Next Article in Journal
Comprehensive Assessment of Ameliorative Effects of AMF in Alleviating Abiotic Stress in Tomato Plants
Next Article in Special Issue
Production of a β-Glucosidase-Rich Cocktail from Talaromyces amestolkiae Using Raw Glycerol: Its Role for Lignocellulose Waste Valorization
Previous Article in Journal
Molecular Phylogeny of Endophytic Fungi from Rattan (Calamus castaneus Griff.) Spines and Their Antagonistic Activities against Plant Pathogenic Fungi
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Random Transfer of Ogataea polymorpha Genes into Saccharomyces cerevisiae Reveals a Complex Background of Heat Tolerance

1
Department of Bioinformatics Engineering, Graduate School of Information Science and Technology, Osaka University, 1-5 Yamadaoka, Suita, Osaka 565-0871, Japan
2
Yeast Genetic Resources Laboratory, Graduate School of Engineering, Osaka University, Osaka 565-0871, Japan
*
Author to whom correspondence should be addressed.
J. Fungi 2021, 7(4), 302; https://doi.org/10.3390/jof7040302
Submission received: 19 March 2021 / Revised: 13 April 2021 / Accepted: 13 April 2021 / Published: 15 April 2021
(This article belongs to the Special Issue Fungal Biotechnology and Application)

Abstract

Horizontal gene transfer, a process through which an organism acquires genes from other organisms, is a rare evolutionary event in yeasts. Artificial random gene transfer can emerge as a valuable tool in yeast bioengineering to investigate the background of complex phenotypes, such as heat tolerance. In this study, a cDNA library was constructed from the mRNA of a methylotrophic yeast, Ogataea polymorpha, and then introduced into Saccharomyces cerevisiae. Ogataea polymorpha was selected because it is one of the most heat-tolerant species among yeasts. Screening of S. cerevisiae populations expressing O. polymorpha genes at high temperatures identified 59 O. polymorpha genes that contribute to heat tolerance. Gene enrichment analysis indicated that certain S. cerevisiae functions, including protein synthesis, were highly temperature-sensitive. Additionally, the results confirmed that heat tolerance in yeast is a complex phenotype dependent on multiple quantitative loci. Random gene transfer would be a useful tool for future bioengineering studies on yeasts.

1. Introduction

Horizontal gene transfer is a rare evolutionary event in yeast, in which functional genes are acquired from other species [1]. Gene transfer among eukaryotes is a relatively rare event that is limited by unknown barriers [2,3,4]. Genome analysis revealed that the budding yeast Saccharomyces cerevisiae has acquired several genes from bacteria, such as those encoding metabolite enzymes and transporters [5,6,7].
Artificial random gene transfer is a technique used in conventional genetic engineering to identify valuable genes, such as those useful for metabolic engineering [8]. In addition, the technique can help investigate the genetic background of quantitative traits, as many loci, each with small effects, contribute to heat tolerance [9,10]. Transfer of a gene pool would provide a list of genes that contribute to heat tolerance in the host yeast, and this list of genes will help elucidate the genetic complexity behind the heat tolerance phenotype.
In this study, we used a cDNA library for a random gene transfer experiment [11]. The cDNA library was constructed from the mRNA of a methylotrophic yeast, Ogataea polymorpha, and then introduced into S. cerevisiae. Saccharomyces cerevisiae is an industrial host for bioethanol production. Since improved heat tolerance reduces the costs required for cooling during fermentation [12], many genetic analyses and adaptive evolutionary studies have been performed [13,14,15]. Ogataea polymorpha was selected because it can grow at temperatures close to 50 °C and is one of the most heat-tolerant species among yeasts [16,17]. Under high temperatures, screening the S. cerevisiae population identified 60 colonies showing improved heat tolerance and the corresponding O. polymorpha genes responsible for heat tolerance. Additionally, the list of genes uncovered the S. cerevisiae functions that are sensitive to high temperatures.

2. Materials and Methods

2.1. Strains, Plasmids, and Yeast Transformation

The yeast strains and plasmids used in this study are listed in Table 1. Plasmids were derived from pGK413, pGK414, or pGK416, in which gene expression is controlled by the PGK1 promoter [18]. For the construction of cDNA libraries, O. polymorpha BY4329 cells were cultured till the exponential growth phase in 5 mL of yeast extract-peptone-adenine-dextrose (YPAD) medium and then harvested by centrifugation at 12,000× g for 5 min. mRNA was extracted from the cells using the Ribo-Pure Yeast Kit (Thermo Fisher Scientific, Waltham, MA, USA). Two overlapping regions for the In-Fusion method were added to the three plasmids using the inverse PCR method with pGK413, pGK414, and pGK416 as the templates and the primers pGK_inv_fw (TCTCATCGTACCCCGGAAATAAATT) and pGK_inv_rv (AACTATGGTGACGAAGTTTTATATTTGTTG) [11]. A cDNA library was constructed from the mRNA mixture and the amplicon of inverse PCR, using the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio, Inc., Shiga, Japan). The In-Fusion mixture was introduced into Escherichia coli HST08 competent cells (Takara Bio, Inc.) by electroporation at 25 μF and 2 kV. The pulse controller was set to 200 Ω using a GenePulser (Bio-Rad Laboratories, Hercules, CA, USA). Ampicillin-resistant cells were recovered from agar plates, from which the plasmid pools were prepared. The growth conditions, DNA-related techniques, and the lithium-acetate method for transformation have been described previously [19].

2.2. Culture Conditions

All strains were cultured in YPAD medium (1% Bacto yeast extract, 2% Bacto peptone, 2% glucose, and 0.004% adenine) and synthetic dextrose (SD) medium (0.67% yeast nitrogen base without amino acids and 2% or 0.5% glucose, as necessary, 0.006% leucine, 0.003% lysine hydrochloride, 0.002% histidine, 0.004% adenine, 0.004% tryptophan, and 0.002% uracil). Yeast cells grown on the agar plate were cultured in 5 mL of SD medium containing the required amino acids overnight at 30 °C and 150 rpm. To screen for cell growth, the transformants were cultured overnight in SD agar medium containing amino acids at 39 °C or 39.5 °C in an incubator (TVA360DB, ADVANTEC, Tokyo, Japan).

2.3. Construction of Screening System for the Heat-Resistant Evolved Strain

Saccharomyces cerevisiae YPH499 was transformed with the cDNA library of O. polymorpha using the lithium-acetate method and then cultured for several days in SD agar medium to obtain colonies of transformants. From the original SD agar plates, replica plates were prepared on other SD agar plates using the replica plating method. The replicas were cultured at 39 °C or 39.5 °C. The plasmids in the selected transformants were extracted using the Easy Yeast Plasmid Isolation Kit (Takara). Each plasmid was introduced into E. coli HST08 competent cells and cultured in L medium containing 5 mL ampicillin. Plasmid purification was performed using LaboPass Mini (Hokkaido System Science), and sequence analysis was performed using the PGK 5′ primer (TAGTTTTTCAAGTTCTTAGA) and PGK 3′ primer (CTATTATTTTAGCGTAAAGG). For each plasmid, the corresponding O. polymorpha gene was identified using the BLAST search function in the UniProt database, including O. polymorpha genome information (http://www.uniprot.org/ accessed on 13 April 2021) [17]. Saccharomyces cerevisiae orthologs were identified using the BLAST search of the Saccharomyces Genome Database (SGD, https://www.yeastgenome.org/ accessed on 13 April 2021). Gene enrichment analysis was performed using the over-representation analysis function of the WebGestalt web tool (http://www.webgestalt.org/ accessed on 13 April 2021) [20]. The Gene Ontology (GO) dataset of all O. polymorpha proteins was retrieved from the UniProt database. The Benjamini-Hochberg (GH) method was used to evaluate the false discovery rate (FDR).

2.4. Confirmation of Reproducibility by Spot Method

Transformants were inoculated on SD agar medium containing 20 g/L glucose and cultured at 30 °C for two days. A single colony grown on the plate was inoculated into a test tube containing 5 mL of SD medium and precultured at 30 °C and 150 rpm. The preculture solution was then centrifuged at 3000 rpm and 4 °C. The collected transformants were suspended in sterile distilled water. Suspensions (6 μL) were then spotted onto SD agar medium supplemented with the appropriate amino acids and incubated at 39 °C or higher for five days.

3. Results

3.1. Comparison of Vectors for Artificial Random Gene Transfer

For the construction of an O. polymorpha cDNA library, three CEN/ARS plasmid vectors (single copy-type), namely pGK416 (possessing URA3), pGK413 (possessing HIS3), and pGK414 (possessing TRP1), were employed [18]. Because the relationship between amino acid auxotrophy and heat tolerance was expected, three control strains possessing pGK416, pGK413, and pGK414 (strains TT01c, TT02c, and TT03c, respectively) were constructed from the S. cerevisiae YPH499 strain and cultured on agar plates to compare their heat tolerance phenotypes (Figure 1A,B). The TT01c and TT02c strains were able to grow at 39 °C but failed to grow at 39.5 °C. However, many colonies that grew at 39 °C showed an abnormally wet phenotype. The upper growth limit of TT03c was 38 °C (Figure 1C). These results showed that the amino acid auxotrophy of S. cerevisiae affected the heat tolerance of yeast for as yet unknown reasons.

3.2. Screening of Heat-Tolerant S. cerevisiae Strains Expressing O. polymorpha cDNA

A cDNA library was constructed from the O. polymorpha BY4329 strain. The cDNA fragments were inserted into pGK416, pGK413, and pGK414, which were then introduced into the S. cerevisiae YPH499 strain to produce three populations possessing O. polymorpha cDNA (TT01, TT02, and TT03, respectively). Approximately 400 colonies grew on each selection plate, and a replica plate was prepared using the replica plating technique. A total of 50–80 replica plates consisting of approximately 20,000–32,000 colonies were prepared for each population (TT01, TT02, and TT03).
The replica plates were incubated at 39.5 °C for the TT01 and TT02 populations and at 39 °C for the TT03 population. After one week, no colonies were obtained from the TT02 population. In contrast, 11 and 49 colonies were obtained on the replica plates of the TT01 and TT03 populations, respectively. No colonies were identified after additional screening at higher temperatures.
Following the collection of plasmid vectors from the 60 colonies, sequences of open reading frames of the cDNAs were determined to identify the corresponding O. polymorpha genes, S. cerevisiae ortholog genes, and their putative functions using the BLAST search of UniProt and SGD databases (Table 2 and Table S1) [17]. Among the 60 colonies, an identical gene (OGAPODRAFT_52470, an ortholog of S. cerevisiae QCR8 ubiquinol-cytochrome c reductase subunit 8) was identified from two independent colonies (TT01-2 and TT01-8). The cDNAs obtained from four colonies (TT03-46, -47, -48, and -49) had poor homology to all S. cerevisiae ORFs (E-value < 1.0 × 10−3), suggesting that these cDNAs were derived from O. polymorpha-specific genes.
Functional categorization of the annotation list revealed that the transferred cDNAs encoded genes involved in various functions such as metabolism (for example, HPODL_02693 encoding 6-phosphofructo-2-kinase, obtained from colony ID TT03-21), translation (HPODL_00942 encoding ribosomal protein P2B, obtained from colony ID TT03-29), electron transport chain (HPODL_02610 encoding cytochrome c1, obtained from colony ID TT01-9), and protein quality control (OGAPODRAFT_12972 encoding the chaperonin GroES, obtained from colony ID TT01-7).
Gene enrichment analysis was performed using the GH method to control the FDR. The results showed that genes encoding ribosomal proteins and other proteins involved in translation were overrepresented in the list of 59 O. polymorpha genes, with 11 (19%) and 9 (15%) cDNAs encoding genes related to the GO terms “structural constituent of ribosome” and “translation”, respectively (Table 3).

3.3. Reconstruction of Heat-Tolerant S. cerevisiae Strains

The S. cerevisiae strains listed in Table 2 were reconstructed to check the false-positive rate derived from the screening approach. For this purpose, 10 out of the 49 plasmid vectors were randomly selected from the TT03 populations and then introduced into the YPH499 strains. The heat tolerance of the reconstructed strains was investigated using a spot assay under high temperature conditions (Figure 2). Although 5-fold serial dilutions were employed to confirm differences in heat tolerance, we found that almost all reconstructed strains tended to be more tolerant to high temperatures (39 °C) than the control strain (TT03c). These results suggest that the false-positive rate was low enough in the screening approach.

4. Discussion

In this study, we introduced a cDNA library derived from O. polymorpha into S. cerevisiae. Screening of the S. cerevisiae populations expressing the O. polymorpha cDNA library under high temperature conditions resulted in 60 colonies showing improved heat tolerance and identification of the O. polymorpha genes responsible for heat tolerance (Figure 2 and Table 2). These results reveal three aspects of the high temperature tolerance of S. cerevisiae.
First, we identified 59 candidate genes in O. polymorpha that contribute to heat tolerance. However, these results do not imply that the heat stability of proteins is derived from these genes. Since a strong promoter (PGK1 promoter) was used to express cDNA, a large amount of overexpressed proteins might have also contributed to heat tolerance. Further genetic and biochemical characterization is needed to examine the heat stability of the proteins expressed from the candidate genes. Moreover, this experiment failed to transfer all O. polymorpha genes to S. cerevisiae because the cDNA library used in this study was collected from O. polymorpha in exponential growth phase at 30 °C. More candidate genes are likely to be obtained using more comprehensive cDNA libraries prepared from O. polymorpha, for instance, under high temperature conditions.
Second, the genes identified in this study revealed the S. cerevisiae functions that are sensitive to high temperatures, because these functions were complemented by the expression of corresponding genes derived from O. polymorpha. Gene enrichment analysis showed that many of the S. cerevisiae proteins sensitive to high temperatures were ribosomal proteins and those involved in other steps of translation. Previous studies have reported that genes related to chaperonins [21], superoxide dismutase [22], ubiquitination [23], nitric oxide [24], H+-ATPase [25], and trehalose biosynthesis [26,27] were responsible for the heat tolerance of S. cerevisiae. While genes encoding chaperonin (TT01-7) and superoxide dismutase (TT03-20) were found, genes responsible for other functions such as H+-ATPase activity and trehalose biosynthesis were not found in the present study (Table 2). These results indicate that chaperonins, superoxide dismutase, ribosome, and translation may be additional targets for improving the heat tolerance of S. cerevisiae.
Thirdly, our results highlight that heat tolerance in yeasts is a complex phenotype that is controlled by multiple genes. This supports the idea that the improvement of heat tolerance in S. cerevisiae requires the expression of multiple heat-stable proteins. This study demonstrated that random gene transfer is a helpful laboratory evolution tool for investigating the genetic background of complex phenotypes, as well as for enabling future bioengineering studies.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/jof7040302/s1, Table S1: Annotation of O. polymorpha genes obtained from colonies of heat tolerant S. cerevisiae expressing O. polymorpha cDNA.

Author Contributions

Conceptualization, H.S. and F.M.; investigation, T.S. and Y.N.; resources, Y.K.; data curation, F.M.; writing—original draft preparation, Y.N.; writing—review and editing, T.S., Y.K., H.S. and F.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported in part by the Grants-in-Aid for Scientific Research (C) (Grant No.18K04851).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Acknowledgments

We thank Yoshihiro Toya and Minetaka Sugiyama for helpful comments to this manuscript. pGK series vectors were provided by the National Bio-Resource Project (NBRP) Yeast, Japan.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Soucy, S.M.; Huang, J.; Gogarten, J.P. Horizontal gene transfer: Building the web of life. Nat. Rev. Genet. 2015, 16, 472–482. [Google Scholar] [CrossRef] [PubMed]
  2. Yoshida, S.; Maruyama, S.; Nozaki, H.; Shirasu, K. Horizontal gene transfer by the parasitic plant Striga hermonthica. Science 2010, 328, 1128. [Google Scholar] [CrossRef] [PubMed]
  3. Zhang, D.; Qi, J.; Yue, J.; Huang, J.; Sun, T.; Li, S.; Wen, J.F.; Hettenhausen, C.; Wu, J.; Wang, L.; et al. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer. BMC Plant Biol. 2014, 14, 19. [Google Scholar] [CrossRef] [PubMed]
  4. Novo, M.; Bigey, F.; Beyne, E.; Galeote, V.; Gavory, F.; Mallet, S.; Cambon, B.; Legras, J.L.; Wincker, P.; Casaregola, S.; et al. Eukaryote-to-eukaryote gene transfer events revealed by the genome sequence of the wine yeast Saccharomyces cerevisiae EC1118. Proc. Natl. Acad. Sci. USA 2009, 106, 16333–16338. [Google Scholar] [CrossRef] [PubMed]
  5. Hall, C.; Brachat, S.; Dietrich, F.S. Contribution of horizontal gene transfer to the evolution of Saccharomyces cerevisiae. Eukaryot. Cell 2005, 4, 1102–1115. [Google Scholar] [CrossRef] [PubMed]
  6. Moriguchi, K.; Yamamoto, S.; Tanaka, K.; Kurata, N.; Suzuki, K. Trans-kingdom horizontal DNA transfer from bacteria to yeast is highly plastic due to natural polymorphisms in auxiliary nonessential recipient genes. PLoS ONE 2013, 8, e74590. [Google Scholar] [CrossRef]
  7. Milner, D.S.; Attah, V.; Cook, E.; Maguire, F.; Savory, F.R.; Morrison, M.; Muller, C.A.; Foster, P.G.; Talbot, N.J.; Leonard, G.; et al. Environment-dependent fitness gains can be driven by horizontal gene transfer of transporter-encoding genes. Proc. Natl. Acad. Sci. USA 2019, 116, 5613–5622. [Google Scholar] [CrossRef]
  8. Shi, S.; Ji, H.; Siewers, V.; Nielsen, J. Improved production of fatty acids by Saccharomyces cerevisiae through screening a cDNA library from the oleaginous yeast Yarrowia lipolytica. FEMS Yeast Res. 2016, 16, fov108. [Google Scholar] [CrossRef] [PubMed]
  9. Wang, Z.; Qi, Q.; Lin, Y.; Guo, Y.; Liu, Y.; Wang, Q. QTL analysis reveals genomic variants linked to high-temperature fermentation performance in the industrial yeast. Biotechnol. Biofuels 2019, 12, 59. [Google Scholar] [CrossRef] [PubMed]
  10. Yang, Y.; Foulquie-Moreno, M.R.; Clement, L.; Erdei, E.; Tanghe, A.; Schaerlaekens, K.; Dumortier, F.; Thevelein, J.M. QTL analysis of high thermotolerance with superior and downgraded parental yeast strains reveals new minor QTLs and converges on novel causative alleles involved in RNA processing. PLoS Genet. 2013, 9, e1003693. [Google Scholar] [CrossRef]
  11. Narazaki, Y.; Nomura, Y.; Morita, K.; Shimizu, H.; Matsuda, F. Expression of Saccharomyces cerevisiae cDNAs to enhance the growth of non-ethanol-producing S. cerevisiae strains lacking pyruvate decarboxylases. J. Biosci. Bioeng. 2018, 126, 317–321. [Google Scholar] [CrossRef]
  12. Steensels, J.; Snoek, T.; Meersman, E.; Picca Nicolino, M.; Voordeckers, K.; Verstrepen, K.J. Improving industrial yeast strains: Exploiting natural and artificial diversity. FEMS Microbiol. Rev. 2014, 38, 947–995. [Google Scholar] [CrossRef]
  13. Riles, L.; Fay, J.C. Genetic basis of variation in heat and ethanol tolerance in Saccharomyces cerevisiae. G3 2019, 9, 179–188. [Google Scholar] [CrossRef] [PubMed]
  14. Caspeta, L.; Nielsen, J. Thermotolerant yeast strains adapted by laboratory evolution show trade-off at ancestral temperatures and preadaptation to other stresses. MBio 2015, 6, e00431. [Google Scholar] [CrossRef] [PubMed]
  15. Kitichantaropas, Y.; Boonchird, C.; Sugiyama, M.; Kaneko, Y.; Harashima, S.; Auesukaree, C. Cellular mechanisms contributing to multiple stress tolerance in Saccharomyces cerevisiae strains with potential use in high-temperature ethanol fermentation. AMB Express 2016, 6, 107. [Google Scholar] [CrossRef]
  16. Ishchuk, O.P.; Voronovsky, A.Y.; Abbas, C.A.; Sibirny, A.A. Construction of Hansenula polymorpha strains with improved thermotolerance. Biotechnol. Bioeng. 2009, 104, 911–919. [Google Scholar] [CrossRef] [PubMed]
  17. Riley, R.; Haridas, S.; Wolfe, K.H.; Lopes, M.R.; Hittinger, C.T.; Goker, M.; Salamov, A.A.; Wisecaver, J.H.; Long, T.M.; Calvey, C.H.; et al. Comparative genomics of biotechnologically important yeasts. Proc. Natl. Acad. Sci. USA 2016, 113, 9882–9887. [Google Scholar] [CrossRef]
  18. Ishii, J.; Izawa, K.; Matsumura, S.; Wakamura, K.; Tanino, T.; Tanaka, T.; Ogino, C.; Fukuda, H.; Kondo, A. A simple and immediate method for simultaneously evaluating expression level and plasmid maintenance in yeast. J. Biochem. 2009, 145, 701–708. [Google Scholar] [CrossRef] [PubMed]
  19. Ishii, J.; Morita, K.; Ida, K.; Kato, H.; Kinoshita, S.; Hataya, S.; Shimizu, H.; Kondo, A.; Matsuda, F. A pyruvate carbon flux tugging strategy for increasing 2,3-butanediol production and reducing ethanol subgeneration in the yeast Saccharomyces cerevisiae. Biotechnol. Biofuels 2018, 11, 180. [Google Scholar] [CrossRef]
  20. Wang, J.; Vasaikar, S.; Shi, Z.; Greer, M.; Zhang, B. WebGestalt 2017: A more comprehensive, powerful, flexible and interactive gene set enrichment analysis toolkit. Nucleic Acids Res. 2017, 45, W130–W137. [Google Scholar] [CrossRef]
  21. Verghese, J.; Abrams, J.; Wang, Y.; Morano, K.A. Biology of the heat shock response and protein chaperones: Budding yeast (Saccharomyces cerevisiae) as a model system. Microbiol. Mol. Biol. Rev. 2012, 76, 115–158. [Google Scholar] [CrossRef] [PubMed]
  22. Zyrina, A.N.; Smirnova, E.A.; Markova, O.V.; Severin, F.F.; Knorre, D.A. Mitochondrial superoxide dismutase and Yap1p act as a signaling module contributing to ethanol tolerance of the yeast Saccharomyces cerevisiae. Appl. Environ. Microbiol. 2017, 83, e02759-16. [Google Scholar] [CrossRef]
  23. Uesugi, S.; Watanabe, D.; Kitajima, M.; Watanabe, R.; Kawamura, Y.; Ohnishi, M.; Takagi, H.; Kimura, K. Calcineurin inhibitors suppress the high-temperature stress sensitivity of the yeast ubiquitin ligase Rsp5 mutant: A new method of screening for calcineurin inhibitors. FEMS Yeast Res. 2014, 14, 567–574. [Google Scholar] [CrossRef] [PubMed][Green Version]
  24. Nishimura, A.; Kawahara, N.; Takagi, H. The flavoprotein Tah18-dependent NO synthesis confers high-temperature stress tolerance on yeast cells. Biochem. Biophys. Res. Commun. 2013, 430, 137–143. [Google Scholar] [CrossRef] [PubMed]
  25. Coote, P.J.; Jones, M.V.; Seymour, I.J.; Rowe, D.L.; Ferdinando, D.P.; McArthur, A.J.; Cole, M.B. Activity of the plasma membrane H+-ATPase is a key physiological determinant of thermotolerance in Saccharomyces cerevisiae. Microbiology 1994, 140 (Pt 8), 1881–1890. [Google Scholar] [CrossRef]
  26. Gibney, P.A.; Lu, C.; Caudy, A.A.; Hess, D.C.; Botstein, D. Yeast metabolic and signaling genes are required for heat-shock survival and have little overlap with the heat-induced genes. Proc. Natl. Acad. Sci. USA 2013, 110, E4393–E4402. [Google Scholar] [CrossRef] [PubMed]
  27. Shima, J.; Hino, A.; Yamada-Iyo, C.; Suzuki, Y.; Nakajima, R.; Watanabe, H.; Mori, K.; Takano, H. Stress tolerance in doughs of Saccharomyces cerevisiae trehalase mutants derived from commercial Baker’s yeast. Appl. Environ. Microbiol. 1999, 65, 2841–2846. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Colonies on replica plates of control strains cultivated under high temperature conditions for one week. (A) TT01c (YPH499 (pGK416)) cultured at 39 °C. (B) TT02c (YPH499 (pGK413)) cultured at 39 °C. (C) TT03c (YPH499 (pGK414)) cultured at 38 °C.
Figure 1. Colonies on replica plates of control strains cultivated under high temperature conditions for one week. (A) TT01c (YPH499 (pGK416)) cultured at 39 °C. (B) TT02c (YPH499 (pGK413)) cultured at 39 °C. (C) TT03c (YPH499 (pGK414)) cultured at 38 °C.
Jof 07 00302 g001
Figure 2. Heat tolerance of reconstructed strains. The dilution series was employed to confirm differences in heat tolerance. Samples were withdrawn from cultures, and their OD600 values were adjusted to 20. Five-fold serial dilutions of these cultures were prepared in sterile distilled water, and 6 μL each of the cultures at OD600 = 20 and their dilutions were spotted onto SD plates without tryptophan. The plates were then incubated at 39 °C for 5 days and photographed.
Figure 2. Heat tolerance of reconstructed strains. The dilution series was employed to confirm differences in heat tolerance. Samples were withdrawn from cultures, and their OD600 values were adjusted to 20. Five-fold serial dilutions of these cultures were prepared in sterile distilled water, and 6 μL each of the cultures at OD600 = 20 and their dilutions were spotted onto SD plates without tryptophan. The plates were then incubated at 39 °C for 5 days and photographed.
Jof 07 00302 g002
Table 1. Strains and plasmids used in this study.
Table 1. Strains and plasmids used in this study.
Strain NameGenotypeSource
Ogataea polymorpha BY4329Leu1-1Obtained from NBRP Yeast
Saccharomyces cerevisiae YPH499MATa, ura3-52 lys2-801_amber ade2-101_ochre trp1-Δ63 his3-Δ200 leu2-Δ1Thermo Scientific
TT01YPH499 (pGK416_BY4329 cDNA library)This study
TT02YPH499 (pGK413_BY4329 cDNA library)This study
TT03YPH499 (pGK414_BY4329 cDNA library)This study
TT01cYPH499 (pGK416)This study
TT02cYPH499 (pGK413)This study
TT03cYPH499 (pGK414)This study
Escherichiacoli DH5αdeoR endA1 gyrA96 hsdR17(rk-mk+) recA1 relA1 supE44 thi-1Δ(lacZYA-argFV169) φ80lacZΔM15 F-
Escherichiacoli HST08F,endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔM15, Δ(lacZYA-argF) U169, Δ(mrr-hsdRMS-mcrBC), ΔmcrA,λ–
Plasmids
pGK413Yeast expression vector containing PGK1 promoter, origin, ARS4/CEN6 HIS3 marker, no expression (control plasmid) [18]
pGK414Yeast expression vector containing PGK1 promoter, origin, ARS4/CEN6 TRP1 marker, no expression (control plasmid) [18]
pGK416Yeast expression vector containing PGK1 promoter, origin, ARS4/CEN6 URA3 marker, no expression (control plasmid) [18]
Table 2. Annotation of O. polymorpha genes obtained from colonies of heat-tolerant S. cerevisiae expressing O. polymorpha cDNA (1).
Table 2. Annotation of O. polymorpha genes obtained from colonies of heat-tolerant S. cerevisiae expressing O. polymorpha cDNA (1).
Colony IDGene ID of O. polymorpha (2)S. cerevisiae Ortholog (3)Functional Annotation of S. cerevisiae Ortholog
TT01-1OGAPODRAFT_7331CAF20cap-associated protein CAF20
TT01-2OGAPODRAFT_52470QCR8ubiquinol-cytochrome c reductase subunit 8
TT01-3OGAPODRAFT_16764ALD4aldehyde dehydrogenase
TT01-4HPODL_02546RPL16A60S ribosomal protein L16-B
TT01-5HPODL_00806GUP1acyltransferase
TT01-6OGAPODRAFT_17522THO1SAP domain-containing ribonucleoprotein
TT01-7OGAPODRAFT_12972HSP10chaperonin GroES
TT01-8OGAPODRAFT_52470QCR8ubiquinol-cytochrome c reductase subunit 8
TT01-9HPODL_02610CYT1cytochrome c1, heme protein, mitochondrial
TT01-10HPODL_04437FRK1serine/threonine protein kinase
TT01-11OGAPODRAFT_15309PAF1RNA polymerase II-associated factor 1
TT03-1HPODL_02637GRS1glycine--tRNA ligase 1, mitochondrial
TT03-2HPODL_00026NAP1histone chaperone NAP1
TT03-3HPODL_05027NAB2mRNA-binding protein NAB2
TT03-4HPODL_03235ERV25p24 family protein delta-1
TT03-5HPODL_05028RPS2ribosomal 40S subunit protein S2
TT03-6OGAPODRAFT_25583RIB33,4-dihydroxy-2-butanone-4-phosphate synthase RIB3
TT03-7HPODL_03162ACB1long-chain fatty acid transporter ACB1
TT03-8HPODL_01585RAD4DNA repair protein RAD4
TT03-9HPODL_00194MRP7mitochondrial 54S ribosomal protein YmL2
TT03-10HPODL_02367RPS31ubiquitin-ribosomal 40S subunit protein S31 fusion protein
TT03-11OGAPODRAFT_76806CYT2cytochrome c1 heme lyase CYT2
TT03-12OGAPODRAFT_92206PSA1mannose-1-phosphate guanylyltransferase
TT03-13HPODL_01049GRX6glutathione-disulfide reductase GRX6
TT03-14HPODL_00042RPL7Aribosomal 60S subunit protein L7A
TT03-15HPODL_04105RPL42Aribosomal 60S subunit protein L42A
TT03-16OGAPODRAFT_17069PTI1cleavage polyadenylation factor subunit PTI1
TT03-17HPODL_01073ANB1translation elongation factor eIF-5A
TT03-18HPODL_02594MMF1isoleucine biosynthesis protein MMF1
TT03-19OGAPODRAFT_102344PGK13-phosphoglycerate kinase
TT03-20 (4)HPODL_02458SOD2superoxide dismutase SOD2
TT03-21 (4)HPODL_02693PFK266-phosphofructo-2-kinase
TT03-22HPODL_02169TAF9transcription initiation factor TFIID subunit 9
TT03-23 (4)HPODL_01966RAD6E2 ubiquitin-conjugating protein RAD6
TT03-24HPODL_02705RPL1Aribosomal 60S subunit protein L1A
TT03-25 (4)HPODL_01497ASC1guanine nucleotide-binding protein subunit beta
TT03-26HPODL_01957MET5sulfite reductase (NADPH) subunit beta
TT03-27OGAPODRAFT_75779CEP3centromere DNA-binding protein complex CBF3 subunit B
TT03-28HPODL_03364RPL23Bribosomal 60S subunit protein L23B
TT03-29 (4)HPODL_00942RPP2Bribosomal protein P2B
TT03-30HPODL_01497ASC1guanine nucleotide-binding protein subunit beta
TT03-31HPODL_02465SER2phosphoserine phosphatase
TT03-32OGAPODRAFT_74529STE5pheromone-responsive MAPK scaffold protein
TT03-33 (4)HPODL_03495ACC1acetyl-CoA carboxylase
TT03-34OGAPODRAFT_16247DEG1pseudouridine synthase DEG1
TT03-35OGAPODRAFT_76195STM1Uncharacterized protein
TT03-36OGAPODRAFT_17428SLM1phosphatidylinositol 4,5-bisphosphate-binding protein
TT03-37OGAPODRAFT_15585RPS26Aribosomal 40S subunit protein S26A
TT03-38HPODL_03366SNF3high-affinity glucose transporter SNF3
TT03-39HPODL_03527IDP1isocitrate dehydrogenase (NADP(+))
TT03-40 (4)OGAPODRAFT_7594SOM1mitochondrial export protein Som1
TT03-41HPODL_02149ETR1trans-2-enoyl-CoA reductase
TT03-42HPODL_04585MYO5myosin-5
TT03-43HPODL_01873SBA1hsp90 cochaperone SBA1
TT03-44 (4)HPODL_01380PRY2sterol-binding protein
TT03-45HPODL_01021RPS27Bribosomal 40S subunit protein S27B
TT03-46HPODL_02251n.d.n.d.
TT03-47HPODL_04413n.d.n.d.
TT03-48 (4)OGAPODRAFT_16908n.d.n.d.
TT03-49 (4)OGAPODRAFT_15905n.d.n.d.
(1) Full data are shown in Table S1. (2) Ogataea polymorpha genes were identified using the BLASTN function of UniProt. Partial nucleotide sequences were used as queries. (3) Saccharomyces cerevisiae orthologs were identified using the BLASTP function of SGD (E-value < 1.0 × 10−4). The full amino acid sequences of the O. polymorpha gene products were used as queries. (4) Corresponding strain was reconstructed for confirmation, as shown in Figure 2.
Table 3. Gene enrichment analysis of the list of 59 O. polymorpha genes.
Table 3. Gene enrichment analysis of the list of 59 O. polymorpha genes.
GO Term False Discovery Rate (FDR)Number of Matches
structural constituent of ribosomeGO:00037350.00001457911
translationGO:00064120.000287969
ribosomeGO:00058400.0471436
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Seike, T.; Narazaki, Y.; Kaneko, Y.; Shimizu, H.; Matsuda, F. Random Transfer of Ogataea polymorpha Genes into Saccharomyces cerevisiae Reveals a Complex Background of Heat Tolerance. J. Fungi 2021, 7, 302. https://doi.org/10.3390/jof7040302

AMA Style

Seike T, Narazaki Y, Kaneko Y, Shimizu H, Matsuda F. Random Transfer of Ogataea polymorpha Genes into Saccharomyces cerevisiae Reveals a Complex Background of Heat Tolerance. Journal of Fungi. 2021; 7(4):302. https://doi.org/10.3390/jof7040302

Chicago/Turabian Style

Seike, Taisuke, Yuki Narazaki, Yoshinobu Kaneko, Hiroshi Shimizu, and Fumio Matsuda. 2021. "Random Transfer of Ogataea polymorpha Genes into Saccharomyces cerevisiae Reveals a Complex Background of Heat Tolerance" Journal of Fungi 7, no. 4: 302. https://doi.org/10.3390/jof7040302

APA Style

Seike, T., Narazaki, Y., Kaneko, Y., Shimizu, H., & Matsuda, F. (2021). Random Transfer of Ogataea polymorpha Genes into Saccharomyces cerevisiae Reveals a Complex Background of Heat Tolerance. Journal of Fungi, 7(4), 302. https://doi.org/10.3390/jof7040302

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop