.-L.; Zhu, F.-X. Dimethachlon Resistance in Sclerotinia sclerotiorum in China. Plant Dis. 2014, 98, 1221–1226. [Google Scholar] [CrossRef] [Green Version]
- Xu, T.; Yao, F.; Liang, W.-S.; Li, Y.-H.; Li, D.-R.; Wang, H.; Wang, Z.-Y. Involvement of alternative oxidase in the regulation of growth, development, and resistance to oxidative stress of Sclerotinia sclerotiorum. J. Microbiol. 2012, 50, 594–602. [Google Scholar] [CrossRef]
- Dzhavakhiya, V.; Shcherbakova, L.; Semina, Y.; Zhemchuzhina, N.; Campbell, B. Chemosensitization of Plant Pathogenic Fungi to Agricultural Fungicides. Front. Microbiol. 2012, 3, 87. [Google Scholar] [CrossRef]
- Kim, K.; Lee, Y.; Ha, A.; Kim, J.-I.; Park, A.R.; Yu, N.H.; Son, H.; Choi, G.J.; Park, H.W.; Lee, C.W.; et al. Chemosensitization of Fusarium graminearum to Chemical Fungicides Using Cyclic Lipopeptides Produced by Bacillus amyloliquefaciens Strain JCK-12. Front. Plant Sci. 2017, 8, 2010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shcherbakova, L.; Mikityuk, O.; Arslanova, L.; Stakheev, A.; Erokhin, D.; Zavriev, S.; Dzhavakhiya, V. Studying the Ability of Thymol to Improve Fungicidal Effects of Tebuconazole and Difenoconazole Against Some Plant Pathogenic Fungi in Seed or Foliar Treatments. Front. Microbiol. 2021, 12, 629429. [Google Scholar] [CrossRef] [PubMed]
- Karpova, N.V.; Yaderets, V.V.; Glagoleva, E.V.; Petrova, K.S.; Ovchinnikov, A.I.; Dzhavakhiya, V.V. Antifungal Activity of the Dry Biomass of Penicillium chrysogenum F-24-28 and Is Application in Combination with Azoxystrobin for Efficient Crop Protection. Agriculture 2021, 11, 935. [Google Scholar] [CrossRef]
- Yaderets, V.V.; Karpova, N.V.; Glagoleva, E.V.; Ovchinnikov, A.I.; Petrova, K.S.; Dzhavakhiya, V.V. Inhibition of the Growth and Development of Sclerotinia sclerotiorum (Lib.) De Bary by Combining Azoxystrobin, Penicillium chrysogenum VKM F-4876d, and Bacillus Strains. Agronomy 2021, 11, 2520. [Google Scholar] [CrossRef]
- Cai, M.; Hu, C.; Wang, X.; Zhao, Y.; Jia, W.; Sun, X.; Elyamine, A.M.; Zhao, X. Selenium induces changes of rhizosphere bacterial characteristics and enzyme activities affecting chromium/selenium uptake by pak choi (Brassica campestris L. ssp. Chinensis Makino) in chromium contaminated soil. Environ. Pollut. 2019, 249, 716–727. [Google Scholar] [CrossRef]
- Trippe, R.C., 3rd; Pilon-Smits, E.A.H. Selenium transport and metabolism in plants: Phytoremediation and biofortification implications. J. Hazard. Mater. 2021, 404, 124178. [Google Scholar] [CrossRef]
- Sarwar, N.; Akhtar, M.; Kamran, M.A.; Imran, M.; Riaz, M.A.; Kamran, K.; Hussain, S. Selenium biofortification in food crops: Key mechanisms and future perspectives. J. Food Compos. Anal. 2020, 93, 103615. [Google Scholar] [CrossRef]
- Shakibaie, M.; Forootanfar, H.; Golkari, Y.; Mohammadi-Khorsand, T.; Shakibaie, M.R. Anti-biofilm activity of biogenic selenium nanoparticles and selenium dioxide against clinical isolates of Staphylococcus aureus, Pseudomonas aeruginosa, and Proteus mirabilis. J. Trace Elem. Med. Biol. 2015, 29, 235–241. [Google Scholar] [CrossRef]
- WH, L.; CH, C.; CW, H.; CC, W.; VH, L. Selenite enhances immune response against Pseudomonas aeruginosa PA14 via SKN-1 in Caenorhabditis elegans. PLoS ONE 2014, 9, e105810. [Google Scholar] [CrossRef] [Green Version]
- Jia, W.; Hu, C.; Xu, J.; Ming, J.; Zhao, Y.; Cai, M.; Sun, X.; Liu, X.; Zhao, X. Dissolved organic matter derived from rape straw pretreated with selenium in soil improves the inhibition of Sclerotinia sclerotiorum growth. J. Hazard. Mater. 2019, 369, 601–610. [Google Scholar] [CrossRef]
- Cheng, Q.; Jia, W.; Hu, C.; Shi, G.; Yang, D.; Cai, M.; Zhan, T.; Tang, Y.; Zhou, Y.; Sun, X.; et al. Enhancement and improvement of selenium in soil to the resistance of rape stem against Sclerotinia sclerotiorum and the inhibition of dissolved organic matter derived from rape straw on mycelium. Environ. Pollut. 2020, 265, 114827. [Google Scholar] [CrossRef] [PubMed]
- Jia, W.; Hu, C.; Ming, J.; Zhao, Y.; Xin, J.; Sun, X.; Zhao, X. Action of selenium against Sclerotinia sclerotiorum: Damaging membrane system and interfering with metabolism. Pestic. Biochem. Physiol. 2018, 150, 10–16. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Jiang, D.; Xie, J.; Cheng, J.; Li, G.; Yi, X.; Fu, Y. Ss-Sl2, a novel cell wall protein with PAN modules, is essential for sclerotial development and cellular integrity of Sclerotinia sclerotiorum. PLoS ONE 2012, 7, e34962. [Google Scholar] [CrossRef] [PubMed]
- Firoz, M.J.; Xiao, X.; Zhu, F.X.; Fu, Y.P.; Jiang, D.H.; Schnabel, G.; Luo, C.X. Exploring mechanisms of resistance to dimethachlone in Sclerotinia sclerotiorum. Pest Manag. Sci. 2016, 72, 770–779. [Google Scholar] [CrossRef]
- Xu, L.; Xiang, M.; White, D.; Chen, W. pH dependency of sclerotial development and pathogenicity revealed by using genetically defined oxalate-minus mutants of Sclerotinia sclerotiorum. Environ. Microbiol. 2015, 17, 2896–2909. [Google Scholar] [CrossRef]
- Kind, T.; Wohlgemuth, G.; Lee, D.Y.; Lu, Y.; Palazoglu, M.; Shahbaz, S.; Fiehn, O. FiehnLib: Mass Spectral and Retention Index Libraries for Metabolomics Based on Quadrupole and Time-of-Flight Gas Chromatography/Mass Spectrometry. Anal. Chem. 2009, 81, 10038–10048. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Kang, T.; Talab, K.M.A.; Zhu, F.; Li, J. Molecular and biochemical characterization of dimethachlone resistant isolates of Sclerotinia sclerotiorum. Pestic. Biochem. Physiol. 2017, 138, 15–21. [Google Scholar] [CrossRef]
- Liu, X.; Yin, Y.; Yan, L.; Michailides, T.J.; Ma, Z. Sensitivity to iprodione and boscalid of Sclerotinia sclerotiorum isolates collected from rapeseed in China. Pestic. Biochem. Physiol. 2009, 95, 106–112. [Google Scholar] [CrossRef]
- Wang, Y.; Duan, Y.-B.; Zhou, M.-G. Baseline sensitivity and efficacy of fluazinam in controlling Sclerotinia stem rot of rapeseed. Eur. J. Plant Pathol. 2015, 144, 337–343. [Google Scholar] [CrossRef]
- Wang, Y.; Hou, Y.-P.; Chen, C.-J.; Zhou, M.-G. Detection of resistance in Sclerotinia sclerotiorum to carbendazim and dimethachlon in Jiangsu Province of China. Australas. Plant Pathol. 2014, 43, 307–312. [Google Scholar] [CrossRef]
- Liu, K.; Cai, M.; Hu, C.; Sun, X.; Cheng, Q.; Jia, W.; Yang, T.; Nie, M.; Zhao, X. Selenium (Se) reduces Sclerotinia stem rot disease incidence of oilseed rape by increasing plant Se concentration and shifting soil microbial community and functional profiles. Environ. Pollut. 2019, 254, 113051. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Q.; Hu, C.; Jia, W.; Cai, M.; Zhao, Y.; Tang, Y.; Yang, D.; Zhou, Y.; Sun, X.; Zhao, X. Selenium reduces the pathogenicity of Sclerotinia sclerotiorum by inhibiting sclerotial formation and germination. Ecotoxicol. Environ. Saf. 2019, 183, 109503. [Google Scholar] [CrossRef] [PubMed]
- Tan, J.; Bednarek, P.; Liu, J.; Schneider, B.; Svatoš, A.; Hahlbrock, K. Universally occurring phenylpropanoid and species-specific indolic metabolites in infected and uninfected Arabidopsis thaliana roots and leaves. Phytochemistry 2004, 65, 691–699. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdel-Farid, I.B.; Jahangir, M.; van den Hondel, C.A.M.J.J.; Kim, H.K.; Choi, Y.H.; Verpoorte, R. Fungal infection-induced metabolites in Brassica rapa. Plant Sci. 2009, 176, 608–615. [Google Scholar] [CrossRef]
- John, K.M.M.; Jung, E.S.; Lee, S.; Kim, J.-S.; Lee, C.H. Primary and secondary metabolites variation of soybean contaminated with Aspergillus sojae. Food Res. Int. 2013, 54, 487–494. [Google Scholar] [CrossRef]
- de Oliveira, C.S.; Lião, L.M.; Alcantara, G.B. Metabolic response of soybean plants to Sclerotinia sclerotiorum infection. Phytochemistry 2019, 167, 112099. [Google Scholar] [CrossRef] [PubMed]
- Hwang, B.K.; Lim, S.W.; Kim, B.S.; Lee, J.Y.; Moon, S.S. Isolation and in vivo and in vitro antifungal activity of phenylacetic acid and sodium phenylacetate from Streptomyces humidus. Appl. Environ. Microbiol. 2001, 67, 3739–3745. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiao, M.; He, W.; Ouyang, Z.; Shi, Q.; Wen, Y. Progress in structural and functional study of the bacterial phenylacetic acid catabolic pathway, its role in pathogenicity and antibiotic resistance. Front. Microbiol. 2022, 13, 964019. [Google Scholar] [CrossRef]
- Iwase, A.; Takebayashi, A.; Aoi, Y.; Favero, D.S.; Watanabe, S.; Seo, M.; Kasahara, H.; Sugimoto, K. 4-Phenylbutyric acid promotes plant regeneration as an auxin by being converted to phenylacetic acid via an IBR3-independent pathway. Plant Biotechnol. 2022, 39, 51–58. [Google Scholar] [CrossRef]
- Maki, Y.; Soejima, H.; Sugiyama, T.; Watahiki, M.K.; Sato, T.; Yamaguchi, J. 3-Phenyllactic acid is converted to phenylacetic acid and induces auxin-responsive root growth in Arabidopsis plants. Plant Biotechnol. 2022, 39, 111–117. [Google Scholar] [CrossRef]
- Hou, Y.-P.; Mao, X.-W.; Wu, L.-Y.; Wang, J.-X.; Mi, B.; Zhou, M.-G. Impact of fluazinam on morphological and physiological characteristics of Sclerotinia sclerotiorum. Pestic. Biochem. Physiol. 2019, 155, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Mao, S.; Lee, S.-J.; Hwangbo, H.; Kim, Y.-W.; Park, K.-H.; Cha, G.-S.; Park, R.-D.; Kim, K.-Y. Isolation and characterization of antifungal substances from Burkholderia sp. culture broth. Curr. Microbiol. 2006, 53, 358–364. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Zhao, Q.; Yang, Q.; Liu, H.; Li, Q.; Yi, X.; Cheng, Y.; Guo, L.; Fan, C.; Zhou, Y. Comparative transcriptomic analysis uncovers the complex genetic network for resistance to Sclerotinia sclerotiorum in Brassica napus. Sci. Rep. 2016, 6, 19007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, H.-J.; Di, Y.-L.; Li, J.-L.; Zhu, F.-X. Baseline sensitivity and control efficacy of fluazinam against Sclerotinia sclerotiorum. Eur. J. Plant Pathol. 2015, 142, 691–699. [Google Scholar] [CrossRef]
- Theis, T.; Stahl, U. Antifungal proteins: Targets, mechanisms and prospective applications. Cell. Mol. Life Sci. 2004, 61, 437–455. [Google Scholar] [CrossRef] [PubMed]
- Tao, N.; Jia, L.; Zhou, H. Anti-fungal activity of Citrus reticulata Blanco essential oil against Penicillium italicum and Penicillium digitatum. Food Chem. 2014, 153, 265–271. [Google Scholar] [CrossRef]
- Ultee, A.; Bennik, M.H.J.; Moezelaar, R. The Phenolic Hydroxyl Group of Carvacrol Is Essential for Action against the Food-Borne Pathogen Bacillus cereus. Appl. Environ. Microbiol. 2002, 68, 1561–1568. [Google Scholar] [CrossRef] [Green Version]
- Liang, X.; Rollins, J.A. Mechanisms of Broad Host Range Necrotrophic Pathogenesis in Sclerotinia sclerotiorum. Phytopathology 2018, 108, 1128–1140. [Google Scholar] [CrossRef] [Green Version]
- Xu, L.; Li, G.; Jiang, D.; Chen, W. Sclerotinia sclerotiorum: An Evaluation of Virulence Theories. Annu. Rev. Phytopathol. 2018, 56, 311–338. [Google Scholar] [CrossRef]
- Rahmanpour, S.; Backhouse, D.; Nonhebel, H.M. Reaction of glucosinolate-myrosinase defence system in Brassica plants to pathogenicity factor of Sclerotinia sclerotiorum. Eur. J. Plant Pathol. 2010, 128, 429–433. [Google Scholar] [CrossRef]
- Hegedus, D.D.; Li, R.; Buchwaldt, L.; Parkin, I.; Whitwill, S.; Coutu, C.; Bekkaoui, D.; Roger Rimmer, S. Brassica napus possesses an expanded set of polygalacturonase inhibitor protein genes that are differentially regulated in response to Sclerotinia sclerotiorum infection, wounding and defense hormone treatment. Planta 2008, 228, 241–253. [Google Scholar] [CrossRef] [PubMed]
- Liang, X.; Moomaw, E.W.; Rollins, J.A. Fungal oxalate decarboxylase activity contributes to Sclerotinia sclerotiorum early infection by affecting both compound appressoria development and function. Mol. Plant Pathol. 2015, 16, 825–836. [Google Scholar] [CrossRef] [PubMed]
- Lionetti, V.; Fabri, E.; De Caroli, M.; Hansen, A.R.; Willats, W.G.T.; Piro, G.; Bellincampi, D. Three Pectin Methylesterase Inhibitors Protect Cell Wall Integrity for Arabidopsis Immunity to Botrytis. Plant Physiol. 2017, 173, 1844–1863. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kubicek, C.P.; Starr, T.L.; Glass, N.L. Plant cell wall-degrading enzymes and their secretion in plant-pathogenic fungi. Annu. Rev. Phytopathol. 2014, 52, 427–451. [Google Scholar] [CrossRef]
- Kim, Y.T.; Prusky, D.O.V.; Rollins, J.A. An activating mutation of the Sclerotinia sclerotiorum pac1 gene increases oxalic acid production at low pH but decreases virulence. Mol. Plant Pathol. 2007, 8, 611–622. [Google Scholar] [CrossRef]
- Favaron, F.; Sella, L.; D’Ovidio, R. Relationships among endo-polygalacturonase, oxalate, pH, and plant polygalacturonase-inhibiting protein (PGIP) in the interaction between Sclerotinia sclerotiorum and soybean. Mol. Plant-Microbe Interact. 2004, 17, 1402–1409. [Google Scholar] [CrossRef] [Green Version]
- Yu, Y.; Xiao, J.; Yang, Y.; Bi, C.; Qing, L.; Tan, W. Ss-Bi1 encodes a putative BAX inhibitor-1 protein that is required for full virulence of Sclerotinia sclerotiorum. Physiol. Mol. Plant Pathol. 2015, 90, 115–122. [Google Scholar] [CrossRef]
- Li, M.; Liang, X.; Rollins, J.A. Sclerotinia sclerotiorum γ-glutamyl transpeptidase (Ss-Ggt1) is required for regulating glutathione accumulation and development of sclerotia and compound appressoria. Mol. Plant-Microbe Interact. 2012, 25, 412–420. [Google Scholar] [CrossRef] [Green Version]
- Guyon, K.; Balagué, C.; Roby, D.; Raffaele, S. Secretome analysis reveals effector candidates associated with broad host range necrotrophy in the fungal plant pathogen Sclerotinia sclerotiorum. BMC Genom. 2014, 15, 336. [Google Scholar] [CrossRef]
Gene Name | Forward Primer (5′-…-3′) | Reverse Primer (5′-…-3′) |
---|---|---|
Ssodc1 | GATGAGGGCCAACTTACGGT | CGGGAGTGTTAGGCTTCAGG |
Ssodc2 | ATTTCTTGCCAACGCCCAAC | TGGGCCACGTAAGTTTGGAA |
CWDE2 | ATGCTCCTTTCACCACAACC | ACACCCCCATTCGCATAATA |
CWDE10 | CCAATGGAGATCAGCAAGGT | TTGTACATTCGCCAAACCAA |
SsBi1 | TCATTCCAGCAAACCTACAACC | GAACATAGCACCACCCACGAG |
SsGgt1 | AGATCGCCCAACTTCACTCG | TTCCCTCTGTCAAAGTCGCC |
β-tublin | TTGGATTTGCTCCTTTGACCAG | AGCGGCCATCATGTTCTTAGG |
Pathway | Description | # Compounds (dem) | Compounds (dem) | # Compounds (All) | Compounds (All) |
---|---|---|---|---|---|
brp01100 | Metabolic pathways-Brassica rapa (field mustard) | 36 | C00049; C00407; C00042; C00257; C00122; C00106; C00334; C00818; C00299; C00294; C00212; C00217; C00333; C00047; C07086; C00253; C00198; C06337; C00242; C00188; C00547; C00689; C00954; C05422; C00184; C00568; C06104; C02226; C00077; C01762; C00438; C06087; C06424; C00449; C06552; C00064 | 124 | C00183; C00180; C00037; C00049; C00148; C00189; C00407; C00042; C00137; C00257; C00989; C00122; C05519; C00249; C01236; C00794; C00106; C00149; C00334; C01904; C00818; C00258; C00299; C00294; C00178; C00212; C00158; C00217; C01083; C00333; C00047; C01234; C01595; C00208; C07086; C00243; C00387; C01571; C01494; C00093; C00116; C00253; C00055; C00327; C02273; C00209; C06423; C06156; C06427; C00198; C06337; C00124; C00059; C00099; C00233; C00191; C00199; C00232; C00089; C00811; C00160; C00847; C00493; C00242; C00559; C00188; C01013; C00547; C00147; C01732; C00263; C00295; C00689; C00026; C00379; C00954; C00499; C01514; C01089; C00979; C01040; C00836; C04411; C05422; C00319; C00090; C00184; C02656; C00624; C00036; C01157; C00735; C00601; C00590; C00568; C00530; C01717; C06104; C00152; C02226; C00077; C01762; C10164; C00438; C06087; C00509; C03722; C01617; C05953; C06424; C05635; C00449; C01042; C05437; C00016; C00581; C02512; C06555; C05141; C00385; C06712; C06552; C00051; C00064 |
brp01110 | Biosynthesis of secondary metabolites-Brassica rapa (field mustard) | 13 | C00049; C00407; C00042; C00257; C00122; C00047; C00253; C00198; C00188; C00077; C01762; C06087; C00449 | 50 | C00183; C00180; C00037; C00049; C00148; C00407; C00042; C00257; C00122; C01236; C00149; C00258; C00158; C01083; C00047; C01234; C01494; C00093; C00253; C00327; C06427; C00198; C00099; C00233; C00199; C00811; C00160; C00493; C00188; C00263; C00026; C01514; C00979; C04411; C00196; C00624; C00036; C01479; C00590; C00152; C00077; C01762; C06087; C00509; C05901; C01617; C00449; C00016; C02512; C00385 |
brp02010 | ABC transporters-Brassica rapa (field mustard) | 9 | C00049; C00407; C00121; C00333; C05402; C00047; C00188; C00077; C00064 | 28 | C00183; C00037; C00049; C00148; C00407; C00137; C00121; C00794; C00487; C01083; C00333; C05402; C00047; C00208; C00243; C00093; C00392; C00116; C02273; C00059; C00089; C01835; C00188; C00379; C00492; C00077; C00051; C00064 |
brp01230 | Biosynthesis of amino acids-Brassica rapa (field mustard) | 7 | C00049; C00407; C00047; C00188; C00077; C00449; C00064 | 22 | C00183; C00037; C00049; C00148; C00407; C00158; C00047; C00327; C00233; C00199; C00493; C00188; C00263; C00026; C00979; C04411; C00624; C00036; C00152; C00077; C00449; C00064 |
brp00250 | Alanine, aspartate and glutamate metabolism-Brassica rapa (field mustard) | 6 | C00049; C00042; C00122; C00334; C00438; C00064 | 12 | C00049; C00042; C00122; C00334; C00158; C00232; C00026; C00036; C00152; C00438; C01042; C00064 |
brp00760 | Nicotinate and nicotinamide metabolism-Brassica rapa (field mustard) | 6 | C00049; C00042; C00122; C00334; C01384; C00253 | 8 | C00049; C00042; C00122; C00334; C01384; C00253; C00232; C03722 |
brp01200 | Carbon metabolism-Brassica rapa (field mustard) | 6 | C00049; C00042; C00257; C00122; C00198; C00184 | 20 | C00037; C00049; C00042; C00257; C00989; C00122; C01236; C00149; C00258; C00158; C00198; C00199; C00232; C00160; C01013; C01732; C00026; C00979; C00184; C00036 |
brp00230 | Purine metabolism-Brassica rapa (field mustard) | 5 | C00294; C00212; C00242; C01762; C00064 | 12 | C00037; C00294; C00212; C00387; C00059; C00242; C00559; C00147; C00499; C01762; C00385; C00064 |
brp00970 | Aminoacyl-tRNA biosynthesis-Brassica rapa (field mustard) | 5 | C00049; C00407; C00047; C00188; C00064 | 9 | C00183; C00037; C00049; C00148; C00407; C00047; C00188; C00152; C00064 |
brp01210 | 2-Oxocarboxylic acid metabolism-Brassica rapa (field mustard) | 5 | C00049; C00407; C00047; C02226; C00077 | 12 | C00183; C00049; C00407; C00158; C00047; C00233; C00026; C04411; C00624; C00036; C02226; C00077 |
brp00053 | Ascorbate and aldarate metabolism-Brassica rapa (field mustard) | 4 | C00879; C00818; C00333; C05422 | 8 | C00137; C00879; C00818; C00333; C00191; C00026; C01040; C05422 |
brp00220 | Arginine biosynthesis-Brassica rapa (field mustard) | 4 | C00049; C00122; C00077; C00064 | 7 | C00049; C00122; C00327; C00026; C00624; C00077; C00064 |
brp00240 | Pyrimidine metabolism-Brassica rapa (field mustard) | 4 | C00106; C00299; C00438; C00064 | 10 | C00106; C00299; C00178; C00055; C00099; C01013; C00295; C00526; C00438; C00064 |
brp00350 | Tyrosine metabolism-Brassica rapa (field mustard) | 4 | C00042; C00122; C01384; C00547 | 8 | C00042; C00122; C01384; C00232; C00811; C00547; C00642; C00530 |
brp00380 | Tryptophan metabolism-Brassica rapa (field mustard) | 4 | C00954; C02693; C02172; C05831 | 10 | C00954; C02043; C02470; C02693; C01717; C10164; C02172; C03722; C05635; C05831 |
brp00410 | beta-Alanine metabolism-Brassica rapa (field mustard) | 4 | C00049; C00106; C00334; C05670 | 8 | C00049; C00106; C00334; C00099; C01013; C01073; C05670; C03722 |
brp00650 | Butanoate metabolism-Brassica rapa (field mustard) | 4 | C00042; C00122; C00334; C01384 | 8 | C00042; C00989; C00122; C00334; C01384; C00232; C00026; C01089 |
brp00030 | Pentose phosphate pathway-Brassica rapa (field mustard) | 3 | C00257; C00121; C00198 | 7 | C00257; C00121; C01236; C00258; C00198; C00199; C03752 |
brp00290 | Valine, leucine and isoleucine biosynthesis-Brassica rapa (field mustard) | 3 | C00407; C00188; C02226 | 6 | C00183; C00407; C00233; C00188; C04411; C02226 |
brp00300 | Lysine biosynthesis-Brassica rapa (field mustard) | 3 | C00049; C00047; C00449 | 5 | C00049; C00047; C00263; C00026; C00449 |
brp00330 | Arginine and proline metabolism-Brassica rapa (field mustard) | 3 | C00334; C01877; C00077 | 9 | C00148; C00334; C01877; C05942; C01157; C00077; C00431; C00581; C05147 |
brp00360 | Phenylalanine metabolism-Brassica rapa (field mustard) | 3 | C00042; C00122; C07086 | 8 | C00180; C00042; C00122; C07086; C00811; C00642; C00601; C02137 |
brp00460 | Cyanoamino acid metabolism-Brassica rapa (field mustard) | 3 | C00049; C00407; C05670 | 8 | C00183; C00037; C00049; C00407; C05670; C00152; C01401; C02512 |
brp00960 | Tropane, piperidine and pyridine alkaloid biosynthesis-Brassica rapa (field mustard) | 3 | C00407; C00047; C00253 | 4 | C00407; C00047; C00253; C01479 |
brp00020 | Citrate cycle (TCA cycle)-Brassica rapa (field mustard) | 2 | C00042; C00122 | 6 | C00042; C00122; C00149; C00158; C00026; C00036 |
brp00190 | Oxidative phosphorylation-Brassica rapa (field mustard) | 2 | C00042; C00122 | 2 | C00042; C00122 |
brp00260 | Glycine, serine and threonine metabolism-Brassica rapa (field mustard) | 2 | C00049; C00188 | 7 | C00037; C00049; C05519; C00258; C00188; C00263; C00581 |
brp00261 | Monobactam biosynthesis-Brassica rapa (field mustard) | 2 | C00049; C00188 | 3 | C00049; C00059; C00188 |
brp00310 | Lysine degradation-Brassica rapa (field mustard) | 2 | C00047; C00449 | 7 | C00037; C00487; C00047; C00489; C00449; C02727; C00431 |
brp00480 | Glutathione metabolism-Brassica rapa (field mustard) | 2 | C05422; C00077 | 4 | C00037; C05422; C00077; C00051 |
brp00620 | Pyruvate metabolism-Brassica rapa (field mustard) | 2 | C00042; C00122 | 4 | C00042; C00122; C00149; C00036 |
brp00630 | Glyoxylate and dicarboxylate metabolism-Brassica rapa (field mustard) | 2 | C00042; C00064 | 12 | C00037; C00042; C00149; C00258; C00158; C00209; C00160; C01732; C00026; C00036; C00898; C00064 |
brp00660 | C5-Branched dibasic acid metabolism-Brassica rapa (field mustard) | 2 | C02341; C02226 | 5 | C00490; C02341; C01732; C00026; C02226 |
brp00770 | Pantothenate and CoA biosynthesis-Brassica rapa (field mustard) | 2 | C00049; C00106 | 4 | C00183; C00049; C00106; C00099 |
brp00910 | Nitrogen metabolism-Brassica rapa (field mustard) | 2 | C00192; C00064 | 2 | C00192; C00064 |
Treatments | Mycelium Growth (cm) | Inhibitory Ratio (%) | Notes | ||
---|---|---|---|---|---|
Name | DIM Concentration (mg/L) | PA Concentration (mg/mL) | |||
CK1 | None | None | 6.09 ± 0.00a | / | Previous study [21] |
T1 | 1.0 mg/L DIM | None | 3.96 ± 0.14b | 35.50% | |
T2 | 0.10 mg/mL PA | 1.92 ± 0.09c | 68.73% | ||
CK2 | None | None | 5.28 ± 0.03a | / | This study |
T3 | 0.8 mg/L DIM | None | 3.91 ± 0.07d | 25.82% | |
T4 | 0.10 mg/mL PA | 2.50 ± 0.00e | 52.61% | ||
Name | Reduced DIM content (mg) (1L solution) | Increased PA content (g) (1L solution) | Δ Mycelium growth (cm) | Increased Inhibitory ratio (%) | Calculated by data of previous study and this study |
T4/T1 | 0.20 | 0.10 | 2.13/2.78 | 17.11% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, H.; Cheng, Q.; Wang, X.; Jia, W.; Xie, J.; Fan, G.; Han, C.; Zhao, X. Selenium Improved Phenylacetic Acid Content in Oilseed Rape and Thus Enhanced the Prevention of Sclerotinia sclerotiorum by Dimethachlon. J. Fungi 2022, 8, 1193. https://doi.org/10.3390/jof8111193
Zhang H, Cheng Q, Wang X, Jia W, Xie J, Fan G, Han C, Zhao X. Selenium Improved Phenylacetic Acid Content in Oilseed Rape and Thus Enhanced the Prevention of Sclerotinia sclerotiorum by Dimethachlon. Journal of Fungi. 2022; 8(11):1193. https://doi.org/10.3390/jof8111193
Chicago/Turabian StyleZhang, Huan, Qin Cheng, Xu Wang, Wei Jia, Jiatao Xie, Guocheng Fan, Chuang Han, and Xiaohu Zhao. 2022. "Selenium Improved Phenylacetic Acid Content in Oilseed Rape and Thus Enhanced the Prevention of Sclerotinia sclerotiorum by Dimethachlon" Journal of Fungi 8, no. 11: 1193. https://doi.org/10.3390/jof8111193
APA StyleZhang, H., Cheng, Q., Wang, X., Jia, W., Xie, J., Fan, G., Han, C., & Zhao, X. (2022). Selenium Improved Phenylacetic Acid Content in Oilseed Rape and Thus Enhanced the Prevention of Sclerotinia sclerotiorum by Dimethachlon. Journal of Fungi, 8(11), 1193. https://doi.org/10.3390/jof8111193