Multi-Gene Phylogeny and Taxonomy of Hydnellum (Bankeraceae, Basidiomycota) from China

Abstract

The genus Hydnellum is an important group of stipitate hydnaceous fungi which can form ectomycorrhiza with many species of woody plants. In recent decades, the frequency and number of basidiocarps observed in China have been declining significantly. So far, however, we know little about the species diversity of Hydnellum in China. In this study, we conducted molecular phylogenetic analyses based on sections of multiple loci, including the large subunit of nuclear ribosomal RNA gene (nLSU), the internal transcribed spacer regions (ITS), the small subunit of nuclear ribosomal RNA gene (SSU) and the second-largest subunit of RNA polymerase II gene (RPB2), as well as morphological studies, of collected samples of Hydnellum from China. We also inferred Maximum Likelihood and Bayesian phylogenies for the order Thelephorales from the dataset of the combined nLSU and ITS. This study has revealed the phylogenetic position of Hydnellum in the order Thelephorales, and phylogenetically confirmed ten major clades in Thelephorales; Twenty-nine taxa are proposed, described or reported, including 10 new subgenera (Hydnellum subgenus Hydnellum, subg. Caesispinosum, subg. Croceum, subg. Inflatum, subg. Rhizomorphum, subg. Scabrosum, subg. Spongiosum, subg. Subindufibulatum, subg. Violaceum and subg. Zonatum), 11 new species (Hydnellum atrorubrum, H. atrospinosum, H. bomiense, H. brunneorubrum, H. fibulatum, H. granulosum, H. inflatum, H. rubidofuscum, H. squamulosum, H. sulcatum and H. yunnanense), 3 newly recorded species (H. caeruleum, H. peckii and H. spongiosipes) and 5 notable specimens (Hydnellum sp 1, H. sp 2, H. sp 3, H. sp 4 and H. sp 5). A classification system based on the morphological characteristics (especially the hyphal structure types) and molecular analyses is proposed to accommodate most species in Hydnellum. The distinguishing characters of the subgenera and the new species with their closely related taxa are discussed. A key to the species of Hydnellum from China is provided.

1. Introduction

The genus Hydnellum, together with Bankera, Phellodon and Sarcodon, are a homogenous group of soil-inhabiting Basidiomycota (with the common characteristic of a hymenophore with a spinulose hymenium) that belongs to the Bankeraceae, Thelephorales [1,2].

All species of Bankeraceae are considered ectomycorrhizal and are associated with woody plants, mainly members of Pinaceae and Fagaceae [3,4,5,6,7], and colonize natural or relatively undisturbed forests [8]. These fungi can absorb organic substances from host plants and also transport nutrients and water from the soil to the plants, which improves the stability of forest ecosystems [9,10]. In addition, some species of Hydnellum have important medicinal functions, including cholesterol-lowering, antioxidant, anti-inflammatory, anti-tumor, immune enhancement, etc. [11]. For instance, Lee et al. [12] suggested that H. concrescens extracts prevents the expression of NDV-HN glycoprotein on the cell surface by inhibiting the activity of α-glucosidase, thus exhibiting anti-viral function. This can be on par with the health benefit potentials of herbal plant infusions [13].

Due to substantial declines in abundance, they have become the focus of increasing conservation concern [14,15,16]. This is mainly attributed to the effect of habitat loss, aerial pollution, nitrogen deposition and soil acidification [17,18,19,20,21]. Stipitate hydnoid fungi, as symbols for the recent decline of ectomycorrhizal fungi, have been redlisted in, e.g., Norway, Poland, Germany, and the Netherlands [7,14,18,19,22,23,24]. Furthermore, an action plan for 14 rare species of hydnoid fungi has been announced to provide strategic management for their future conservation in the UK [25].

The genus Hydnellum is characterized by single to gregarious or coalescent pileate, stipitate basidiocarps, spinous hymenophore, corky to woody, not duplex to duplex, azonate to zonate context, uninflated to inflated generative hyphae, with or without clamp connections, and brown, irregularly ellipsoid to globose, tuberculate basidiospores. Some species display olivaceous or blue-green colours with KOH [1,2,5,26,27]. However, differentiation between closely related species within Hydnellum becomes significantly difficult on account of their macromorphological polymorphism caused by growing around obstacles or fusing to other adjacent basidiocarps [2,27]. Therefore, molecular sequence data are very important in identifying them. Molecular evidence has confirmed that Hydnellum has a close phylogenetic affiliation with the genus Sarcodon, and both genera aggregated in the same clade, named the “Hydnellum-Sarcodon lineage” [28,29,30]. Furthermore, the phylogenetic analysis of Hydnellum and Sarcodon according to Baird et al. [27] suggested that the generic limits need reassessment. To revise the generic limits and make genera monophyletic, Larsson et al. [31] moved 12 species from Sarcodon to Hydnellum, resulting in the generic circumscription of Hydnellum being amended. Morphologically, basidiospore size appears to separate the genera in most cases.

Most of the described species of Hydnellum are distributed to North America [2,27,32,33,34] and Europe [1,6,35,36], with a few species reported from Singapore, India, Australia, and New Guinea [26]. About 61 species have been described and transferred to the genus according to Index Fungorum (http://www.indexfungorum.org/ (accessed on 1 August 2021)) and MycoBank; however, only three taxa have been previously reported from China, and detailed molecular studies have not been performed [37]. Some specimens of this genus collected from China were identified as H. aurantiacum, H. ferrugineum and H. suaveolens based solely on morphological characteristics. However, molecular methods revealed that these specimens are misidentified, and the specimens need to be re-identified.

Numerous Hydnellum specimens have been collected from field investigations on stipitate hydnoid fungi in China during the past two decades. During the study of these specimens, twenty-nine new taxa have been identified using morphological characters and phylogenetic analyses of nuc rDNA ITS1-5.8S-ITS2 combined with nuc 28S rDNA, nuc 18S rDNA and nuc RPB2 rDNA sequences. In this paper, we present these taxa with illustrated morphological descriptions, phylogeny and comparison with related and/or similar taxa, a key and classification system.

The aims of this study are: (1) To describe the new taxa of Hydnellum from China and confirm or propose infrageneric subdivision (new subgenera, new species and newly recorded species) based on morphological and phylogenetic analyses; (2) To provide a classification system using hyphal structure types, molecularly supported clades and morphological characteristics within Hydnellum and Sarcodon; and (3) To confirm the phylogenetic position of Hydnellum within the Thelephorales.

2. Materials and Methods

2.1. Morphological Studies

Specimens were deposited at the herbarium of the Institute of Applied Ecology, Chinese Academy of Sciences (IFP). Microscopic procedures followed Mu et al. [38]. Structures were examined microscopically from sections mounted in Cotton Blue (CB): 0.1 mg aniline blue dissolved in 60 g pure lactic acid; CB+ = cyanophilous, CB− = acyanophilous. Amyloid and dextrinoid reactions were tested in Melzer’s reagent (IKI): 1.5 g KI (potassium iodide), 0.5 g I (crystalline iodine), 22 g chloral hydrate, 20 mL distilled water; IKI− = neither amyloid nor dextrinoid reaction. Sections were mounted in 5% KOH and studied at magnifications up to 1000× using a Nikon Eclipse E600 microscope (Tokyo, Japan) with phase contrast illumination. Dimensions were measured by the ruler in the eyepiece, with accuracy within 0.1 μm. In presenting basidiospore size ranges, 5% of the measurements at each end of the range are given in parentheses. The following abbreviations are used in the text: Lm = mean spore length, Wm = mean spore width, Q = range of length/width ratios for specimens studied, and n = total number of basidiospores measured from a given number of specimens. The surface morphology for the basidiospores was observed with a Phenom Prox scanning electron microscope (ESEM, Phenom Prox, FEI, The Netherlands) at an accelerating voltage of 20 kV. A thin layer of gold was coated on the samples to avoid charging. Special color terms are from Rayner [39] and Munsell [40].

2.2. Molecular Procedures and Phylogenetic Analyses

Fungal taxa and strains used in this study are listed in

Table 1. Voucher numbers, geographic origins and GenBank accession numbers for the specimens included; sequences produced in this study are in bold.

Species	Geographic Origin	Voucher Number	GenBank Accessions No.
			SSU	ITS	nLSU	RPB2
Amaurodon aquicoeruleu Agerer	Australia	UK452	–	AM490944	AM490944	–
A. sumatranus Miettinen & Kõljalg	Indonesia	O. Miettinen5877	–	AM490943	–	–
A. viridis (Alb. & Schwein.) J. Schröt.	Norway	KHLarsson14947b	–	MK602707	MK602707	–
A. viridis	Russia	TAA149664	–	AM490942	AY586625	–
Bankera fuligineoalba (J.C. Schmidt) Coker & Beers ex Pouzar	Sweden	ELarsson400-13	–	MK602708	MK602708	–
B. fuligineoalba	Estonia	TAA152454	–	–	AY586635	–
B. violascens (Alb. & Schwein.) Pouzar	Finland	MVijanen130902	–	MK602709	MK602709	–
B. violascens	–	RGC14-033	–	MH310793	–	–
Boletopsis grisea (Peck) Bondartsev & Singer	Sweden	UPS F-120382	–	MN536751	MN535646	–
B. grisea	Spain	AH 42971	–	MN536747	MN535642	–
B. leucomelaena (Pers.) Fayod	Sweden	Krikorev140912	–	MK602710	MK602710	–
B. nothofagi J.A. Cooper & P. Leonard	New Zealand	PDD:96007	–	JQ417193	–	–
Hydnellum amygdaliolens (Rubio Casas, Rubio Roldán & Català) E. Larss., K.H. Larss. & Kõljalg	Iberian Peninsula	SC-2011	–	JN376763	–	–
H. atrorubrum	China	Wei8315	–	MW579937	–	–
H. atrorubrum	China	Wei8261	MW579910	MW579936	MW579884	–
H. atrospinosum	China	Yuan6495	MW579911	MW579938	MW579885	–
H. atrospinosum	China	Yuan6514	MW579913	MW579940	MW579886	–
H. atrospinosum	China	Yuan6520	MW579912	MW579939	–	–
H. aurantiacum (Batsch) P. Karst.	Norway	EBendiksen177-07	–	MK602712	MK602712	–
H. aurantiacum	Norway	OF29502	–	MK602713	MK602713	–
H. auratile (Britzelm.) Maas Geest.	Norway	OF242763	–	MK602715	MK602715	–
H. auratile	Norway	OF294095	–	MK602714	MK602714	–
H. bomiense	China	Yuan 13759	MW579914	MW579941	MW579887	OK254206
H. bomiense	China	Yuan 13767	MW579915	MW579942	–	–
H. bomiense	Estonia	TUF100611	–	UDB003287	–	–
H. bomiense	Costa Rica	TUF100057	–	UDB003286	–	–
H. brunneorubrum	China	Yuan12997	MW579917	MW579944	MW579889	OK254217
H. brunneorubrum	China	Yuan14339	MW579916	MW579943	MW579888	OK254216
H. brunneorubrum	China	Yuan14668	MW579918	MW579945	MW579890	OK254218
H. caeruleum (Hornem.) P. Karst.	Norway	EBendiksen584-11	–	MK602719	MK602719	–
H. caeruleum	Norway	EBendiksen575-11	–	MK602718	MK602718	–
H. caeruleum	China	Wei1474a	–	MW579965	–	–
H. chrysinum K.A. Harrison	–	SC071	–	KJ534291	–	–
H. coactum Y.H. Mu & H.S. Yuan	China	Wei8094	–	MN846278	MN846287	–
H. coactum	China	Shi181	–	MN846279	MN846288	–
H. complicatum Banker	USA	REB-71	–	KC571711	–	–
H. complicatum	USA	REB-329	–	KC571712	–	–
H. concrescens (Pers.) Banker	USA	SEW 88	–	AY569025	–	–
H. concrescens	Mexico	GO-2009-204	–	KC152116	–	–
H. cristatum (Bres.) Stalpers	USA	REB-169	–	JN135174	–	–
H. cristatum	USA	REB-88	–	KC571718	–	–
H. cumulatum K.A. Harrison	Finland	TU115384	–	UDB011871	UDB011871	–
H. cumulatum	Estonia	TU111191	–	UDB032402	–	–
H. cyanopodium K.A. Harrison	USA	SEW 85	–	AY569027	–	–
H. diabolus Banker	Canada	KAH13873	–	AF351863	–	–
H. dianthifolium Loizides	Cyprus	ML61211HY	–	KX619419	–	–
H. dianthifolium	Italy	ML902162HY	–	KX619420	–	–
H. earlianum Banker	USA	REB-75	–	KC571724	–	–
H. earlianum	USA	REB-375	–	JN135179	–	–
H. fagiscabrosum A.M. Ainsw. & Nitare	Sweden	GB-0195621	–	MW144293	MW144293	–
H. fagiscabrosum	Sweden	GB-0195622	–	MW144296	MW144296	–
H. fennicum (P. Karst.) E. Larss, K.H. Larss. & Kõljalg	Norway	OF242833	–	MK602738	MK602738	–
H. fennicum	Norway	OF294087	–	MK602737	MK602737	–
H. ferrugineum (Fr.) P. Karst.	Norway	OF297319	–	MK602720	MK602720	–
H. ferrugineum	Sweden	ELarsson197-14	–	MK602722	MK602722	–
H. ferrugipes Coker	USA	REB-176	–	KC571727	–	–
H. ferrugipes	USA	REB-68	–	JN135176	–	–
H. fibulatum	China	Yuan14646	MW579926	MW579957	–	–
H. fibulatum	China	Yuan14656	MW579927	MW579958	–	–
H. fuligineoviolaceum (Kalchbr.) E. Larss., K.H. Larss. & Kõljalg	Sweden	BNylen130918	–	MK602741	MK602741	–
H. fuligineoviolaceum	Sweden	LA120818	–	MK602740	MK602740	–
H. fuscoindicum (K.A. Harrison) E. Larss., K.H. Larss. & Kõljalg	USA	OSC 113641	–	EU669230	EU669280	–
H. fuscoindicum	USA	OSC 107844	–	EU669229	EU669279	–
H. glaucopus (Maas Geest. & Nannf.) E. Larss., K.H. Larss. & Kõljalg	Sweden	JNitare060916	–	MK602744	MK602744	–
H. glaucopus	Sweden	Edvinson110926	–	MK602745	MK602745	–
H. geogenium (Fr.) Banker	–	AFTOL-ID 680	AY752971	DQ218304	AY631900	DQ408133
H. geogenium	Norway	OF296213	–	MK602724	MK602724	–
H. gracilipes (P. Karst.) P. Karst.	Sweden	ELarsson219-11	–	MK602726	MK602726	–
H. gracilipes	Sweden	GB-0113779	–	MK602727	MK602727	–
H. granulosum	China	Yuan12213a	MW579921	MW579948	MW579893	OK254213
H. granulosum	China	Yuan12213b	MW579920	MW579947	MW579892	OK254212
H. grosselepidotum Y.H. Mu & H.S. Yuan	China	Wei8120	–	MN846274	MN846283	–
H. grosselepidotum	China	Wei8075	–	MN846276	MN846285	–
H. illudens (Maas Geest.) Nitare	Sweden	GB-0195819	–	MW144341	MW144341	–
H. illudens	Norway	O-F-242769	–	MW144335	MW144335	–
H. inflatum	China	Wang80	MW579922	MW579949	MW579894	OK254210
H. inflatum	China	Shi506	MW579923	MW579950	MW579895	OK254211
H. joeides (Pass.) E. Larss., K.H. Larss. & Kõljalg	Sweden	KHjortstam17589	–	MK602750	MK602750	–
H. joeides	Sweden	Nitare110829	–	MK602751	MK602751	–
H. lepidum (Maas Geest.) E. Larss., K.H. Larss. & Kõljalg	Sweden	JNitare110829	–	MK602754	MK602754	–
H. lepidum	Sweden	RGCarlsson10-065	–	MK602752	MK602752	–
H. lidongensis Y.H. Mu & H.S. Yuan	China	We8365	–	MN846280	MN846289	–
H. lidongensis	China	Wei8329	–	MN846281	MN846290	–
H. lundellii (Maas Geest. & Nannf.) E. Larss., K.H. Larss. & Kõljalg	Norway	OF242639	–	MK602759	MK602759	–
H. lundellii	Norway	OF295814	–	MK602760	MK602760	–
H. martioflavum (Snell, K.A. Harrison & H.A.C. Jacks.) E. Larss., K.H. Larss. & Kõljalg	Norway	OF242435	–	MK602762	MK602762	–
H. martioflavum	Norway	OF242872	–	MK602761	MK602761	–
H. mirabile (Fr.) P. Karst.	Sweden	SLund140912	–	MK602730	MK602730	–
H. mirabile	Sweden	ELarsson170-14	–	MK602729	MK602729	–
H. nemorosum A.M. Ainsw. & E. Larss.	Norway	O-F-242352	–	MW144372	MW144372	–
H. nemorosum	Sweden	GB-0195631	–	MW144373	MW144373	–
H. parvum Banker	USA	REB-131	–	JN135187	–	–
H. parvum	USA	REB-392	–	KC571717	–	–
H. peckii Banker	Norway	SSvantesson328	–	MK602731	MK602731	–
H. peckii	Sweden	ELarsson174-14	–	MK602732	MK602732	–
H. peckii	China	Yuan13708	MW579931	MW579966	MW579905	OK254214
H. peckii	China	Yuan13720	MW579932	MW579967	MW579906	OK254215
H. pineticola K.A. Harrison	USA	REB-49	–	KC571733	–	–
H. pineticola	USA	REB-43	–	JN135175	–	–
H. piperatum Coker ex Maas Geest.	USA	REB-332	–	JN135173	–	–
H. piperatum	USA	REB-304	–	KC571723	–	–
H. regium K.A. Harrison	USA	SEW 93	–	AY569031	–	–
H. roseoviolaceum Nitare	Sweden	GB-0195936	–	MW144374	MW144374	–
H. roseoviolaceum	Sweden	GB-0195687	–	MW144375	MW144375	–
H. rubidofuscum	China	Yuan14561	MW579924	MW579951	MW579896	OK254207
H. rubidofuscum	China	Yuan14587	MW579925	MW579952	MW579897	OK254208
H. rubidofuscum	China	Yuan14654	–	MW579953	MW579898	OK254209
H. scabrosum (Fr.) E. Larss., K.H. Larss. & Kõljalg	Norway	OF360777	–	MK602765	MK602765
H. scabrosum	Norway	OF292320	–	MK602766	MK602766
H. scabrosellum Nitare	Sweden	GB-0195792	–	MW144380	MW144380	–
H. scabrosellum	Sweden	GB-0195807	–	MW144381	MW144381	–
H. scleropodium K.A. Harrison	USA	REB-3	–	JN135186	–	–
H. scleropodium	USA	REB-352	–	KC571740	–	–
H. scrobiculatum (Fr.) P. Karst.	USA	REB-78	–	JN135181	–	–
H. spongiosipes (Peck) Pouzar	USA	REB-107	–	KC571743	–	–
H. spongiosipes	USA	REB-52	–	JN135184	–	–
H. spongiosipes	China	Yuan14517	MW579933	MW579968	MW579907	OK254219
H. squamulosum	China	Yuan13615	–	MW579954	–	–
H. squamulosum	China	Yuan13625	–	MW579956	MW579899	OK254204
H. squamulosum	China	Yuan13743	–	MW579955	–	OK254203
H. suaveolens (Scop.) P. Karst.	Sweden	ELarsson8-14	–	MK602735	MK602735	–
H. suaveolens	Norway	SSvantesson877	–	MK602736	MK602736	–
H. subsuccosum K.A. Harrison	USA	SEW 55	–	AY569033	–	–
H. subsuccosum	USA	REB-10	–	JN135178	–	–
H. sulcatum	China	Yuan14521	MW579930	MW579961	MW579902	OK254202
H. sulcatum	China	Yuan14649	MW579929	MW579960	MW579901	–
H. sulcatum	China	Yuan14660	MW579928	MW579959	MW579900	OK254201
H. yunnanense	China	Yuan14386	–	MW579962	MW579903	OK254199
H. yunnanense	China	Yuan14396	–	MW579963	MW579904	OK254200
H. yunnanense	China	Shi212	–	MW579964	–	–
H. underwoodii (Banker) E. Larss., K.H. Larss. & Kõljalg	USA	REB-358	–	JN135189	–	–
H. underwoodii	USA	REB-119	–	KC571782	–	–
H. versipelle (Fr.) E. Larss., K.H. Larss. & Kõljalg	Sweden	RGCarlsson13-057	–	MK602771	MK602771	–
H. versipelle	Sweden	RGCarlsson11-08	–	MK602772	MK602772	–
Hydnellum sp 1	China	Shi164	–	MW579969	–	–
Hydnellum sp 2	China	Yuan14387	MW579934	MW579970	MW579908	–
Hydnellum sp 3	China	Yuan14388	–	MW579971	–	–
Hydnellum sp 4	China	Wang295	–	MW579972	–	–
Hydnellum sp 5	China	Yuan14594	MW579935	MW579973	MW579909	OK254205
Lenzitopsis daii L.W. Zhou & Kõljalg	China	Yuan 2959	–	JN169799	JN169795	–
L. daii	China	Yuan2952	–	JN169798	JN169794	–
L. oxycedri Malençon & Bertault	Spain	KHLarsson15304	–	MK602774	MK602774	–
L. oxycedri	–	UK 635	–	JN169800	JN169796	–
Odontia fibrosa (Berk. & M.A. Curtis) Kõljalg	China	TU115028	–	MK602775	MK602775
O. fibrosa	China	LL_17	–	MT678878	–	–
O. sparsa Yuan, Y.C. Dai & H.S. Yuan	China	Yuan10718	–	MG719980	–	–
O. sparsa	China	Yuan10780	–	MG719979	–	–
Phellodon cf. niger	Sweden	ELarsson35-14	–	MK602782	MK602782	–
P. tomentosus (L.) Banker	Norway	EBendiksen11-810	–	MK602781	MK602781	–
P. tomentosus	–	BG Thesis	–	–	AF518637	–
Polyozellus mariae Voitk & Kõljalg	Canada	TU117348	–	MF100831	MF100831	–
P. mariae	Canada	TU117235	–	MF100826	–	–
P. multiplex (Underw.) Murrill	USA	TU117350	–	MF100830	MF100830	–
P. multiplex	China	TU115049	–	MF100812	MF100812	–
Pseudotomentella abundiloba Svantesson	Norway	OF110312		MK290731	MK290731
P. flavovirens (Höhn. & Litsch.) Svrček	Finland	KHLarsson16190	–	MK602780	MK602780	–
P. rotundispora Svantesson	Sweden	SS394	–	MK290728	MK290728	–
P. rotundispora	Sweden	SS413	–	MK290674	–	–
P. umbrinascens Svantesson	Sweden	SS335	–	MK290697	MK290697	–
Sarcodon aspratus (Berk.) S. Ito	–	–	–	DQ448877	–	–
S. aspratus	–	–	–	AF335110	–	–
S. imbricatus (L.) P. Karst.	Norway	SSvantesson355	–	MK602748	MK602748	–
S. imbricatus	Sweden	ELarsson384-10	–	MK602747	MK602747	–
S. leucopus (Pers.) Maas Geest. & Nannf.	Norway	OF296099	–	MK602755	MK602755	–
S. leucopus	Sweden	PHedberg080811	–	MK602757	MK602757	–
S.quercinofibulatus Pérez-De-Greg., Macau & J. Carbó	Italy	JC-20090718.2	–	JX271818	MK602773	–
S. quercinofibulatus	USA	TENN	–	MG663244	–	–
S. scabripes (Peck) Banker	Mexico	FCME:23240	–	EU293829	–	–
S. scabripes	USA	REB-351	–	JN135191	–	–
S.squamosus (Schaeff.) P. Karst.	Norway	OF295554	–	MK602769	MK602769	–
S. squamosus	Norway	OF177452	–	MK602768	MK602768	–
Steccherinum murashkinskyi (Burt) Maas Geest.	Russia	X449	–	JN710588	JN710588	–
S. ochraceum (Pers. ex J.F. Gmel.) Gray	Sweden	KHL11902	–	JQ031130	JQ031130	–
Thelephora ganbajun M. Zang	China	GDGM 48899	–	MF593267	MH620355	–
T. ganbajun	China	GDGM 48891	–	MF593266	MH620354	–
T. iqbalii Nasir & Hanif	Pakistan	MH810	–	JX241471	–	–
T. terrestris Ehrh.	Denmark	DMS-9327942	–	MT644883	MT644883	–
T. terrestris	Norway	ELarsson295-13	–	MK602777	MK602777	–
Tomentella fuscocrustosa H.S. Yuan, X. Lu & Y.C. Dai	China	Yuan11399	–	MK211712	MK446366	–
T. fuscocrustosa	China	Yuan11420	–	MK211713	MK446367	–
T.patagonica Kuhar & Rajchenb.	Argentina	BAFC52372	–	KT032090	KT032102	–
T. patagonica	Argentina	BAFC52373	–	KT032091	KT032103	–
Tomentellopsis bresadoliana (Sacc. & Trotter) Jülich & Stalpers	Sweden	JEH 031011	–	EU118674	EU118674	–
T. pulchella Kõljalg & Bernicchia	Norway	KHLarsson16366	–	MK602779	MK602779	–

Newly generated sequences in this study are in bold.

. Phire Plant Direct PCR Kit (Thermo Fisher Scientific, Waltham, MA, USA) procedures were used to extract total genomic DNA from the basidiocarps. Polymerase chain reactions (PCR) was performed on a Bio-Rad T100^TM Thermal cycler (Bio-RAD Inc., Hercules, CA, USA). Amplification reactions were performed in a 30 μL reaction mixture using the following final concentrations or total amounts: 0.9 μL template DNA, 15 μL of 2× Phire Plant PCR buffer, 1.5 μL of each primer, 0.6 μL Phire HS II DNA Polymerase, and 10.5 μL ddH₂O (double distilled water). Primer sequences for the used genes are provided in

Table 2. The gene fragments, their corresponding primers and primer sequences used in this study.

Genes	Primers	Primer Sequences (5’-3’)	References
nLSU	LROR	ACCCGCTGAACTTAAGC	Vilgalys & Hester 1990 [48]
	LR7	TACTACCACCAAGATCT	Vilgalys & Hester 1990 [48]
ITS	ITS1-F	CTTGGTCATTTAGAGGAAGTAA	White et al. 1990 [49]
	ITS4	TCCTCCGCTTATTGATATGC	White et al. 1990 [49]
nSSU	NS1	GTAGTCATATGCTTGTCTC	White et al. 1990 [49]
	NS4	CTTCCGTCAATTCCTTTAAG	White et al. 1990 [49]
RPB2	bRPB2-6F	TGGGGYATGGTNTGYCCYGC	Liu et al. 1999 [50]
	bRPB2-7.1R	CCCATRGCYTGYTTMCCCATDGC	Liu et al. 1999 [50]

. The PCR lthermal cycling program condition was set as follows: initial denaturation at 98 °C for 5 min, followed by 39 cycles at 98 °C for 30 s, × °C (the annealing temperatures for LROR/LR7, ITS1-F/ITS4, NS1/NS4, and bRPB2-6F/bRPB2-7.1R were 47.2 °C, 57.2 °C, 48 °C and 57.2 °C, respectively) for 30 s, 72 °C for 30 s, and a final extension at 72 °C for 1 min. PCR amplification was confirmed on 1% agarose electrophoresis gels stained with ethidium bromide [41]. DNA sequencing was performed at the Beijing Genomics Institute (BGI). All newly generated sequences were submitted to GenBank. Additional LSU rDNA, ITS rDNA, SSU rDNA and RPB2 rDNA sequences in the dataset used to establish phylogenetic relationships were downloaded from GenBank (http://www.ncbi.nlm.nih.gov/genbank/php (accessed on 10 August 2021)) and UNITE (https://unite.ut.ee/index.php (accessed on 10 August 2021)) (Table 1). Nuclear ribosomal RNA genes were used to determine the phylogenetic position of the new species. After PCR amplification, the products were sequenced in both directions and the sequences were assembled using DNAMAN 8.0. DNA sequences were aligned using MAFFT 7.110 [42]. To ensure the repeatability of the results, alignments were not manually adjusted. The best-fit evolutionary models selected by jmodeltest-2.1.10 for genes were GTR+I+G (nLSU), K80+G (ITS1), K80 (5.8S), JC+G (ITS2), TrN+I+G (SSU), K80+G (RPB2) in the first dataset (Hydnellum and Sarcodon dataset) and GTR+I+G (nLSU), K80+G (ITS1), K80+G (5.8S), K80+G (ITS2) in the second dataset (Thelephorales dataset). These models were applied in Bayesian analyses. All gaps were treated as missing data. Maximum Likelihood (ML) analysis was performed in RAxML v8.2.4 with GTR+I+G model [43]. The best tree was obtained by executing 100 rapid bootstrap inferences and thereafter a thorough search for the most likely tree using one distinct model/data partition with joint branch length optimization [44]. Bayesian analyses with MrBayes 3.2.4 [45] implementing the Markov Chain Monte Carlo (MCMC) technique and parameters predetermined with MrMODELTEST2.3 [46,47] were performed. Four simultaneous Markov chains were run starting from random trees, keeping one tree every 100th generation until the average standard deviation of split frequencies was below 0.01. The value of burn-in was set to discard 25% of trees when calculating the posterior probabilities. Bayesian posterior probabilities were obtained from the 50% majority rule consensus of the trees kept. Then the FigTree v1.3.1 were used to visualize the resulting trees.

3. Results

Phylogenetic Analyses

In the first dataset, 272 sequences derived from four gene loci (nLSU, ITS, SSU and RPB2) were used to build phylogenetic trees; 108 of them were newly generated, including 25 of nLSU, 37 sequences of ITS, 25 of SSU and 21 of RPB2. The phylogenetic construction performed with maximum likelihood and Bayesian Inference (BI) analyses for two combined datasets showed similar topology. The combined LSU-ITS-SSU-RPB2 dataset represented 70 taxa and 3629 characters after being trimmed. Polyozellus mariae and P. multiplex were used as the outgroups according to phylogenetic analysis of Thelephorales. Bayesian analysis ran for 8 million generations and resulted in an average standard deviation of split frequencies of 0.005062. The same dataset and alignment were analysed using the ML method. The Maximum Likelihood tree is shown in Figure 1. In the phylogenetic tree, ten clades which correspond to subgenus Hydnellum, subg. Caesispinosum, subg. Croceum, subg. Inflatum, subg. Rhizomorphum, subg. Scabrosum, subg. Spongiosum, subg. Subindufibulatum, subg. Violaceum and subg. Zonatum were revealed. Twenty-eight sampled specimens formed 11 new species (Hydnellum atrorubrum, H. atrospinosum, H. bomiense, H. brunneorubrum, H. fibulatum, H. granulosum, H. inflatum, H. rubidofuscum, H. squamulosum, H. sulcatum and H. yunnanense) and clustered in a clade that comprised most species of Hydnellum. Four sampled specimens (Wei1474a, Yuan13708 and Yuan13720, Yuan14517) that were confirmed as new records from China clustered with Hydnellum caeruleum, H. peckii and H. spongiosipes with strong support. In addition, five notable specimens, Hydnellum sp 1, Hydnellum sp 2, Hydnellum sp 3, Hydnellum sp 4 and Hydnellum sp 5, formed five separate clades, and need further verification. In the second dataset, the combined ITS and nLSU gene also included sequences from 129 specimens representing 58 taxa of Thelephorales, as well as Steccherinum ochraceum and S. murashkinskyi, which were chosen as outgroups according to previous study [31]. The average standard deviation of split frequencies in the Bayesian analyses reached 0.007357 after running for 8 million generations. The calculated values based on the dataset analysed using the ML method. The Maximum Likelihood tree is shown in Figure 2. It revealed that the Hydnellum clade occupies an independent phylogenetic position. The Hydnellum clade is sister to the Sarcodon clade. According to the phylogenetic tree, ten major clades, Amaurodon clade, Boletopsis clade, Hydnellum clade, Lenzitopsis clade, Odontia clade, Phellodon/Bankera clade, Pseudotomentella/Polyozellus clade, Sarcodon clade, Thelephora/Tomentella clade and Tomentellopsis clade, were identified within the Thelephorales (Figure 2). Therefore, in order to use the maximum amount of genetic information when defining new species, we conducted the first dataset. Meanwhile, ITS trees of Hydnellum and Sarcodon were constructed and produced a topology similar to that generated by the first dataset (see Supplementary, Figure S1). The purpose of executing the second dataset was to demonstrate the phylogenetic position of Hydnellum species in the Thelephorales.

4. Taxonomy

Hydnellum subg. Hydnellum

MycoBank MB841191

Etymology. Hydnellum (Latin), refers to the subgenus in which the type species of the genus is located.

Included species: Hydnellum atrospinosum, H. suaveolens

Type species: Hydnellum suaveolens (Scop.) P. Karst.

Notes: This subgenus consists of the genus type Hydnellum suaveolens and our new species H. atrospinosum; they share the characteristics of dark blue context, decurrent and dark spines, clamped generative hyphae in the context and the spines trama and irregularly oblong, tuberculate basidiospores of similar size. Furthermore, both species occur in coniferous forests [27,34].

Hydnellum atrospinosum Y.H. Mu & H.S. Yuan, sp. nov. (Figure 3)

MycoBank MB839034

Etymology. Atrospinosum (Latin), refers to the dark violet spines.

Type: CHINA, Qinghai Province, Qilian County, Binggou Forest Park, ground in Picea forest, 8 September 2012, H. S. Yuan, Yuan 6520 (holotype IFP 018516).

Basidiocarps annual, solitary to gregarious or concrescent, leathery when fresh, becoming hard and light in weight upon drying; taste mild, odor fragrant when dry. Pileus irregularly ellipsoid to circular, later flabelliform or semicircular and applanate with age, up to 75 mm diam and 6–11 mm thick at center. Pileal surface light orange (5A4) to yellowish brown (5F6), concentrically zonate, scrobiculate when fresh, becoming glabrescent, rugose when dry; margin white (5A1) when fresh, brownish orange (5C6) when dry, even. Spine surface dark violet (15F4) when fresh, violet-gray (15F2) when dry; spines up to 2.5 mm long, base up to 0.4 mm diam, conical, 3–4 per mm, decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 11 mm thick, light yellow (4A4), brownish gray (7F2) to dark violet (16F5) or dark blue (20E6), woody. Stipe lateral, up to 4 cm long and 3 cm diam, sometimes connate, leathery when fresh, woody upon drying, brown (6E6) to violet gray (15F2), glabrous, inside solid, cylindrical to flatted or broadened below with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with clamp-connections, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, clamped, straight, regularly arranged, sometimes flexuous and collapsed, mostly 3–6 μm diam. Spines: generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, more or less parallel along spines, clamped, straight, 2–3 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (2.1–4.2 μm long), clamped at base, 17–45 × 3–6 μm; basidioles similar to basidia. Basidiospores irregular oblong or triangular, brown, thin-walled, tuberculate CB–, IKI–, (4–)4.1–5.1(–5.5) × (3–)3.1–3.9(–4) μm, Lm = 4.6 μm, Wm = 3.2 μm, Q = 1.34–1.44 (n = 60/2); tuberculi isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 1 μm long.

Additional specimens (paratypes) examined: CHINA, Qinghai Province, Qilian County, Binggou Forest Park, ground in Picea forest, 8 September 2012, H. S. Yuan, Yuan 6495 (IFP 018495, paratype); Yuan 6514 (IFP 018510, paratype).

Notes: Hydnellum atrospinosum and H. suaveolens have a close phylogenetic relationship with full support (100% in ML and 1.00 BPP). Morphologically, they both have single to gregarious basidiocarps with glabrous to rugose pileal surface, woody and dark blue context, an eccentric and terete stipe with a bulbous base, conical, decurrent and dark spines, clamped generative hyphae and irregularly oblong, tuberculate basidiospores of similar size. However, H. suaveolens differs from H. atrospinosum by longer spines (up to 6 mm vs. 2.5 mm in H. atrospinosum), context tissues turning light blue to green in KOH and presence of inflated hyphae in the context [27,34]. A special characteristic of H. atrospinosum is that the clamped generative hyphae are present in all parts of the basidiocarp; this trait can also be observed in H. cruentum, H. cyanopodium, H. geogenium and H. scleropodium. H. cruentum differs from H. atrospinosum by plushy to tomentose pileal surface, grayish blue and slightly longer spines (up to 3.5 mm vs. 2.5 mm in H. atrospinosum) and subglobose basidiospores [26,27,51]. H. cyanopodium and H. scleropodium obviously differs in blue spines [27,33,51]. H. geogenium differs in reflexed-multiplex and yellow basidiocarps, pale yellow to brown spines and subglobose basidiospores [1,27,34].

Hydnellum subg. Caesispinosum Y.H. Mu & H.S. Yuan, subgen. nov.

MycoBank MB841195

Etymology. Caesispinosum (Latin), refers to the blue spines.

Included species: Hydnellum cyanopodium, H. scleropodium

Type species: Hydnellum cyanopodium K.A. Harrison

Notes: The subgenus is composed of two American species, Hydnellum cyanopodium and H. scleropodium. Blue spines and context and fully clamped hyphae in all parts of basidiocarps are their distinctly common features. In addition, the two species both have rugose and pitted pileal surface and clamped basidia of similar size [33,34,51].

Hydnellum subg. Croceum Y.H. Mu & H.S. Yuan, subgen. nov.

MycoBank MB841196

Etymology. Croceum (Latin), refers to the orange basidiocarps.

Included species: Hydnellum aurantiacum, H. auratile, H. brunneorubrum, H. chrysinum, H. earlianum

Type species: Hydnellum aurantiacum (Batsch) P. Karst.

Notes: This subgenus includes five species, Hydnellum aurantiacum, H. auratile, H. brunneorubrum, H. chrysinum and H. earlianum. They often have orange basidiocarps, tomentose to matted pileal surface, yellow to orange spines and context, the monomitic hyphal system with uninflated and unclamped hyphae, clavate basidia with simple-septate at base and irregularly subglobose basidiospores [2,26,27,33,34,51].

Hydnellum brunneorubrum Y.H. Mu & H.S. Yuan, sp. nov. (Figure 4)

MycoBank MB839036

Type: CHINA, Liaoning Province, Xinbin County, Gangshan Nature Reserve, on the ground in Fagaceous forest, 30 August 2018, H. S. Yuan, Yuan 12997 (holotype IFP 019384).

Basidiocarps annual, solitary to gregarious or multiple pilei overlapping and fused to form a compound cluster, soft and leathery when fresh, becoming woody and light in weight upon drying; taste mild, odor none when dry. Pileus applanate and ellipsoid to irregularly circular when young, later depressed or infundibuliform to flabelliform with age, up to 40 mm diam and 5–10 mm thick at center. Pileal surface brownish orange (6C8) to brownish red (10D8), azonate, pubscent to floccose when fresh, becoming matted or fibrillose to glabrous when dry; margin white (6A1) to light orange (6A5) when fresh, light orange (5A4) when dry, involute and wavy, sometimes lobed with age. Spine surface golden yellow (5B6) to light brown (7D8) when fresh, light brown (6D7) to dark brown (7F8) when dry; spines up to 4 mm long, base up to 0.3 mm diam, conical, 3–5 per mm, more or less decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 5 mm thick, grayish orange (5B5), woody. Stipe central to lateral, up to 3 cm long and 1 cm diam, sometimes connate, leathery when fresh, woody upon drying, brownish orange (6C8) to light brown (6D7), tomentose, solid inner, cylindrical to flat or attenuate downwards with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with simple-septa, occasionally encrusted, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, thin- to slightly thick-walled, frequently branched, simple-septate, straight, regularly arranged, sometimes flexuous and collapsed, mostly 4–6 μm diam. Spines: generative hyphae hyaline, thin-walled, frequently branched, more or less parallel along spines, frequently simple-septate, straight, 2–5 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (2.5–5 μm long), simple-septate at base, 12–50 × 3–7 μm; basidioles similar to basidia. Basidiospores irregularly ellipsoid to subglobose, brown, thin-walled, tuberculate, CB–, IKI–, (4–)4.1–5.1(–5.2) × (3.1–)3.2–4.6(–4.8) μm, Lm = 4.9 μm, Wm = 3.9 μm, Q = 1.23–1.26 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 0.8 μm long.

Additional specimens (paratypes) examined: CHINA, Liaoning Province, Xinbin County, Gangshan Nature Reserve, on the ground in mixed forest, 30 August 2018, H. S. Yuan, Yuan 12999 (IFP 019385, paratype); Yuan 13004 (IFP 019386, paratype); 2 September 2019, H. S. Yuan, Yuan 14339 (IFP 019387, paratype); Yuan 14340 (IFP 019388, paratype); Yuan 14341 (IFP 019389, paratype); 12 August 2020, H. S. Yuan, Yuan 14562 (IFP 019390, paratype); 26 August 2020, H. S. Yuan, Yuan 14585 (IFP 019391, paratype); 12 September 2020, H. S. Yuan, Yuan 14796 (IFP 019392, paratype); Yuan 14798 (IFP 019393, paratype); Yuan 14799 (IFP 019394, paratype); Benxi County, Guanmenshan National Forest Park, on the ground in mixed forest, 29 August 2020, H. S. Yuan, Yuan 14642 (IFP 019395, paratype); Xinbin County, Qingsongling Forest Park, on the ground in mixed forest, 5 September 2020, H. S. Yuan, Yuan 14668 (IFP 019396, paratype); Yuan 14688 (IFP 019397, paratype).

Notes: The orange basidiocarps make Hydnellum brunneorubrum similar to H. aurantiacum, H. auratile, H. chrysinum and H. earlianum. H. aurantiacum differs from H. brunneorubrum in bigger pileus (up to 100 mm vs. 40 mm in H. brunneorubrum) with colliculose and wrinkled pileal surface, longer spines (up to 5 mm vs. up to 4 mm in H. brunneorubrum) and longer basidiospores (6–6.7 μm vs. 4.1–5.1 μm in H. brunneorubrum) [1]. H. auratile differs in squamulose, concentrically zoned and occasionally black stained pileal surface, duplex stipe context with black lines in the centre and longer basidiospores (4.9–5.8 μm vs. 4.1–5.1 μm in H. brunneorubrum); in addition, H. auratile usually grows in coniferous forests [1,26]. H. chrysinum is differentiated by having duplex, slightly zonate context, context tissue turning dark olive or blackish in KOH and slightly longer basidia sterigmata (up to 6 µm vs. up to 5 µm in H. brunneorubrum) [2,33,51]. H. earlianum is differentiated by a larger pileus (up to 90 mm vs. 40 mm in H. brunneorubrum), duplex context, dark brown or black context tissues in KOH and longer basidiospores (5–6 µm vs. 4.1–5.1 μm in H. brunneorubrum) [27,32,34].

Hydnellum subg. Inflatum Y.H. Mu & H.S. Yuan, subgen. nov.

MycoBank MB841197

Etymology. Inflatum (Latin), refers to the presence of inflated generative hyphae.

Included species: Hydnellum cristatum, H. granulosum, H. inflatum, H. mirabile, H. piperatum

Type species: Hydnellum mirabile (Fr.) P. Karst.

Notes: There are five species in the subgenus Inflatum, Hydnellum cristatum, H. granulosum, H. inflatum, H. mirabile and H. piperatum. The presence of inflated generative hyphae in the context of the pileus is an important feature they share. As well as, they often have yellow to brown and depressed pileus, cylindrical stipe and unclamped generative hyphae in the context and the spine trama [1,27,34].

Hydnellum granulosum Y.H. Mu & H.S. Yuan, sp. nov. (Figure 5)

MycoBank MB839038

Etymology. Granulosum (Latin), refers to the granulose pileal surface when dry.

Type: CHINA, Sichuan Province, Guangyuan County, Tianzhaoshan National Forest Park, on the ground in Acer and Cryptomeria mixed forest, 13 August 2017, H. S. Yuan, Yuan 12213b (holotype IFP 019400).

Basidiocarps annual, solitary to gregarious or two to three pilei fused to form a complex pileus, soft and leathery when fresh, becoming hard and light in weight upon drying; taste acrid, odor fragrant when dry. Pileus aplanate, irregularly ellipsoid when young, later irregularly flabelliform with age, up to 50 mm diam and 5–10 mm thick at center. Pileal surface light yellow (4A4), light brown to grayish brown (9F3), azonate, granulose when dry; margin yellowish white (4A2), involute and wavy, sometimes lobed. Spine surface grayish orange (5B4) to dark brown (8F7) when dry; spines up to 2 mm long, base up to 0.3 mm diam, conical, 3–6 per mm, more or less decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 9 mm thick, grayish orange (5B4), woody. Stipe central to lateral, up to 4 cm long and 3 cm diam, sometimes connate, hard upon drying, golden brown (5D6) to brown (6E6), rugose, solid inner, terete or attenuate or broadening downwards with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with simple-septa, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, mostly slightly thick-walled, rarely thin-walled, occasionally branched, simple-septate, occasionally inflated, interwoven, mostly 4–7 μm diam. Spines: generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, more or less parallel along spines, frequently simple-septate, straight, 3–4 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (3–5 μm long), simple-septate at base, 15–30 × 5–9 μm; basidioles similar to basidia. Basidiospores irregularly ellipsoid to globose, brown, thin-walled, tuberculate, CB–, IKI–, (4–)4.1–5.1(–5.3) × (3.2–)3.4–4.7(–4.9) μm, Lm = 4.6 μm, Wm = 4.1 μm, Q = 1.12–1.13 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 1.2 μm long.

Additional specimens (paratypes) examined: CHINA, Sichuan Province, Guangyuan County, Tianzhaoshan National Forest Park, on the ground in Acer and Cryptomeria mixed forest, 12 August 2017, H. S. Yuan, Yuan 12213a (IFP 019401, paratype); 13 August 2017, H. S. Yuan, Yuan 12213c (IFP 019402, paratype).

Notes: Hydnellum granulosum has a close phylogenetic relationship with H. piperatum. In morphology, H. piperatum resembles H. granulosum in having single to gregarious or concrescent basidiocarps, with lobed pileal margin from fused pilei or indeterminate growth, a single to fused, central to eccentric and terete to attenuate downwards stipe, context tissue turning olivaceous in KOH, absence of clamp-connections and the presence of inflated hyphae. However, H. piperatum is distinguishable from H. granulosum by having a comparatively broader pileus (up to 150 mm vs. 50 mm in H. granulosum) with a scaly or squamulose and zonate pileal surface and strongly decurrent and longer spines (up to 5 mm vs. 2 mm in H. granulosum) [27]. The presence of inflated generative hyphae is a shared feature in H. granulosum and H. mirabile. They also have simple or concrescent basidiocarps with light yellow to brown pilei, and hard and cylindrical stipes. However, H. mirabile differs from H. granulosum by the plano-convex to depressed and larger pileus (up to 90 mm vs. 50 mm in H. granulosum), yellowish to purplish brown and longer spines (up to 5 mm vs. 2 mm in H. granulosum), duplex and pallid to pale brownish context and longer basidiospores (5.6–5.8 µm vs. 4.1–5.1 μm in H. granulosum) [1].

Hydnellum inflatum Y.H. Mu, X.H. Wang & H.S. Yuan, sp. nov. (Figure 6)

MycoBank MB839040

Etymology. Inflatum (Latin), refers to the mostly inflated generative hyphae in the context of the pileus.

Type: CHINA, Yunnan Province, Maguan County, Dalishu Township, on the ground in Fagaceous forest, 14 October 2017, S. F. Shi, Shi 506 (holotype IFP 019403).

Basidiocarps annual, solitary to gregarious, soft and leathery when fresh, becoming corky and light in weight upon drying; taste acrid, odor fragrant when dry. Pileus depressed to aplanate and irregularly circular when young, later flabelliform with age, up to 75 mm diam and 3–8 mm thick at center. Pileal surface grayish orange (5B5) to brown (7E7), azonate, fibrous to colliculose when fresh, becoming scrobiculate when dry; margin light yellow (4A4) when fresh, orange-white (5A2) when dry, involute and wavy, often lobed with age. Spine surface white (5A1) to golden brown (5D7) when fresh, yellowish brown (5D5) to dark brown (7F8) when dry; spines up to 4 mm long, base up to 0.25 mm diam, conical, 4–5 per mm, strongly decurrent on stipe, without spines at pileus margin, brittle when dry. Context duplex, upper layer grayish yellow (4B5), loose and soft, up to 2 mm thick; lower layer pale yellow (4A3), woody, up to 3 mm thick; a dark line present between upper and lower cortical layers. Stipe central to lateral, up to 5 cm long and 2 cm diam, occasionally connate, fleshy when fresh, woody upon drying, light brown (6D7), smooth to rugose, inside solid, context with a dark line present at centre, cylindrical or attenuate downwards with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with simple-septa, CB+ in slightly thick-walled hyphae, IKI–; tissues slightly olivaceous in KOH. Context: generative hyphae hyaline, thin- to slightly thick-walled, occasionally branched, simple-septate, mostly inflated, interwoven, mostly 4–8 μm diam. Spines: generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, more or less parallel along spines, frequently simple-septate, straight, 2–5 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (3–5 μm long), simple-septate at base, 19–33 × 4–6 μm; basidioles similar to basidia. Basidiospores irregularly ellipsoid to globose, brown, thin-walled, tuberculate, CB–, IKI–, (4–)4.2–5(–5.1) × (3.2–)3.8–4.3(–5) μm, Lm = 4.8 μm, Wm = 4 μm, Q = 1.18–1.2 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 1.2 μm long.

Additional specimens (paratypes) examined: CHINA, Yunnan Province, Maguan County, Mabai Town, Caiyuanzi Village, on the ground, 5 August 2017, J. Wang, Wang 80 (IFP 019404, paratype); Wang 82 (IFP 019405, paratype); on the way from Dalishu Township to Damagu Village, on the ground in Fagaceous forest, 6 August 2017, S. F. Shi, Shi 150 (IFP 019406, paratype); Shi 160 (IFP 019407, paratype).

Notes: Hydnellum inflatum is characterized by the presence of inflated generative hyphae, which makes it similar to H. cristatum, H. granulosum, H. mirabile and H. piperatum. This is an important feature that distinguishes from other species. However, H. cristatum can be differentiated from H. inflatum by the larger pileus (up to 100 mm vs. 75 mm in H. inflatum) with tomentose to matted pileal surface, longer spines (up to 5 mm vs. 4 mm in H. inflatum), brown context tissues in KOH, bigger basidia (34–46 × 8–9 μm vs. 19–33 × 4–6 μm in H. inflatum) and basidiospores (5–6 × 4–5 μm vs. 4.2–5 × 3.8–4.3 μm in H. inflatum) [27,34]. H. granulosum differs in granulose pileal surface, not duplex context, mostly slightly thick-walled hyphae in the context and shorter spines (up to 2 mm vs. up to 4 mm in H. inflatum). H. mirabile differs in ochraceous yellow and olive brown pileus, yellowish to purplish brown spines and longer spores (5.6–5.8 μm vs. 4.2–5 μm in H. inflatum) [1]. H. piperatum differs in umbilicate and greatly pileus (up to 100 mm vs. 75 mm in H. inflatum), red haired to sunburn slightly longer spines (up to 5 mm vs. up to 4 mm in H. inflatum) and inflated to cylindrical hyphae in the spines [27].

Hydnellum subg. Rhizomorphum Y.H. Mu & H.S. Yuan, subgen. nov.

MycoBank MB841198

Etymology. Rhizomorphum (Latin), refers to the rhizomorphs-like stipe.

Included species: Hydnellum gracilipes, Hydnellum sp 1

Type species: Hydnellum gracilipes (P. Karst.) P. Karst.

Notes: Hydnellum gracilipes and our notable specimen Hydnellum sp 1 comprise the subgenus Rhizomorphum. Rhizomorph-like stipe are their typical common characteristics. Besides, both species have the monomitic hyphal system with simple-septate generative hyphae [35].

Hydnellum sp 1

Basidiocarps annual, solitary to gregarious or coalescent. Pileus flabelliform to irregularly circular. Pileal surface deep red (10C8) to violet-brown (10F8) and felted. Spines white (10A1) to brownish red (10D7) and more or less decurrent, up to 1.5 mm long. Rhizomorphs stipe-like. Hyphal system monomitic, generative hyphae simple-septa. Basidia clavate, with four sterigmata. Basidiospores irregularly subglobose to globose, tuberculate, (4–)4.1–4.9(–5) × (3.1–)3.2–4(–4.1) μm.

Specimen examined: CHINA, Yunnan Province, Maguan County, on the way from Dalishu Township to Damagu Village, on the ground of angiosperm forest, 6 August 2017, S. F. Shi, Shi 164 (IFP 019436).

Hydnellum subg. Scabrosum Y.H. Mu & H.S. Yuan, subgen. nov.

MycoBank MB841199

Etymology. Scabrosum (Latin), refers to the pileal surface with scabrosity.

Included species: Hydnellum amygdaliolens, H. coactum, H. fagiscabrosum, H. fennicum, H. grosselepidotum, H. illudens, H. lepidum, H. lidongensis, H. nemorosum, H. scabrosellum, H. scabrosum, H. underwoodii

Type species: Hydnellum scabrosum (Fr.) E. Larss., K.H. Larss. & Kõljalg

Notes: There are twelve species, namely Hydnellum amygdaliolens, H. coactum, H. fagiscabrosum, H. fennicum, H. grosselepidotum, H. illudens, H. lepidum, H. lidongensis, H. nemorosum, H. scabrosellum, H. scabrosum and H. underwoodii in this subgenus characterised by planar to depressed and brown pileus, azonate pileal surface with scabrosity, variously-brown spines, not duplex and yellow to orange context, inflated and unclamped generative hyphae and irregularly ellipsoid to globose basidiospore [1,2,26,27,32,33,34,38,51,52,53,54].

Hydnellum subg. Spongiosum Y.H. Mu & H.S. Yuan, subgen. nov.

MycoBank MB841200

Etymology. Spongiosum (Latin), refers to the spongy pileal surface.

Included species: Hydnellum ferrugineum, H. pineticola, H. spongiosipes, Hydnellum sp 2

Type species: Hydnellum ferrugineum (Fr.) P. Karst.

Notes: This subgenus includes Hydnellum ferrugineum, H. pineticola, H. spongiosipes and Hydnellum sp 2; they all have planoconvex to depressed and brown pileus with spongy pileal surface, purplish brown spines, the monomitic hyphal system with simple-septate generative hyphae and irregularly subglobose basidiospores [1,2,27,34].

Hydnellum spongiosipes (Peck) Pouzar, Česká Mykol. 14(2): 130 (1960)

Hydnum spongiosipes Peck, Ann. Rep. Reg. N.Y. St. Mus. 50: 111 (1898) (1897)

Basidiocarps single to gregarious. Pileus flabelliform, applanate to subdepressed. Pileal surface pale orange (6A3) to dark brown (6F7), velutinous to very spongy, tomentose to fibrillose. Spines pale orange (6A3) to dark brown (6F7), subdecurrent to decurrent, up to 6 mm long. Stipe central to subeccentric, terete, thick and strong. Hyphal system monomitic; generative hyphae simple-septate. Basidia clavate, with four sterigmata. Basidiospores irregularly subglobose, tuberculate, (5–)5.1–6.1(–6.2) × (4.3–)4.5–5.3(–5.8) μm.

Specimen examined: CHINA, Liaoning Province, Kuandian County, Baishilazi National Nature Reserve, on the ground of Quercus forest, 8 August 2020, H. S. Yuan, Yuan 14517 (IFP 019435).

Notes: The studied sample clustered with Hydnellum spongiosipes (REB-107 and REB-52) in the multi-gene phylogenetic tree with strong support (90% in ML and 1.00 BPP) (Figure 1). The samples REB-107 and REB-52 both show 0.99 similarity to Yuan 14517 in ITS region. Besides this, morphological analyses also confirmed the new record, which is described in detail by Maas Geesteranus (1975) and Baird (2013). This species was recorded to occur widely in the United States and European countries and usually was found under hardwood tree [1,2,27,34].

Hydnellum sp 2

Basidiocarps annual, coalescent. Pileus compound, multiple pilei fused. Pileal surface violet-brown (10E6) and spongy-tomentose. Spines white (10A1) to violet-brown (10E6) and strongly decurrent, up to 2.5 mm long. Stipe short and connate. Hyphal system monomitic, generative hyphae simple-septa. Basidia clavate, with four sterigmata. Basidiospores irregularly subglobose, tuberculate, (3.1–)4–4.3(–4.5) × (3–)3.1–4(–4.1) μm.

Specimen examined: CHINA, Yunnan Province, Nanjian County, Lingbaoshan National Forest Park, on the ground of angiosperm forest, 19 September 2019, H. S. Yuan, Yuan 14387 (IFP 019437).

Hydnellum subg. Subindufibulatum Y.H. Mu & H.S. Yuan, subgen. nov.

MycoBank MB841201

Etymology. Subindufibulatum (Latin), refers to the occasionally clamped hyphae in the context of the pileus.

Included species: Hydnellum caeruleum, H. ferrugipes, H. fibulatum

Type species: Hydnellum caeruleum (Hornem.) P. Karst.

Notes: Hydnellum caeruleum, H. ferrugipes and H. fibulatum make up the subgenus Subindufibulatum and occasional presence of clamped hyphae in the context of the pileus is the dominating trait that distinguishes them from other species. Furthermore, they have dark brown and fibrillose to colliculose pileal surface, orange stipe, context tissues turning olivaceous in KOH and the absence of clamp-connections in the spine trama [2,26,27].

Hydnellum caeruleum (Hornem.) P. Karst., [as ‘coeruleum’], Meddn Soc. Fauna Flora Fenn. 5: 41 (1879)

Hydnum caeruleum Hornem., Fl. Danic. 8(23): 7, tab. 1374 (1808)

Basidiocarps single to gregarious or concrescent. Pileus convex to plane. Pileal surface pastel yellow (4A4) to dark blonde (5D4), tomentose and colliculose. Spines decurrent, up to 6 mm long, orange-white (5A2) to dark brown (6F8). Stipe central and terete. Hyphal system monomitic; most of the generative hyphae with simple-septa, rarely with clamps. Basidia clavate, with four sterigmata. Basidiospores irregularly subglobose, tuberculate, (4.9–)5–6(–6.1) × (4–)4.1–4.9(–5) μm.

Specimen examined: CHINA, Xinjiang Autonomous Region, Huocheng County, Guozigou Forest Park, on the ground in Picea forest, 18 August 2004, Y. L. Wei, Wei 1474a (IFP 019432).

Notes: The phylogenetic analyses showed that the studied sample matched with Hydnellum caeruleum (EBendiksen584-11) with full support (100% in ML and 1.00 BPP) (Figure 1). ITS sequence BLAST also revealed it is 100% identical to H. caeruleum. Besides, our collection shares identical characters with H. caeruleum described by Maas Geesteranus [26] in morphology. This is the first report of this species from China.

Hydnellum fibulatum Y.H. Mu & H.S. Yuan, sp. nov. (Figure 7)

MycoBank MB839037

Etymology. Fibulatum (Latin), refers to the generative hyphae with occasional clamp-connections.

Type: CHINA, Liaoning Province, Benxi County, Guanmenshan National Forest Park, on the ground in Quercus forest, 29 August 2020, H. S. Yuan, Yuan 14656 (holotype IFP 019398).

Basidiocarps annual, solitary to gregarious, soft and leathery when fresh, becoming woody and light in weight upon drying; taste mild, odor none when dry. Pileus applanate, circular when young, later flabelliform with age, up to 45 mm diam and 3–7 mm thick at center. Pileal surface light brown (7D7) to dark brown (8F4), obscurely zonate, pubescent when fresh, becoming fibrillose, rugose when dry; margin white (6A1) when fresh, brown (6E6) when dry, incurved, sometimes lobed. Spine surface pinkish white (7A2) to brown (7E7) when fresh, orange-white (5A2) to brown (6E6) when dry; spines up to 1.5 mm long, base up to 0.2 mm diam, conical, 3–4 per mm, more or less decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 5 mm thick, light brown (6D4) to dark brown (6F4), woody. Stipe central to lateral, up to 3.5 cm long and 1 cm diam, single, leathery when fresh, woody upon drying, light orange (5A5) to brown (6E7), pubescent, solid inner, cylindrical or attenuate downwards with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with mostly simple-septa, occasionally clamped, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, slightly thick-walled, occasionally branched, simple-septate, occasionally clamped, straight, regularly arranged, sometimes flexuous and collapsed, mostly 3–5 μm diam. Spines: generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, more or less parallel along spines, frequently simple-septate, straight, 2–4 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (2–5 μm long), simple-septate at base, 15–47 × 5–9 μm; basidioles similar to basidia. Basidiospores irregularly ellipsoid to globose, brown, thin-walled, tuberculate, CB–, IKI–, (4.2–)4.4–5.8(–6) × (4–)4.1–4.9(–5.1) μm, Lm = 5.2 μm, Wm = 4.3 μm, Q = 1.12–1.21 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 1 μm long.

Additional specimen (paratype) examined: CHINA, Liaoning Province, Benxi County, Guanmenshan National Forest Park, on the ground in Quercus forest, 29 August 2020, H. S. Yuan, Yuan 14646 (IFP 019399, paratype).

Notes: Hydnellum caeruleum and H. ferrugipes have an adjacent phylogenetic relationship with H. fibulatum according to the phylogenetic tree (Figure 1). H. caeruleum and H. fibulatum have similar morphological characteristics, such as a flat and velutinous pileus when immature, white pileal margin when fresh, central, terete and tomentose stipe, olivaceous context tissue in KOH, presence of occasional clamp-connections in the context and simple-septate hyphae in the spines. However, H. caeruleum can be distinguished by having a larger pileus (up to 80 mm vs. 45 mm in H. fibulatum), rough or colliculose pileal surface when mature, duplex and zonate context [2,26]. H. ferrugipes resembles H. fibulatum in having a white pileal margin when fresh, tomentose and orange to brown stipe, orange-white to brown spines when dry, regularly arranged and occasionally clamped hyphae in the context, unclamped hyphae in the spines and basidia sterigmata with similar size. However, H. ferrugipes differs from H. fibulatum in the infundibuliform pileus with pitted to subnodulose or subcolliculose pileal surface, blue-gray or grayish orange context, considerably longer spines (up to 6 mm vs. 1.5 mm in H. fibulatum) and wider basidiospores (5–6 μm vs. 4.1–4.9 μm in H. fibulatum) [27,34].

Hydnellumsubg.Violaceum Y.H. Mu & H.S. Yuan, subgen. nov.

MycoBank MB841202

Etymology. Violaceum (Latin), refers to the violaceous basidiocarps.

Included species: Hydnellum fuligineoviolaceum, H. fuscoindicum, H. glaucopus, H. joeides, H. roseoviolaceum

Type species: Hydnellum fuligineoviolaceum (Kalchbr.) E. Larss., K.H. Larss. & Kõljalg

Notes: Five species, Hydnellum fuligineoviolaceum, H. fuscoindicum, H. glaucopus, H. joeides and H. roseoviolaceum, comprise the subgenus Violaceum. They share the following features: violaceous basidiocarps, pileal surface with appressed scales, purplish context, the presence of inflated generative hyphae and the simple-septate haphae in all tissue [1,26,27,33,53].

Hydnellumsubg.Zonatum Y.H. Mu & H.S. Yuan, subgen. nov.

MycoBank MB841203

Etymology. Zonatum (Latin), refers to the concentrically zonate pileal surface.

Included species: Hydnellum atrorubrum, H. bomiense, H. concrescens, H. dianthifolium, H. parvum, H. rubidofuscum, H. scrobiculatum, H. squamulosum, H. subsuccosum, H. sulcatum, H. yunnanense, Hydnellum sp 3, Hydnellum sp 4, Hydnellum sp 5

Type species: Hydnellum scrobiculatum (Fr.) P. Karst.

Notes: The subgenus Zonatum contains fourteen taxa, Hydnellum atrorubrum, H. bomiense, H. concrescens, H. dianthifolium, H. parvum, H. rubidofuscum, H. scrobiculatum, H. squamulosum, H. subsuccosum, H. sulcatum, H. yunnanense, Hydnellum sp 3, Hydnellum sp 4 and Hydnellum sp 5. The concentrically zonate pileal surface is their most prominently mutual peculiarity. Additionally, the absence of clamp-connections in the context of the pileus and the spine trama is another important common feature [1,2,26,27,34,36].

Hydnellum atrorubrum Y.H. Mu & H.S. Yuan, sp. nov. (Figure 8)

MycoBank MB839032

Etymology. Atrorubrum (Latin), refers to the dark ruby red pileal surface.

Type: CHINA, Yunnan Province, Yulong County, on the ground in Fagaceous forest, 23 July 2018, Y. L. Wei, Wei 8261 (holotype IFP 019377).

Basidiocarps annual, solitary to gregarious or several pilei fused to form a compound pileus, soft and leathery when fresh, becoming woody and light in weight upon drying; taste slightly bitter, odor slightly fragrant when dry. Pileus applanate and flabelliform to irregularly circular when young, later depressed or subinfundibuliform to rounded with age, up to 48 mm diam and 3–8 mm thick at center. Pileal surface light brown (7D7) to dark ruby (12F8), usually concentrically zoned, flocculose when fresh, becoming fibrillose to glabrescent when dry; margin white (7A1) when fresh, brown (7E5) when dry, even to slightly irregular, occasionally wavy or lobed. Spine surface white (6A1) to dark brown (6F6) when fresh, grayish orange (5B4) to brown (6E8) when dry; spines up to 3.5 mm long, base up to 0.4 mm diam, conical, 3–5 per mm, decurrent to strongly decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 6 mm thick, brown (6E6), corky. Stipe central, up to 3.5 cm long and 1.5 cm diam, sometimes connate, leathery when fresh, corky upon drying, pinkish (8A2) to reddish brown (8E6), velutinous, inside solid, cylindrical or attenuate downwards with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with simple-septa, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, thin- to slightly thick-walled, occasionally branched, simple-septate, straight, regularly arranged, sometimes flexuous and collapsed, mostly 4–6 μm diam. Spines: generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, more or less parallel along spines, frequently simple-septate, straight, 2–4 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (4–6 μm long), simple-septate at base, 20–48 × 5–8 μm; basidioles similar to basidia. Basidiospores irregular ellipsoid, brown, thin-walled, tuberculate, CB–, IKI–, (4.1–)4.5–6(–6.1) × (3.2–)3.9–5.1(–6) μm, Lm = 5 μm, Wm = 4.4 μm, Q = 1.14–1.21 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 1.1 μm long.

Additional specimens (paratypes) examined: CHINA, Yunnan Province, Yulong County, on the ground in Fagaceous forest, Y. L. Wei, 23 July 2018, Wei 8290 (IFP 019378, paratype); Wei 8312 (IFP 019379, paratype); Wei 8315 (IFP 019380, paratype); Wei 8319 (IFP 019381, paratype).

Notes: Phylogenetically, Hydnellum atrorubrum has a close relationship with H. subsuccosum. Morphologically, H. subsuccosum is similar to H. atrorubrum in having gregarious to confluent basidiocarps with zonate pileal surface and lobed pileal margin, brown context, cylindrical or attenuate downwards stipe, decurrent and similar length spines, the monomitic hyphal system with uninflated and simple-septate generative hyphae, basidia of similar shape and width, as well as basidiospores of similar length. However, H. subsuccosum can be differentiated by scabrous to nodulose and orange-white to camel pileal surface, black spines and presence of subglobose basidiospores [27]. H. auratile is comparable to H. atrorubrum in having similar size, depressed to infundibuliform or flabelliform and concentrically zoned pileus with undulate margin, tomentose and reddish-brown stipe, non-duplex context, thin- to slightly thick-walled and unclamped generative hyphae. However, H. auratile differs from H. atrorubrum by orange or orange-brown to dark red-brown pileus with entire or deeply split margin and tawny to purplish brown spines [26].

Hydnellum bomiense Y.H. Mu & H.S. Yuan, sp. nov. (Figure 9)

MycoBank MB839035

Etymology. Bomiense, refers to the Bomi County, where the specimens were collected.

Type: CHINA, Xizang Autonomous Region, Bomi County, on the ground in Fagaceous forest, 19 July 2019, H. S. Yuan, Yuan 13767 (holotype IFP 019382).

Basidiocarps annual, solitary to gregarious, soft and leathery when fresh, becoming woody and light in weight upon drying; taste acrid, odor slightly fragrant when dry. Pileus infundibuliform when young, later applanate and irregularly circular with age, up to 26 mm diam and 2–4 mm thick at center. Pileal surface grayish yellow (4B4), brown (7E7) to dark brown (7F8), obscurely concentrically zonate, tomentose, scrupose when fresh, becoming fibrillose or glabrous when dry; margin white (5A1) when fresh, grayish orange (5B4) when dry, involute and wavy, sometimes lobed or rimose with age. Spine surface white (6A1) to brown (6E7) when fresh, light brown (6D6) to dark brown (7F8) when dry; spines up to 1.1 mm long, base up to 0.2 mm diam, conical, 4–6 per mm, more or less decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 4 mm thick, brown (6E5), woody. Stipe central to lateral, up to 2 cm long and 0.5 cm diam, woody upon drying, grayish orange (5B5) to dark brown (7F7), rugose, solid inner, terete or attenuate downwards with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with simple-septa, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, thin- to slightly thick-walled, frequently branched, simple-septate, straight, regularly arranged, sometimes flexuous and collapsed, mostly 4–6 μm diam. Spines: generative hyphae hyaline, thin-walled, occasionally branched, more or less parallel along spines, frequently simple-septate, straight, 2–4 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (1.5–3 μm long), simple-septate at base, 15–42 × 4–7 μm; basidioles similar to basidia. Basidiospores irregularly ellipsoid to subglobose, brown, thin-walled, tuberculate, CB–, IKI–, (4–)4.1–5.1(–5.2) × (3–)3.3–4.5(–4.8) μm, Lm = 4.7 μm, Wm = 4 μm, Q = 1.18–1.21 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 1 μm long.

Additional specimen (paratype) examined: CHINA, Xizang Autonomous Region, Bomi County, on the ground with moss in Fagaceous forest, 19 July 2019, H. S. Yuan, Yuan 13759 (IFP 019383, paratype).

Notes: This species clustered with two samples from Estonia and Costa Rica, and formed an independent clade (Figure S1). Hydnellum bomiense and H. dianthifolium are closely related based on nucleotide sequence analyses and possess common morphological features: separate to coalescing or grouped basidiocarps with decurrent spines, cylindrical stipe, absence of clamp-connections and brown, tuberculate and irregularly ellipsoid to subglobose basidiospores of similar size with isolated to bifurcate tuberculi. However, H. dianthifolium differs from H. bomiense by having slender, turbinate and coralloid basidiocarps that split radially to form erect, coralloid or flower-shaped lobed pilei, not perceptibly zoned context and thick-walled and encrusted context hyphae [36]. Meanwhile, H. concrescens and H. scrobiculatum are also in a big clade with H. bomiense in Figure 1, and concentrically zonate pileal surface is their common characteristic. However, H. concrescens differs by quite larger pileus (up to 120 mm vs. up to 26 mm in H. bomiense), duplex context and longer basidia sterigmata (3–4 µm vs. 1.5–3 µm in H. bomiense) [27,34]. H. scrobiculatum differs in subcolliculose to scrobiculate pileal surface and longer spines (up to 3 mm vs. 1.1 mm in H. bomiense) [27,34].

Hydnellum rubidofuscum Y.H. Mu & H.S. Yuan, sp. nov. (Figure 10)

MycoBank MB839041

Etymology. Rubidofuscum (Latin), refers to the reddish brown pileal surface.

Type: CHINA, Liaoning Province, Xinbin County, Gangshan Nature Reserve, on the ground in Quercus forest, 12 August 2020, H. S. Yuan, Yuan 14561 (holotype IFP 019408).

Basidiocarps annual, solitary to gregarious or multiple pilei overlapping and fused to form a compound cluster, soft and leathery when fresh, becoming woody and light in weight upon drying; taste mild, odor slightly fragrant when dry. Pileus applanate to infundibuliform when young, later depressed to flabelliform or irregularly circular with age, up to 70 mm diam and 4–10 mm thick at center. Pileal surface reddish brown (8E8), obscurely concentrically zonate, glabrous to scrupose when fresh, becoming fibrillose to virgate when dry; margin white (6A1) to orange-white (6A2) when fresh, brownish orange (6C4) when dry, even, sometimes lobed with age. Spine surface grayish brown (8D3) to reddish brown (8E7) when fresh, brown (6E6) to dark brown (6F7) when dry; spines up to 3 mm long, base up to 0.2 mm diam, conical, 4–6 per mm, strongly decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 10 mm thick, brown (6E6), woody. Stipe central to lateral, up to 3.5 cm long and 2 cm diam, sometimes connate, leathery when fresh, woody upon drying, light brown (7D6) to brown (7E6), pubescent, solid inner, cylindrical to flat or attenuate downwards with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with simple-septa, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, thin- to slightly thick-walled, occasionally branched, simple-septate, straight, regularly arranged, sometimes flexuous and collapsed, mostly 3–6 μm diam. Spines: generative hyphae hyaline, thin-walled, occasionally branched, more or less parallel along spines, frequently simple-septate, straight, 2–3 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (1–4 μm long), simple-septate at base, 14–37 × 4–6 μm; basidioles similar to basidia. Basidiospores irregularly ellipsoid to subglobose, brown, thin-walled, tuberculate, CB–, IKI–, (4–)4.1–5(–5.1) × (3.8–)3.9–4.6(–4.8) μm, Lm = 4.6 μm, Wm = 4.1 μm, Q = 1.11–1.12 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 1 μm long.

Additional specimens (paratypes) examined: CHINA, Liaoning Province, Xinbin County, Gangshan Nature Reserve, on the ground in Quercus forest, 12 August 2020, H. S. Yuan, Yuan 14559 (IFP 019409, paratype); Yuan 14560 (IFP 019410, paratype); Yuan 14563 (IFP 019411, paratype); 26 August 2020, H. S. Yuan, Yuan 14586 (IFP 019412, paratype); Yuan 14587 (IFP 019413, paratype); 12 September 2020, H. S. Yuan, Yuan 14792 (IFP 019414, paratype); Yuan 14794 (IFP 019415, paratype); Yuan 14800 (IFP 019416, paratype); Benxi County, Guanmenshan National Forest Park, on the ground in Quercus forest, 29 August 2020, H. S. Yuan, Yuan 14654 (IFP 019417, paratype).

Notes: Phylogenetically, Hydnellum rubidofuscum is closely related to H. bomiense and H. dianthifolium (Figure 1). Morphologically, infundibuliform pileus when young, concentrically zonate pileal surface and irregularly ellipsoid to subglobose basidiospores are their common features. However, H. bomiense can be distinguished by smaller pileus (up to 26 mm vs. up to 70 mm in H. rubidofuscum), yellow to dark brown pileal surface and shorter spines (up to 1.1 mm vs. up to 3 mm in H. rubidofuscum). H. dianthifolium differs by subpubescent pileal surface, reddish-brown to vinaceous-brown context, thick-walled and rarely branched hyphae in the context and context tissue turning blue-green in KOH [36]. The reddish brown pileal surface is very similar to that of H. scrobiculatum. Furthermore, H. scrobiculatum also has a single to gregarious or concrescent basidiocarp with applanate to depressed or infundibuliform pileus, obscurely concentrically zonate pileal surface, simple or connate, central to eccentric and velutinous stipe, reddish brown and decurrent spines and the monomitic hyphal system. However, the major differences are that H. scrobiculatum has a fungoid or no odor, a scrobiculate and rugulose pileal surface, duplex and zonate context and longer basidiospores (5.4–6.4 μm vs. 4.1–5 μm in H. rubidofuscum) [26,27,34].

Hydnellum squamulosum Y.H. Mu & H.S. Yuan, sp. nov. (Figure 11)

MycoBank MB839042

Etymology. Squamulosum (Latin) refers to the minutely scaly pileal surface.

Holotype. CHINA, Xizang Autonomous Region, Bomi County, on the ground in Picea mixed forest, 17 July 2019, H. S. Yuan, Yuan 13615 (holotype IFP 019418).

Basidiocarps annual, solitary to gregarious or coalescent to form complex pileus, soft and leathery when fresh, becoming corky and light in weight upon drying; taste none, odor none when dry. Pileus circular when young, circular or semicircular with age, applanate, up to 35 mm diam and 4–8 mm thick at center. Pileal surface pastel red (7A4) to dark Magenta (13F7), zonate, floccose to woolly, squamulose when fresh, becoming fibrillose and scrobiculate when dry; margin white (7A1) when fresh, grayish orange (5B3) when dry, involute and wavy, sometimes lobed with age. Spine surface pale red (7A3) to reddish brown (8E8) when fresh, grayish orange (5B4) to dark brown (8F7) when dry; spines up to 2 mm long, base up to 0.2 mm diam, conical, 3–6 per mm, decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 9 mm thick, reddish brown (8E6), soft corky. Stipe central to lateral, up to 4 cm long and 1 cm diam, sometimes connate, leathery or freshy when fresh, soft corky upon drying, pale red (11A3), tomentose, solid inner, context with a dark zone present at centre, terete to flat or attenuate downwards with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with simple-septa, occasionally encrusted, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, simple-septate, straight, regularly arranged, sometimes flexuous and collapsed, mostly 4–5 μm diam. Spines: generative hyphae hyaline, thin-walled, moderately branched, more or less parallel along spines, frequently simple-septate, straight, 2–4 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (2–3 μm long), simple-septate at base, 8–38 × 4–6 μm; basidioles similar to basidia. Basidiospores irregularly ellipsoid to globose, brown, thin-walled, tuberculate, CB–, IKI–, (4–)4.1–5(–5.1) × (3.2–)3.3–4.1(–4.2) μm, Lm = 4.4 μm, Wm = 3.8 μm, Q = 1.14–1.16 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 1 μm long.

Additional specimens (paratypes) examined: CHINA, Xizang Autonomous Region, Bomi County, on the ground in Picea mixed forest, 17 July 2019, H. S. Yuan, Yuan 13617 (IFP 019419, paratype); Yuan 13625 (IFP 019420, paratype); Yuan 13626 (IFP 019421, paratype); Yuan 13627 (IFP 019422, paratype); on the ground with moss in Picea mixed forest, 19 July 2019, H. S. Yuan, Yuan 13743 (IFP 019423, paratype).

Notes: Hydnellum squamulosum and H. concrescens are closely related in the phylogenetic tree and share similar morphological and anatomical characteristics: a solitary to gregarious or coalescent basidiocarp with fibrillose, squamulose and zonate pileal surface, irregularly lobed margin, decurrent and reddish-brown spines, not duplex context in the pileus, zonate context in the stipe, context tissue becoming olivaceous in KOH, and tuberculate basidiospores. However, H. concrescens can be differentiated by depressed or infundibuliform basidiocarps, reddish white to dark brown pileal margin, larger pileus (up to 120 mm vs. 35 mm in H. squamulosum), longer basidia sterigmata (up to 5 µm vs. up to 3 µm in H. squamulosum) and larger basidiospores (5–6 × 4–5 µm vs. 4.1–5 × 3.3–4.1 μm in squamulosum) [2,27,34]. H. fraudulentum is similar to H. squamulosum in having a squamulose-fibrillose pileal surface, cylindrical or connate stipe, context tissue olivaceous in KOH, thin- to slightly thick-walled and unclamped hyphae in the context, basidia of similar shape, and brown and tuberculate basidiospores. However, it differs from H. squamulosum in having depressed, azonate and yellow-brown to dark brown pilei, purplish brown and slightly longer spines (up to 2.5 mm vs. 2 mm in H. squamulosum), wider basidia (6–7 µm vs. 4–6 μm in H. squamulosum) with longer sterigmata (3.6–4.5 µm vs. 2–3 μm in H. squamulosum) and bigger basidiospores (6.3–7 × 4.5–4.7 µm vs. 4.1–5 ×3.3–4.1 μm in H. squamulosum) [26].

Hydnellum sulcatum Y.H. Mu & H.S. Yuan, sp. nov. (Figure 12)

MycoBank MB839043;

Etymology. Sulcatum (Latin), refers to the often grooved pileal surface.

Type: CHINA, Liaoning Province, Benxi County, Guanmenshan National Forest Park, on the ground of Quercus forest, 29 August 2020, H. S. Yuan, Yuan 14649 (holotype IFP 019424).

Basidiocarps annual, solitary to gregarious or multiple pilei overlapping and fused to form a compound cluster, soft and leathery when fresh, becoming woody and light in weight upon drying; taste mild, odor slightly fragrant when dry. Pileus subinfundibuliform when young, later applanate to flabelliform or circular with age, up to 65 mm diam and 3–6 mm thick at center. Pileal surface dark brown (9F4), obscurely concentrically zonate, often grooved, scabrous to fibrous when fresh, becoming fibrillose, rugose when dry; margin white (6A1) when fresh, light brown (6D5) when dry, even, sometimes lobed. Spine surface brown (7E7) when fresh, brown (6E5) to dark brown (7F5) when dry; spines up to 1.5 mm long, base up to 0.1 mm diam, conical, 5–7 per mm, more or less decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 6 mm thick, brown (7E6), woody. Stipe lateral, up to 2 cm long and 1.5 cm diam, sometimes connate, leathery when fresh, woody upon drying, brown (7E5), pubescent, inside solid, cylindrical to flat or attenuate downwards with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with simple-septa, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, thin-walled, moderately branched, simple-septate, straight, regularly arranged, sometimes flexuous and collapsed, mostly 4–6 μm diam. Spines: generative hyphae hyaline, thin to slightly thick-walled, moderately branched, more or less parallel along spines, often simple-septate, straight, 2–3 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (2–3 μm long), simple-septate at base, 20–30 × 4–8 μm; basidioles similar to basidia. Basidiospores irregular ellipsoid to subglobose, brown, thin-walled, tuberculate, CB–, IKI–, (4–)4.1–5.8(–5.9) × (3.9–)4–4.6(–4.8) μm, Lm = 4.8 μm, Wm = 4.3 μm, Q = 1.14–1.19 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 0.9 μm long.

Additional specimens (paratypes) examined: CHINA, Liaoning Province, Kuandian County, Baishilazi National Nature Reserve, on the ground of Quercus forest, 8 August 2020, H. S. Yuan, Yuan 14521 (IFP 019425, paratype); Benxi County, Guanmenshan National Forest Park, on the ground of Quercus forest, 29 August 2020, H. S. Yuan, Yuan 14638 (IFP 019426, paratype); Yuan 14658 (IFP 019427, paratype); Yuan 14660 (IFP 019428, paratype).

Notes: Hydnellum parvum has a close phylogenetic relationship with H. sulcatum. The former species resembles the latter by compound fused pilei and rugulose pileal surface. However, the latter has a thinner stipe (0.7 × 0.2 cm vs. 2 × 1.5 cm in H. sulcatum), slightly longer spines (up to 2 mm vs. 1.5 mm in H. sulcatum) and shorter basidiospores (3–4 μm vs. 4.1–5.8 μm in H. sulcatum) [27]. H. subsuccosum resembles H. sulcatum by concentrically zonate pileus with similar size, context hyphae of similar width, the absence of clamp-connections and brown and subglobose basidiospores. However, H. subsuccosum differs by orange white to camel and nodulose or pitted pileal surface, longer spines (up to 3 mm vs. 1.5 mm in H. sulcatum), blue green to dark brown or black context tissue in KOH and longer basidia sterigmata (3–4 μm vs. 2–3 μm in H. sulcatum) [27]. H. atrorubrum is similar to H. sulcatum in having white to brown and even pileal margin and zonate pileal surface, olivaceous context tissues in KOH and basidiospores of similar shape with isolated or grouped tuberculi. However, H. atrorubrum can be differentiated by a flocculose to fibrillose or glabrescent pileal surface, longer spines (up to 3.5 mm vs. 1.5 mm in H. sulcatum) and basidia sterigmata (4–6 μm vs. 2–3 μm in H. sulcatum) and slightly longer tuberculi (up to 1.1 μm vs. 0.9 μm in H. sulcatum) of basidiospores.

Hydnellum yunnanense Y.H. Mu, X.H. Wang & H.S. Yuan, sp. nov. (Figure 13)

MycoBank MB839044

Etymology. Yunnanense, refers to the Yunnan Province, where the specimens were collected.

Type: CHINA, Yunnan Province, Nanjian County, Lingbaoshan National Forest Park, on the ground, 19 September 2019, H. S. Yuan, Yuan 14386 (holotype IFP 019429).

Basidiocarps annual, solitary to gregarious, soft and leathery when fresh, becoming woody and light in weight upon drying; taste mild, odor slightly fragrant when dry. Pileus subinfundibuliform when young, later flabelliform with age, up to 21 mm diam and 3–5 mm thick at center. Pileal surface grayish red (10D6) to dark brown (9F8), obscurely concentrically zonate, velutinate to tomentose when fresh, becoming rugulose to glabrescent when dry; margin white (6A1) when fresh, light brown (6D4) when dry, even, sometimes eroded with age. Spine surface white (10A1) to grayish red (106) when fresh, pale orange (5A3) to brown (6E7) when dry; spines up to 1.5 mm long, base up to 0.1 mm diam, conical, 5–8 per mm, more or less decurrent on stipe, without spines at pileus margin, brittle when dry. Context not duplex, up to 5 mm thick, reddish brown (8E4), woody. Stipe central to lateral, up to 4 cm long and 0.7 cm diam, sometimes connate, leathery when fresh, woody upon drying, brown (7E6), tomentose, solid inner, context with a dark line present at centre, cylindrical to attenuate downwards or broadening below with bulbous base when old. Hyphal structure: hyphal system monomitic; generative hyphae with simple-septa, CB+ in slightly thick-walled hyphae, IKI–; tissues olivaceous in KOH. Context: generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, simple-septate, straight, regularly arranged, sometimes flexuous and collapsed, mostly 3–5 μm diam. Spines: generative hyphae hyaline, thin- to slightly thick-walled, frequently branched, more or less parallel along spines, often simple-septate, straight, 2–5 μm diam. Cystidia and cystidioles absent. Basidia clavate, thin-walled, with four sterigmata (2–4 μm long), simple-septate at base, 13–28 × 4–7 μm; basidioles similar to basidia. Basidiospores irregularly ellipsoid to subglobose, brown, thin-walled, tuberculate, CB–, IKI–, (4.1–)4.2–5.1(–5.3) × (3.4–)3.5–4.5(–5) μm, Lm = 4.7 μm, Wm = 4 μm, Q = 1.17–1.18 (n = 60/2); tuberculi usually isolated, sometimes in groups of two or more, then bi- to trifurcate in shape, up to 1.2 μm long.

Additional specimens (paratypes) examined: CHINA, Yunnan Province, Nanjian County, Lingbaoshan National Forest Park, on the ground, 19 September 2019, H. S. Yuan, Yuan 14396 (IFP 019430, paratype); Maguan County, Dalishu Township, Adushangba Village, on the ground, 7 August 2017, S. F. Shi, Shi 212 (IFP 019431, paratype).

Notes: The phylogenetic analyses support that Hydnellum yunnanense is sister to H. sulcatum (Figure 1). Morphologically, H. sulcatum resembles H. yunnanense in having an annual, solitary to gregarious basidiocarp with subinfundibuliform to flabelliform pileus with equal-length spines, a brown, pubescent, cylindrical stipe, olivaceous context tissue in KOH and basidiospores of similar shape. However, it differs from H. yunnanense in having a broader pileus (up to 65 mm vs. 21 mm in H. yunnanense) with scabrous to squamulose pileal surface and light brown pileal margin and shorter tuberculi (up to 0.9 μm vs. 1.2 μm in H. yunnanense). H. rubidofuscum resembles H. yunnanense by infundibuliform to flabelliform and concentrically zonate pileus, not duplex and woody context, thin- to slightly thick-walled and simple-septate hyphae in the context, basidia of similar width and basidiospores of similar shape and size. However, H. rubidofuscum differs by larger pileus (up to 70 mm vs. up to 21 mm in H. yunnanense) with reddish brown and scrupose, fibrillose to virgate pileal surface, grayish brown to reddish brown and longer spines (up to 3 mm vs. up to 1.5 mm in H. yunnanense) and thin-walled generative hyphae in the spines.

Hydnellumsp 3

Basidiocarps annual, solitary. Pileus applanate, flabelliform. Pileal surface brown (7E7) to dark brown (7F7), concentrically zonate and pubescent. Spines reddish brown (9E6) and more or less decurrent, up to 1 mm long. Stipe lateral, cylindrical and slender. Hyphal system monomitic, generative hyphae simple-septa. Basidia clavate, with four sterigmata. Basidiospores irregularly subglobose, tuberculate, (4.8–)4.9–5.2(–5.3) × (4–)4.1–4.8(–5) μm.

Specimen examined: CHINA, Yunnan Province, Nanjian County, Lingbaoshan National Forest Park, on the ground of angiosperm forest, 19 September 2019, H. S. Yuan, Yuan 14388 (IFP 019438).

Hydnellum sp 4

Basidiocarps annual, solitary to gregarious. Pileus irregularly flabelliform. Pileal surface grayish yellow (4B3) to yellowish brown (5E8), obscurely concentrically zonate and glabrescent. Spines yellowish brown (5D5) and more or less decurrent, up to 2 mm long. Stipe lateral and cylindrical. Hyphal system monomitic, generative hyphae simple-septa. Basidia clavate, with four sterigmata. Basidiospores irregularly subglobose, tuberculate, (4.1–)4.2–5.3(–6) × (4–)4.1–4.3(–4.8) μm.

Specimen examined: CHINA, Yunnan Province, Maguan County, Dalishu Township, on the ground in Fagaceous forest, 14 October 2017, J. Wang, Wang 295 (IFP 019439).

Hydnellumsp 5

Basidiocarps annual, solitary. Pileus irregularly circular. Pileal surface zonate, velutinous and strigose with lobed margin. Spines decurrent, up to 1 mm long. Stipe lateral, cylindrical and broadened below with bulbous base when old. Hyphal system monomitic, generative hyphae simple-septa. Basidia clavate, with four sterigmata. Basidiospores irregularly ellipsoid to subglobose, tuberculate, (4–)4.1–5.5(–5.6) × (3–)3.1–4.7(–5.2) μm.

Specimen examined: CHINA, Liaoning Province, Xinbin County, Gangshan Nature Reserve, in the angiosperm forest dominated by Quercus liaotungensis, 26 August 2020, H. S. Yuan, Yuan 14594 (IFP 019440).

OtherHydnellumspecies

Hydnellum complicatum, H. cumulatum, H. diabolus, H. geogenium, H. lundellii, H. martioflavus, H. peckii, H. regium, H. versipelle

Hydnellum peckii Banker, in Peck, Bull. N.Y. St. Mus. 157: 28 (1912) (1911)

Basidiocarps single to concrescent. Pileus turbinate or elliptical, planar to subdepressed. Pileal surface white (6A1) to light orange (6A4), colliculose, rarely scrobiculate and glabrous. Spines brownish orange (7C4), decurrent, up to 3 mm long. Stipe central and terete. Hyphal system monomitic; generative hyphae mostly with clamp-connections, minority of simple-septa. Basidia clavate, with simple-septate at base and four sterigmata. Basidiospores irregularly subglobose, tuberculate, (4.1–)4.2–5.1(–5.3) × (3.8–)3.9–4.4(–4.6) μm.

Specimens examined. CHINA, Xizang Autonomous Region, Bomi County, on the ground in Pinus mixed forest, 19 July 2019, H. S. Yuan, Yuan 13708 (IFP 0193433); Yuan 13720 (IFP 019434).

Notes: The studied samples were found in high altitude Pinus mixed forest. These two specimens clustered with two other samples (SSvantesson328 and ELarsson174-14) of Hydnellum peckii from Europe with full support (100% in ML and 1.00 BPP) (Figure 1). The ITS+LSU sequence identity between the specimens from China and Europe was 0.99 in Bioedit pairwise alignment. In morphology, the characters of our specimens overlap with those of H. peckii [1,27]. Therefore, we introduce H. peckii as a new record to China.

Key to species of Hydnellum from China
1. Basidiocarps fleshy	2
1.→ Basidiocarps woody	4
2. Pileal surface not scaled	H. coactum
2.→ Pileal surface scaled	3
3. Pileal surface with ascend squama	H. grosselepidotum
3.→ Pileal surface with appressed squama	H. lidongensis
4. Context tissue olivaceous in KOH	5
4.→ Context tissue blue-green in KOH	H. peckii
5. Hyphae with clamp-connections in the context	6
5.→ Hyphae without clamp-connections in the context and spines	8
6. Basidiocarps with dark violet spines underneath pileus	H. atrospinosum
6.→ Basidiocarps with different colored spines underneath pileus	7
7. Pileal surface fibrillose, rugose when dry, spines up to 1.5 mm long	H. fibulatum
7.→ Pileal surface pitted, colliculose when dry, spines up to 6 mm long	H. caeruleum
8. Inflated hyphae present from the context	9
8.→ Inflated hyphae absent in the context	10
9. Generative hyphae mostly inflated in the context, pileal surface scrobiculate when dry	H. inflatum
9.→ Generative hyphae occasionally inflated in the context, pileal surface granulose when dry	H. granulosum
10. Stipe thin, rhizomorphs-like	Hydnellum sp 1
10.→ Stipe cylindrical to flattened	11
11. Pileal surface colored brownish orange to brownish red	H. brunneorubrum
11.→ Pileal surface differently colored	12
12. Pileal margin involute and wavy, sometimes lobed or rimose	13
12.→ Pileal margin even or effused, sometimes lobed or eroded	14
13. Pileal surface glabrescent	Hydnellum sp 4
13.→ Pileal surface not glabrescent	15
14. Pileal surface azonate and spongy	16
14.→ Pileal surface obsurely concentrically zonate to zonate and not spongy	17
15. Pileal surface floccose to squamulose when fresh, context corky	H. squamulosum
15.→ Pileal surface tomentose and scrupose when fresh, context woody	H. bomiense
16. Basidiocarps single to gregarious and stipe single and long	H. spongiosipes
16.→ Basidiocarps coalescent and stipe connate and short	Hydnellum sp 2
17. Stipe context with a dark line at centre	18
17.→ Stipe context without a dark line at centre	19
18. Pileus and spines grayish red	H. yunnanense
18.→ Pileus brown and spines reddish brown	Hydnellum sp 3
19. Spines up to 3 or 3.5 mm long	20
19.→ Spines up to 1 or 1.5 mm long	21
20. Pileus light brown to dark ruby	H. atrorubrum
20.→ Pileus reddish brown	H. rubidofuscum
21. Basidiocarps gregarious or multiple pilei overlapping and pileal surface often grooved, scabrous to fibrous	H. sulcatum
21.→ Basidiocarps solitary and pileal surface velutinous and strigose	Hydnellum sp 5

5. Discussion

Baird et al. [27] constructed a phylogenetic tree of Bankeraceae using ITS sequences of specimens from the temperate southeastern United States, and suggested that neither Hydnellum nor Sarcodon were monophyletic. In the current study, phylogenetic analyses using four loci (nLSU + ITS + SSU + RPB2) of Hydnellum and Sarcodon were carried out using sequences from Europe, Asia and America. Our results also verify that Sarcodon is paraphyletic; with regard to Hydnellum, some species of Sarcodon nesting among Hydnellum species. Larsson et al. [31] provided phylogenetic analyses on Hydnellum and Sarcodon based on ITS and LSU sequences, confirming that Sarcodon makes Hydnellum paraphyletic and the genus limits were revised, 12 species of Sarcodon moved to Hydnellum. Morphologically, they proposed to use the size of the basidiospores to separate the two genera, delimiting Hydnellum and Sarcodon species with basidiospore lengths in the ranges of 4.45–6.95 µm and 7.4–9 µm, respectively. These results indicate that the traditional classification system based on the consistency of Sarcodon (fleshy) and Hydnellum (woody) did not conform to the monophyletic concept of the two genera.

Based on microscopical hyphal structure species of Hydnellum and Sarcodon can be divided into five groups, as shown in

Table 3. Hyphal-septa type observations in the context of the pileus and the spine trama in the species of Hydnellum and Sarcodon.

Group	Subgenus	Species	Pileus	Spines	References
I	Croceum	Hydnellum aurantiacum	simple-septa	simple-septa	Maas Geesteranus 1975 [1]
		H. auratile	simple-septa	simple-septa	Maas Geesteranus 1971 [26]
		H. brunneorubrum	simple-septa	simple-septa	In this study
		H. chrysinum	simple-septa	simple-septa	Baird 1986 [51]
		H. earlianum	simple-septa	simple-septa	Baird et al. 2013 [27]
	Inflatum	H. cristatum	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. granulosum	simple-septa	simple-septa	In this study
		H. inflatum	simple-septa	simple-septa	In this study
		H. piperatum	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. mirabile	simple-septa	simple-septa	Maas Geesteranus 1975 [1]
	Rhizomorphum	H. gracilipes	simple-septa	simple-septa	Koljalg & Renvall 2000 [35]
		Hydnellum sp 1	simple-septa	simple-septa	In this study
	Scabrosum	H. amygdaliolens	simple-septa	simple-septa	Rubio Casas et al. 2011 [52]
		H. coactum	simple-septa	simple-septa	Mu et al. 2020 [38]
		H. fagiscabrosum	simple-septa	simple-septa	Nitare et al. 2021 [53]
		H. fennicum	simple-septa	simple-septa	Hahn et al. 2018 [54]
		H. grosselepidotum	simple-septa	simple-septa	Mu et al. 2020 [38]
		H. illudens	simple-septa	simple-septa	Nitare et al. 2021 [53]
		H. lepidum	simple-septa	simple-septa	Maas Geesteranus 1975 [1]
		H. lidongensis	simple-septa	simple-septa	Mu et al. 2020 [38]
		H. nemorosum	simple-septa	simple-septa	Nitare et al. 2021 [53]
		H. scabrosellum	simple-septa	simple-septa	Nitare et al. 2021 [53]
		H. scabrosum	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. underwoodii	simple-septa	simple-septa	Baird et al. 2013 [27]
	Spongiosum	H. ferrugineum	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. pineticola	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. spongiosipes	simple-septa	simple-septa	Baird et al. 2013 [27]
		Hydnellum sp 2	simple-septa	simple-septa	In this study
	Violaceum	H. fuligineoviolaceum	simple-septa	simple-septa	Maas Geesteranus 1971 [26]
		H. fuscoindicum	simple-septa	simple-septa	Maas Geesteranus 1967 [65]
		H. glaucopus	simple-septa	simple-septa	Maas Geesteranus 1975 [1]
		H. joeides	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. roseoviolaceum	simple-septa	simple-septa	Nitare et al. 2021 [53]
	Zonatum	H. atrorubrum	simple-septa	simple-septa	In this study
		H. bomiense	simple-septa	simple-septa	In this study
		H. concrescens	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. dianthifolium	simple-septa	simple-septa	Loizides et al. 2016 [36]
		H. parvum	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. rubidofuscum	simple-septa	simple-septa	In this study
		H. scrobiculatum	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. squamulosum	simple-septa	simple-septa	In this study
		H. subsuccosum	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. sulcatum	simple-septa	simple-septa	In this study
		H. yunnanense	simple-septa	simple-septa	In this study
		Hydnellum sp 3	simple-septa	simple-septa	In this study
		Hydnellum sp 4	simple-septa	simple-septa	In this study
		Hydnellum sp 5	simple-septa	simple-septa	In this study
	Others	H. complicatum	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. cumulatum	simple-septa	simple-septa	Baird et al. 2013 [27]
		H. lundellii	simple-septa	simple-septa	Maas Geesteranus 1975 [1]
		H. martioflavum	simple-septa	simple-septa	Baird et al. 2013 [27]
II	Subindufibulatum	H. caeruleum	simple-septa, occasionally with clamp-connections	simple-septa	Baird & Khan 1986 [2]; In this study
		H. ferrugipes	simple-septa, occasionally with clamp-connections	simple-septa	Baird et al. 2013 [27]
		H. fibulatum	simple-septa, occasionally with clamp-connections	simple-septa	In this study
III	Others	H. peckii	mostly with clamp-connections, minority of simple-septa	mostly with clamp-connections, minority of simple-septa	Baird et al. 2013 [27]; In this study
		H. versipelle	mostly with clamp-connections, minority of simple-septa	mostly with clamp-connections, minority of simple-septa	Baird et al. 2013 [27]
IV	Others	H. diabolus	clamp-connections	simple-septa	Baird et al. 2013 [27]
V	Hydnellum	H. atrospinosum	clamp-connections	clamp-connections	In this study
		H. suaveolens	clamp-connections	clamp-connections	Baird et al. 2013 [27]
	Caesispinosum	H. cyanopodium	clamp-connections	clamp-connections	Baird 1986 [51]
		H. scleropodium	clamp-connections	clamp-connections	Harrison 1964 [33]
	Others	H. geogenium	clamp-connections	clamp-connections	Baird et al. 2013 [27]
	Sarcodon	Sarcodon aspratus	clamp-connections	clamp-connections	Maas Geesteranus 1971 [26]
		S. imbricatus	clamp-connections	clamp-connections	Baird et al. 2013 [27]
		S. leucopus	clamp-connections	clamp-connections	Mleczko et al. 2011 [66]
		S. quercinofibulatus	clamp-connections	clamp-connections	Pérez-De-Gregorio et al. 2011 [67]
		S. scabripes	clamp-connections	clamp-connections	Baird et al. 2013 [27]
		S. squamosus	clamp-connections	clamp-connections	Baird 1986 [34]
	Others	H. regium	hyphae with few simple-septa and with a few clamp-connections		Harrison 1964 [33]

: (I) Context of the pileus and the spines composed of simple-septate hyphae (includes H. aurantiacum, H. auratile and 49 other taxa); (II) Pileus composed mostly of simple-septate hyphae with occasional clamp-connections and spinal trama composed of simple-septate hyphae (includes H. caeruleum, H. ferrugipes and H. fibulatum); (III) Both pileus and the spines composed of predominantly clamped hyphae with occasional simple-septa (includes H. peckii and H. versipelle); (IV) Pileus composed of only hyphae with clamp-connections and spine with only simple-septate hyphae (includes H. diabolus); (V) Both pileus and the spines composed of clamped hyphae (includes H. atrospinosum, H. cyanopodium, H. geogenium, H. scleropodium, H. suaveolens, S. aspratus, S. imbricatus, S. leucopus, S. quercinofibulatus, S. scabripes and S. squamosus). One species, H. regium, has not been classified into these five groups because the information is not available from the original description [33].

In the phylogenetic tree, ten subgenera with moderate to high support in Hydnellum have been distinguished (Figure 1), and each subgenus possesses distinctive morphological characteristics. Group I can be categorized into seven subgenera. The subgenus Croceum has an orange basidiocarps and includes H. aurantiacum, H. auratile, H. brunneorubrum, H. chrysinum and H. earlianum; the subgenus Inflatum has the appearance of inflated hypha in the context of the pileus and includes H. cristatum, H. granulosum, H. inflatum, H. mirabile and H. piperatum; the subgenus Rhizomorphum has rhizomorphs-like stipe and includes H. gracilipes and Hydnellum sp 1; the subgenus Scabrosum has pileal surface with scabrosity and includes H. amygdaliolens, H. coactum, H. fagiscabrosum, H. fennicum, H. grosselepidotum, H. illudens, H. lepidum, H. lidongensis, H. nemorosum, H. scabrosellum, H. scabrosum and H. underwoodii; the subgenus Spongiosum corresponds to a spongy pileal surface and includes H. ferrugineum, H. pineticola, H. spongiosipes and Hydnellum sp 2; the subgenus Violaceum corresponds to the violaceous basidiocarps and includes H. fuligineoviolaceum, H. fuscoindicum, H. glaucopus, H. joeides and H. roseoviolaceum; the subgenus Zonatum has a concentrically zonate pileal surface and includes H. atrorubrum, H. bomiense, H. concrescens, H. dianthifolium, H. parvum, H. rubidofuscum, H. scrobiculatum, H. squamulosum, H. subsuccosum, H. sulcatum, H. yunnanense, Hydnellum sp 3, Hydnellum sp 4 and Hydnellum sp 5. Group II corresponds to the subgenus Subindufibulatum, having occasionally clamped hyphae in the context of the pileus, and includes H. caeruleum, H. ferrugipes and H. fibulatum. Group V corresponds to all hyphae clamped in the pileus and the spines, incorporating two subgenera of Hydnellum and six Sarcodon species; the subgenus Hydnellum has dark spines and includes H. atrospinosum and H. suaveolens; the subgenus Caesispinosum has blue spines and includes H. cyanopodium and H. scleropodium; H. geogenium is morphologically related to other species in Group V, but is distantly related in the phylogenetic tree; Sarcodon clade S. aspratus, S. imbricatus, S. leucopus, S. quercinofibulatus, S. scabripes and S. squamosus have the characteristics of long spores compared with the Hydnellum species. Therefore, the classification system using hyphal structure type and phylogenetic subgenera can fix the positions for most species in Hydnellum and Sarcodon, except for some species in Groups III, IV and those without phylogenetic support.

The specimens involved in this study were collected from the northeast, northwest and southwest regions of China, where industrial pollution is relatively low and vegetation is relatively abundant. The forests are primarily dominated by Pinaceae and Fagaceae trees such as Pinus spp., Picea spp., Quercus spp., Lithocarpus spp. and a small portion of other tree families. Thus, we speculated that these species may form an ectomycorrhizal association with Pinaceae and Fagaceae host trees. The species diversity and basidiocarps richness of stipitate hydnoid fungi represented by Hydnellum and Sarcodon species have shown a declining trend across Europe and some regions of North America during the 1970s to 2000s [6,55,56,57]; the phenomenon is most probably caused by forest management, air pollutants, forest soil acidification, nitrogen deposition and forest succession, among other causes [19,58,59,60,61]. Many stipitate hydnoid fungi have been included in national Red Lists in Europe [27,62,63,64]. With the rapid industrialization in China over the past four decades, a significant decline of basidiocarps has also been observed during the course of our field investigation. The identification and description of stipitate hydnoid fungi in this paper will contribute to the understanding of species diversity and provide baseline data for the evaluation and protection of these fungi in China.