Next Article in Journal
Synergistic Enhancement of Straw Hydrolysis and Lactic Acid Production in Talaromyces pinophilus Through Combined Random Mutagenesis and Plasmid Reconstruction
Previous Article in Journal
In Vivo Evaluation of a Nanoemulsion-Delivered Chromium(III)–Triazole Complex Against Fluconazole-Resistant Candida albicans
Previous Article in Special Issue
Genetic Diversity and Gene Flow of the Ectomycorrhizal Mushroom Lactarius hatsudake in Southern China: Evidence from SSR Markers
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 12
Issue 6
10.3390/jof12060404
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Circadian Clock Homologs and Their Rhythmic Expression Differences Among Mating-Type Strains in Morchella sextelata

by
Meng-Qian Chen
,
Jun-Xi Liu
,
Jia Ling
and
Xi-Hui Du
*
College of Life Sciences, Chongqing Normal University, Chongqing 401331, China
*
Author to whom correspondence should be addressed.
J. Fungi 2026, 12(6), 404; https://doi.org/10.3390/jof12060404
Submission received: 10 March 2026 / Revised: 15 May 2026 / Accepted: 27 May 2026 / Published: 2 June 2026
(This article belongs to the Special Issue Edible and Medicinal Macrofungi, 4th Edition)
Browse Figures
Versions Notes

Abstract

The circadian clock is a widespread rhythmic phenomenon across organisms, characterized by distinct gene expression patterns and behaviors at specific times of the day. Extensive genetic studies in the model fungus Neurospora crassa have yielded critical insights into the components and molecular mechanisms of circadian oscillators. However, these understandings remain absent across fungal lineages, especially from edible mushrooms. Morels (Morchella spp.) are well-recognized edible ascomycetes of considerable economic value and are partially artificially cultivated, but their biological characteristics are poorly understood. Investigating the presence of their circadian clock components, as well as the molecular underpinnings of circadian rhythms, holds important biological implications. In this study, we firstly performed a genomic search for homologs of known circadian clock genes in Morchella sextelata. Homologs of seven circadian clock genes, including wc-1, wc-2, fwd-1, frh, frq, and two additional clock-controlled genes, were identified, indicating the components necessary for the operation of a FWC oscillator contained in M. sextelata. Then, using reverse transcription quantitative PCR (RT-qPCR), the expression profiles of these seven circadian clock-related genes and four mating-type genes were examined in RNA samples which were extracted from mycelia of MAT1-1, MAT1-2 and MAT1-1 × MAT1-2 co-culture/crossed condition during conidiation under in vitro cultivation across one day. The expression levels of seven circadian clock genes and four mating-type genes displayed similar time-of-day-specific rhythmic patterns, yet remained consistently distinct across the mating-type strains and their co-culture/crossed condition, indicating a potential correlation between circadian clock and mating-type loci. Collectively, these results suggest that M. sextelata harbors conserved circadian clock-related homologs and displays mating-type-associated temporal expression differences under the tested conidiation conditions, offering a novel perspective for exploring the potential link between clock-related regulation and mating-type background in the future.

1. Introduction

Circadian clocks are endogenous timekeeping systems that synchronize with environmental cues, and play a vital role in coordinating gene expression, physiology, and behaviors across the tree of life in a ~24 h cyclic oscillation [1,2,3,4]. The circadian clock is evolutionarily conserved across eukaryotes and relies on a transcription–translation feedback loop (TTFL), comprising positive regulators (WC-1/WC-2 in Neurospora crassa, CYC/CLK in Drosophila, and BMAL1/CLOCK in mammals) and negative components (FRQ, TIM/PER, and CRY/PER in the corresponding organisms, respectively) [5,6,7,8,9]. In fungi, N. crassa is the most extensively characterized model fungus for circadian rhythm research, with its clock system widely documented to regulate key biological processes, including conidiation, sexual reproduction, hyphal growth rate, and aerial hyphae formation [10,11,12]. Its circadian clock system is centered on the FRQ/WCC oscillator [13], which comprises core molecular components including FRQ (FREQUENCY), FRH (FRQ-interacting RNA helicase), WC-1 (White Collar-1), WC-2 (White Collar-2) and FWD-1 (F-box/WD40 repeat-containing protein-1) [14,15]. Besides the core molecular components, there is also a group of well-described clock-controlled genes (ccgs) [16,17], which are downstream target genes of the circadian oscillator [18,19].
The fungal kingdom is estimated to comprise up to 5.1 million potential species [20]. However, except for the model fungus N. crassa [2], studies on circadian clocks, related phenomena, and oscillator components in other fungi are largely limited, especially in edible fungi. One effective approach to elucidate circadian rhythms in other fungi is to examine the distribution of the core clock genes from N. crassa in their genomes and characterize their expression patterns [19,21,22,23]. Morchella, a genus of edible and medicinal fungi, has garnered increasing attention due to its artificial cultivation and substantial economic value [24,25,26,27]. Given that the yield and quality of Morchella fruiting bodies are tightly linked to the coordination of developmental events (e.g., mycelial growth, conidiation, primordium formation and fruiting body maturation) with environmental cycles, investigating its circadian clock is theoretically and practically relevant for better understanding its life cycle. Furthermore, despite the circadian clock being well-documented in model fungi, whether circadian rhythms are modulated in the co-culture/crossed condition between MAT1-1 and MAT1-2 strains remains unexplored. Likewise, comparisons of circadian rhythmicity among strains with different mating types remain poorly investigated. Morchella mainly displays a heterothallic mating system, in which the MAT1-1 idiomorph harbors MAT1-1-1, MAT1-1-10, and MAT1-1-11, whereas the MAT1-2 idiomorph contains only MAT1-2-1 [24,26]. Comparative studies on the circadian clock gene expression among its different mating-type and co-culture/crossed conditions are helpful to uncover the rhythmic difference between mating types.
In this study, we identified putative homologs of known fungal circadian clock-related genes in the genome of M. sextelata and examined the temporal expression patterns of selected clock-related homologs and mating-type genes in MAT1-1, MAT1-2 and MAT1-1 × MAT1-2 co-culture during conidiation. By comparing expression profiles across these mating-type backgrounds, we aimed to determine whether clock-related homologs and mating-type genes exhibit time-of-day-dependent transcriptional differences. These analyses provide an initial framework for understanding clock-related transcriptional dynamics in M. sextelata and for exploring their potential association with mating-type regulation.

2. Materials and Methods

2.1. Strains Used in This Study

The wild fruiting body of Morchella sextelata, collected in China, was used in this study, with species identification confirmed by phylogenetic analysis of the ITS dataset. Its single mating-type strains with either MAT1-1 or MAT1-2 were obtained by isolating single ascospores which were detected using mating-type genes. The MAT1-1 and MAT1-2 isolates were maintained separately for single-strain experiments and were also used to establish the MAT1-1 × MAT1-2 co-culture/crossed condition described below.

2.2. Growth Conditions and Sampling

For analysis of circadian rhythms and detection of mating-type-associated differences, the MAT1-1 strain, MAT1-2 strain and MAT1-1 × MAT1-2 co-culture/crossed condition with 24 replicates for each treatment were inoculated on Murashige and Skoog medium (MS; Solarbio Science & Technology Co., Ltd., Beijing, China) and then cultivated for 24 days to induce conidiation under the following conditions: placing these MS plates on a clean bench at free-running indoor temperature in the lab with windows open from December to January by mimicking natural growth conditions with light from the lab windows and occasional lab illumination. For the MAT1-1 × MAT1-2 co-culture/crossed condition, MAT1-1 and MAT1-2 isolates were inoculated on the same MS plate to allow mycelial contact. Dense conidial production was mainly observed in the contact region between the two mating-type isolates. At each sampling time point, mycelial tissues from the co-culture plate, including the contact region, were harvested for RNA extraction. Therefore, this treatment contained mycelial material from both MAT1-1 and MAT1-2 mycelia and their contact region. Because heterokaryon formation at the contact region could not be directly verified in the present study, this treatment is referred to as the MAT1-1 × MAT1-2 co-culture/crossed condition. On the 24th day, three replicates of each treatment were harvested every 3 h over 24 h. Finally, a total of 72 samples were harvested and obtained for RNA extraction and RT-qPCR, including three replicates of each treatment at 0 h, 3 h, 6 h, 9 h, 12 h, 15 h, 18 h, and 21 h, respectively. Zeitgeber time (ZT) denotes an exogenous temporal framework that anchors biological rhythms to a principal environmental synchronizer (Zeitgeber, a German term literally meaning “time giver”). Herein, ZT labels are used to denote chronological sampling points under the tested culture condition, such as 3:00 p.m. corresponding to ZT15:00.

2.3. Homolog Identification of Circadian Clock Genes and Acquisition of Mating-Type Genes in M. sextelata

Seventeen clock-related genes, including four core circadian clock genes (wc-1, wc-2, frh, frq from N. crassa, Aspergillus chevalieri and A. melleus) [11], and 13 additional clock-associated or clock-controlled genes (fwd-1, pre-1, pre-2, mfa-1 and seven ccgs from N. crassa and two ccgs from Lachnellula hyalina) [11,28,29,30,31] were used as queries to search for their putative homologs in the M. sextelata genomic databases in NCBI using BLASTX [32]. Details of all query circadian clock genes used are listed in Table 1. Orthology of the M. sextelata genes was assessed and potential homologs in M. sextelata were retrieved using an E value less than 1 × 10−10, species identity over 30% and coverage over 25% as selection criteria. Four mating-type genes, including MAT1-1-1, MAT1-1-10, MAT1-1-11 and MAT1-2-1 were acquired from the publicly available reference genome of M. sextelata in the NCBI database (GenBank accession number: GCA_020137385.1) and via PCR amplification.
Primers for the finally selected homologs of circadian clock genes and mating-type genes were designed using NCBI Primer-BLAST (National Center for Biotechnology Information, Bethesda, MD, USA; https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 1 May 2026) [33] with the following criteria: length: 18–22 bp; amplicon size: 80–200 bp; melting temperature (Tm): 50–60 °C; and GC content: 40–60%. The specificity of all primers designed was further validated using BLAST and the NCBI Primer-BLAST tool.

2.4. RNA Extraction and RT-qPCR

Samples, including hyphae and conidial tissues for each, were ground in liquid nitrogen and total RNA was extracted using TRIzol reagent (Accurate Biology Co., Ltd., Changsha, China) according to the manufacturer’s instructions. The concentration of total RNA was measured with a Nanodrop Analyzer (Allsheng Instruments Co., Ltd., Hangzhou, China). To assess the integrity of the RNA, the total RNA were run on a denaturing gel to check for the presence of clear 28S and 18S rRNA bands at a 2:1 ratio. Then, the total RNA of each group was used as the template for reverse transcription with the Evo M-MLV reverse transcription kit (Accurate Biology Co., Ltd., Changsha, China).
Real-time quantitative PCR (RT-qPCR) was used to quantify gene expression of seven circadian clock-related homologs and four mating-type genes in M. sextelata, elucidating 24 h regulatory trends of 11 genes during conidiation. The primers of 11 targeted genes for RT-qPCR are detailed in Table 2. RT-qPCR was conducted using a CFX Connect real-time PCR detection system (Bio-Rad, Hercules, CA, USA) at 95 °C for 2 min, and then 40 cycles at 95 °C for 10 s followed by 52 °C for 15 s, and 72 °C for 15 s with actin1 selected as the normalization reference after candidate reference-gene validation (internal control) in this study. The instrument default was set to melt-curve analysis. The total volume of the reaction system was 20 μL, including 10 μL of 2× SYBR® green premix ProTaq HS kit (Accurate Biology Co., Ltd., Changsha, China), 0.6 μL each of positive and negative primers, 1 μL of cDNA and 7.8 μL of RNase-free ddH2O. The method of 2−ΔΔCt was used to calculate the relative expression ratios of target genes [34]. Independent assays were performed three times.

2.5. Reference-Gene Validation for RT-qPCR Normalization

To validate the suitability of reference genes for RT-qPCR normalization under the circadian time-series sampling condition, three candidate reference genes, actin1, elongation factor 1-α and β-tubulin were evaluated in this study using primers reported in [35]. Raw Ct values of these candidate genes across all tested samples were used for stability analysis with the BestKeeper algorithm. The stability of each candidate reference gene was assessed based on standard deviation (SD), coefficient of variation (CV) and correlation with the BestKeeper index. The gene showing the highest expression stability was selected as the internal reference for normalization of target gene expression across circadian time during conidiation of M. sextelata.

2.6. Statistical Analysis

Statistical analyses of the rhythmic expression profiles of the 11 investigated genes across time points were performed using SPSS 27.0, employing one-way ANOVA, with a significance level set at p < 0.05. The GraphPad Prism version 10.3.0 was utilized for data visualization.

3. Results

3.1. Conidiation Comparison of MAT1-1, MAT1-2 and MAT1-1 × MAT1-2 Co-Culture

We examined the conidial growth of cultures grown on MS medium over a 24-day period. A marked difference between single MAT cultures and the MAT1-1 × MAT1-2 co-culture/crossed condition was observed. MAT1-1 and MAT1-2 strains displayed only sporadically scattered conidia on their respective media. At the junction between MAT1-1 and MAT1-2 in the co-culture/crossed condition, conidia clustered densely in their contacted region (Figure 1). Because heterokaryon formation could not be experimentally verified, this phenotype is interpreted as a co-culture-associated conidiation pattern rather than direct evidence of a genetically confirmed heterokaryotic strain.

3.2. Identification of Circadian Clock Gene Homologs in M. sextelata

In order to investigate the presence of circadian clock-associated genes in M. sextelata, we examined its genome for homologs of the four core circadian clock genes (frq, wc-1, wc-2, frh), nine clock-controlled output genes (ccgs) and four additional clock-controlled genes (mfa-1, pre-1, pre-2, fwd-1), which were identified from N. crassa, A. chevalieri, A. melleus and L. hyalina, respectively [11,28,29,30,31]. Then, homologs of four core circadian clock genes (wc-1, wc-2, frh, frq) and one clock gene (fwd-1) were identified in the M. sextelata genome, sharing 30.85–61.04% sequence identity with queries (Table 1). Among the nine ccgs of N. crassa and L. hyalina, only homologs of five (ccg-8, ccg-9, ccg-15, ccg-16, ccg-14) were identified in M. sextelata, sharing 33.33–51.72% sequence identity with queries. Due to low coverage of homologs of ccg-15, ccg-16 and ccg-14 to those of N. crassa, the three homologs were not further investigated in this study. Homologs of ccg-1, ccg-4, ccg-6, ccg-13, mfa-1, pre-1, and pre-2 have not been identified in the genome of M. sextelata, with nothing matched. The homologs of circadian clock genes in M. sextelata are summarized in Table 1. The results indicated that M. sextelata contain frq, frh, wc-1, wc-2, and fwd-1 homologs (Table 1), indicating that this species contains the components necessary for a FWC oscillator as is found in N. crassa. It also contain homologs for ccg-8 and ccg-9 of the output pathway of the FWC oscillator in N. crassa.

3.3. Validation of Candidate Reference Genes for RT-qPCR Normalization

To ensure the reliability of RT-qPCR normalization under the present time-series sampling condition, three candidate reference genes, actin1, elongation factor 1-α and β-tubulin, were evaluated using the BestKeeper algorithm based on their raw Ct values. All three candidate reference genes showed SD values below 1, indicating acceptable expression stability under the tested experimental conditions. Among the three candidates, actin1 showed the lowest SD value and a high correlation with the BestKeeper index. Although elongation factor 1-α displayed a slightly higher correlation coefficient, actin1 exhibited lower Ct variation and a moderate expression level. Therefore, actin1 was selected as the internal reference gene for normalization of clock-related homologs and mating-type genes in the subsequent RT-qPCR analysis (Table 3).

3.4. Expression Patterns of Seven Circadian Gene Homologs in MAT1-1, MAT1-2 and MAT1-1 × MAT1-2 Co-Culture

To elucidate whether the seven circadian homologs (frq, frh, fwd-1, wc-1, wc-2, ccg-8 and ccg-9) found in M. sextelata had rhythmic periodicity, we applied RT-qPCR and analyzed the expression patterns of them in the MAT1-1, MAT1-2 and their co-culture/crossed conditions at eight time points of the conidiation stage during the ZT cycle of one day.

3.4.1. Expression Patterns of Seven Circadian Gene Homologs in the MAT1-1 Strain

All the seven circadian gene homologs had one high expression peak at ZT12:00 and one low expression trough at ZT15:00 (Figure 2A). After the peak at ZT12:00, the expression of ccg-8, frh and frq showed similar rhythmic fluctuation patterns with the second peak at ZT0:00, while fwd-1 had the second peak at ZT3:00. In addition, the expression of wc-1, wc-2 and ccg-9 showed similar rhythmic fluctuation patterns with two or three peaks at ZT18:00, ZT0:00 and ZT6:00 after the peak at ZT12:00, respectively.
One-way ANOVA confirmed significant rhythmic variation in four of the seven genes, whereas expression changes in fwd-1, wc-1, and ccg-9 did not reach statistical significance (Figure 2A). Notably, even these non-significant genes exhibited peak timing broadly similar to the significant ones, suggesting a coordinated expression program across all seven genes. In addition, the current expression patterns of seven circadian gene homologs in the MAT1-1 strain indicate a potential rhythmic periodicity of 12 h. However, since this study only investigated a 24 h period, further research with a longer duration is needed.

3.4.2. Expression Patterns of Seven Circadian Gene Homologs in the MAT1-2 Strain

Notably, the expression patterns of seven circadian gene homologs in the MAT1-2 strain were totally different from those in the MAT1-1 strain, and did not exhibit clear regular rhythmic oscillation, instead presenting a single broad, gently rounded expression peak (Figure 2B). The expression levels of ccg-8, frh, frq and fwd-1 were consistently higher than those of wc-1, wc-2 and ccg-9. One-way ANOVA verified significant rhythmic variation in five of the seven genes, while the expression changes in wc-1 and ccg-8 were not statistically significant (Figure 2B). Nevertheless, genes that lacked significant rhythmicity still displayed broadly consistent peak phases with the significant genes. Rhythmic patterns indicate that these genes in the MAT1-2 strain are likely under circadian regulation with an approximately 24 h period.

3.4.3. Expression Patterns of Seven Circadian Gene Homologs in the MAT1-1 × MAT1-2 Co-Culture

Interestingly, the expression patterns of seven circadian gene homologs in the co-culture/crossed condition were totally different from those in both the MAT1-1 strain and MAT1-2 strain, but their expression demonstrated a surprisingly consistent rhythmic fluctuation pattern (Figure 2C). All the seven circadian gene homologs (ccg-8, frh, frq, fwd-1, wc-1 and ccg-9) had the highest expression peak at ZT18:00, with an exception of wc-2 at ZT 21:00. They also exhibited nearly identical expression levels at ZT18:00, except for ccg-9, which showed a significantly higher expression level. All the seven circadian gene homologs (ccg-8, frh, frq, fwd-1, wc-1 and ccg-9) had the lowest expression at ZT0:00, with an exception of ccg-9 at ZT3:00.
According to one-way ANOVA analysis, only frh and frq among the seven genes showed significant rhythmic expression changes in the co-culture/crossed condition (Figure 2C), while the other five genes did not exhibit statistically significant rhythmicity. Despite lacking statistical significance, these genes still showed comparable peak phases to the significant ones, supporting the presence of a unified expression profile across all seven genes. The circadian period of seven circadian gene homologs in the co-culture/crossed condition remains unclear, owing to the short duration of investigations into their expression patterns.

3.4.4. Comparison of Expression Patterns Among MAT1-1, MAT1-2 and MAT1-1 × MAT1-2 Co-Culture

The expression patterns of seven circadian gene homologs were totally different among MAT1-1, MAT1-2 and their co-culture/crossed condition. Seven circadian gene homologs in the MAT1-1 strain (Figure 2A) had similar expression pattern to some extent but still showed partial differences between the four gene homologs (ccg-8, frh, frq, fwd-1) and the other three (wc-1, wc-2, ccg-9). It is the same case in the MAT1-2 strain, where the four gene homologs (ccg-8, frh, frq, fwd-1) and the other three (wc-1, wc-2, ccg-9) had a similar expression pattern but also demonstrated differences (Figure 2B). In the co-culture/crossed condition, seven circadian clock-related gene homologs exhibited a nearly unified expression pattern characterized by a highest peak and similar expression level (Figure 2C). Additionally, given that the MAT1-1, MAT1-2 and their co-culture/crossed conditions potentially have different rhythmic periods for circadian gene homologs (Figure 2A–C), further studies are needed.

3.5. Expression Patterns of Four Mating-Type Genes in MAT1-1, MAT1-2 and MAT1-1 × MAT1-2 Co-Culture

To elucidate the rhythmic periodicity of four mating-type genes, we applied RT-qPCR and assessed the expression patterns of MAT1-1-1, MAT1-1-10, and MAT1-1-11 in the MAT1-1 strain, MAT1-2-1 in the MAT1-2 strain, and MAT1-1-1, MAT1-1-10, MAT1-1-11, and MAT1-2-1 in the co-culture/crossed condition at the conidiation stage at eight time points during the ZT cycle of 24 h.

3.5.1. Expression Patterns of Three Mating-Type Genes in the MAT1-1 Strain

In the MAT1-1 strain (Figure 3A), both MAT1-1-10 and MAT1-1-11 had the same rhythmic periodicity from ZT9:00 to ZT6:00, exhibiting expression peaks at both ZT12:00 and ZT0:00 and expression troughs at both ZT15:00 and ZT3:00 with a nearly identical expression level (Figure 3A). From ZT9:00 to ZT21:00, MAT1-1-1 showed a similar rhythmic periodicity as both MAT1-1-10 and MAT1-1-11, with one expression peak at ZT12:00, but MAT1-1-1 had a very different expression pattern from the other two genes after ZT21:00. According to one-way ANOVA, MAT1-1-1 and MAT1-1-11 displayed significant rhythmic expression changes (Figure 3A), whereas MAT1-1-10 showed no statistically significant rhythmicity. Notably, despite lacking significance, MAT1-1-10 exhibited a rhythmic peak similar to that of MAT1-1-11, implying a coordinated expression program between the two genes.

3.5.2. Expression Patterns of One Mating-Type Gene in the MAT1-2 Strain

In the MAT1-2 strain, the expression pattern of MAT1-2-1 (Figure 3B) was totally different from those of MAT1-1-1, MAT1-1-10 and MAT1-1-11 in the MAT1-1 strain (Figure 3A). The gene MAT1-2-1 did not show a regular fluctuation periodicity from ZT9:00 to ZT6:00 and exhibited a steep trough at ZT6:00. One-way ANOVA analysis revealed significant rhythmic expression changes in MAT1-2-1 (Figure 3B).

3.5.3. Expression Patterns of Four Mating-Type Genes in the MAT1-1 × MAT1-2 Co-Culture

In the co-culture/crossed condition, the expression pattern of MAT1-1-1, MAT1-1-10, MAT1-1-11 and MAT1-2-1 (Figure 3C) was totally different from those in the MAT1-1 and MAT1-2 strains (Figure 3A,B). Interestingly, the expression of MAT1-1-10 and MAT1-1-11 still showed a consistent rhythmic pattern in the cross, remaining different from that of MAT1-1-1. Moreover, the expression of MAT1-2-1 in the co-culture/crossed condition exhibited an opposite pattern to that in the MAT1-2 strain, showing the lowest trough at ZT12:00. According to one-way ANOVA analysis, only MAT1-1-1 among the four mating-type genes showed significant rhythmic expression changes, while MAT1-1-10, MAT1-1-11 and MAT1-2-1 did not exhibit statistically significant rhythmicity (Figure 3C). MAT1-1-10 and MAT1-1-11 exhibited similar rhythms to that of MAT1-1-1.

3.5.4. Comparison of Expression Patterns Among MAT1-1, MAT1-2 and MAT1-1 × MAT1-2 Co-Culture

On the one hand, the expression pattern of MAT1-1-1, MAT1-1-10, MAT1-1-11 and MAT1-2-1 in the co-culture/crossed condition was totally different from those in the MAT1-1 and MAT1-2 strains (Figure 3). On the other hand, MAT1-1-10 and MAT1-1-11 in the MAT1-1 strain exhibited relatively regular circadian fluctuations, indicating a rhythm periodicity of 12 h. However, MAT1-1-1 in the MAT1-1 strain, MAT1-2-1 in the MAT1-2 strain, and MAT1-1-1, MAT1-1-10, MAT1-1-11, and MAT1-2-1 in the co-culture/crossed condition did not show clear regular circadian fluctuations and their rhythm periodicity is currently unknown, indicating further research with a longer duration needed.

3.6. Comparison of Eleven Gene Expression Patterns Among MAT1-1, MAT1-2 and MAT1-1 × MAT1-2 Co-Culture

To investigate whether the four mating-type genes exhibited circadian expression patterns similar to the seven circadian clock homologs, we analyzed their expression profiles within each strain, including either all investigated genes (Figure 4(A1,B1,C1)) or only significantly rhythmic genes (Figure 4(A2,B2,C2)). In both the MAT1-1 strain (Figure 4(A1,A2)) and MAT1-2 strain (Figure 4 (B1,B2)), the mating-type genes and their corresponding clock homologs displayed remarkably consistent expression patterns and rhythmic fluctuations. In the co-culture/crossed condition, these genes also showed generally consistent expression dynamics (Figure 4(C1,C2)), except for MAT1-2-1 (non-significant), which exhibited a distinct low trough at ZT12:00 (Figure 4(C1)). Interestingly, as core components of the fungal circadian clock system, the expression rhythms of frh and frq were significant across the MAT1-1, MAT1-2 and their co-culture/crossed strains, and MAT1-1-1 showed significant rhythms in both MAT1-1 and crossed strains. In M. sextelata, the expression rhythms of these eleven genes were highly conserved within each strain but varied consistently across the three strains, regardless of whether all investigated genes or only significantly rhythmic ones were considered. Together, these results support the existence of an endogenous circadian clock governing conidiation in M. sextelata, although its rhythms appear to differ among mating-type strains and their co-culture/crossed condition strains.

4. Discussions

Among fungi, the ascomycete N. crassa stands as the sole model system in which the molecular underpinnings of circadian rhythms have been extensively characterized, especially during conidiation [11,36,37]. However, the molecular architecture of circadian clocks in other fungal species remains largely unknown. In this study, we investigated the circadian components of M. sextelata, which has been successfully cultivated on a commercial scale in China [24,38], and further evaluated their rhythmic expression patterns in MAT1-1, MAT1-2, and their MAT1-1 × MAT1-2 co-culture/crossed condition during conidiation. Our results demonstrate that M. sextelata harbors core components of the circadian oscillator, exhibiting rhythmic expression for eleven genes examined. Notably, distinct expression patterns and peak times were observed among the three investigated conditions, which represent novel characteristics distinct from those previously reported in other fungi [37,39,40].
The core circadian oscillator is organized around a feedback loop governed by the FRQ, FRH, WC-1, WC-2, and FWD-1 in N. crassa, and controls other clock-controlled genes (ccgs) in a circadian fashion [39,41,42]. To date, all fungal species in which the frq gene has been identified possess a circadian clock [19,43]. However, not all fungi with circadian rhythmicity harbor the frq gene [32,44]. In comparison with frq, wc-1 and wc-2 are widely conserved in the fungi [22,41]. In this study, through homologous sequence alignment and bioinformatic analyses, we identified seven homologs in the M. sextelata genome that exhibit high sequence similarity to circadian clock genes characterized in N. crassa, including the core ones frq, frh, wc-1, wc-2, and fwd-1, as well as ccg-8 and ccg-9. The results indicate that M. sextelata carries the conserved components required for FWC oscillator operationality as previously reported in N. crassa, and possesses the inherent ability to manifest circadian rhythmicity.
Then, the expression patterns of seven circadian homologs and four mating-type genes were assessed via RT-qPCR in this study, showing a surprisingly nearly consistent expression pattern and rhythm fluctuation within each of the three strains but uniformly different ones among the three strains, except for the gene MAT1-2-1 in the co-culture/crossed condition (Figure 2, Figure 3 and Figure 4). In the MAT1-1 strain, all genes (seven clock genes, MAT1-1-1, MAT1-1-10 and MAT1-1-11) exhibited a transcriptional peak at ZT12:00 (the middle of the day), with most also showing a secondary peak at ZT0:00 (dawn time). In contrast, these genes (seven clock genes and MAT1-2-1) lacked distinct sharp peaks in the MAT1-2 strain, displaying only a broad expression peak spanning ZT9:00 to ZT6:00 throughout the experimental period. Notably, in the co-culture/crossed condition, all genes (seven clock genes, MAT1-1-1, MAT1-1-10, MAT1-1-11 and MAT1-2-1) showed a clear peak at ZT18:00 (dusk time) except MAT1-2-1, totally different from those observed in either the MAT1-1 or MAT1-2 strain. In N. crassa, the expression of its clock genes exhibits only a single peak within a 24 h period [5,22,36,39], similar to our finding of only one peak in the co-culture/crossed condition of M. sextelata (Figure 2C). In contrast, the MAT1-1 strain of M. sextelata displays multiple expression peaks, whereas the MAT1-2 strain yields a single broad, gently rounded peak (Figure 2A,B).
In addition, the peak time of most known ccgs in N. crassa largely coincides with that of the core clock gene frq, occurring from late night to early morning (dawn time), although they differ in overall expression levels and rhythmic amplitude, with only a few ccgs peaking at midday (noon time) or night (dusk time) [45,46]. These distinct expression phases of circadian genes are also observed in mice with transcriptional “rush hours” at dawn and dusk [47]. However, in M. sextelata, the peak time of the investigated clock genes and mating-type genes occurred at noon and dawn time in the MAT1-1 strain, but at dusk time in the co-culture/crossed condition, without an obvious peak time observed in the MAT1-2 strain. As previous circadian clock studies did not consider the mating types of the strains used [45,46,48], whether the expression peak numbers and peak times arise from differences in mating type or species remains unclear and warrants further investigation. However, the degree to which conidiation is governed by the circadian clock in the fungal kingdom suggests a selective advantage for initiating these developmental processes at specific times of the day [10,11].
The key to the mating process in heterothallic fungi is communication between cells of the opposite mating-type [29,49,50]. To investigate whether strain communications and interactions have potential influence on the expression patterns of circadian clock genes when different mating-type strains are co-cultured/crossed, we sought to assess the daily oscillations of clock genes and mating-type gene expression in the co-culture/crossed condition under the same culture conditions as the MAT1-1 and MAT1-2 strains. Remarkably, in contrast to the parental strains, circadian clock genes and mating type genes in the co-culture/crossed condition exhibited highly different but uniform expression patterns, characterized by a shared phase and coordinated fluctuations (Figure 4(A1–C2)). In addition, phenotypic observations revealed that the growth characteristics of the co-culture/crossed condition also differ significantly from either the MAT1-1 or MAT1-2 strains, which displayed only sporadically scattered conidia on their respective media, while the co-culture/crossed condition had the conidia clustered densely in the contacted region between MAT1-1 and MAT1-2 (Figure 1). These divergences suggest that potential direct or indirect interaction between the MAT1-1 and MAT1-2 regulatory systems reorganizes circadian control in the co-culture/crossed condition, thereby further coordinating reproductive processes. Although stronger conidiation was evident at the contact region, heterokaryon formation could not be directly validated. Accordingly, the disparate transcriptional patterns observed in co-cultures are tentatively attributed to interactions between distinct MAT strains instead of serving as direct proof of heterokaryon-exclusive circadian regulation.
Notably, MAT1-1-1, MAT1-1-10, and MAT1-1-11 displayed expression phases and fluctuation patterns nearly consistent with those of core circadian clock genes in both the MAT1-1 strain and the co-culture/crossed condition, suggesting that these mating-type genes may be associated, either directly or indirectly, with clock-related regulation in M. sextelata. Whereas expression oscillations of MAT1-2-1 reached statistical significance in the MAT1-2 strain but not in the co-culture/crossed condition, its expression dynamics also diverged from those of core circadian clock genes, suggesting that this mating-type gene might lack circadian-associated rhythmicity in M. sextelata. The circadian clock provides an endogenous signal to regulate conidiation on a daily basis in N. crassa [36,46,51]. Since the expression peaks of the MAT1-1-1, MAT1-1-10, and MAT1-1-11 genes in M. sextelata are roughly consistent with those of the core clock homologous genes, we hypothesize that these mating-type genes might be involved in conidial development.
Regarding RT-qPCR normalization, the stability of candidate reference genes, actin1, elongation factor 1-α and β-tubulin were compared using BestKeeper based on their raw Ct values, and all three candidates showed acceptable stability (SD < 1). Actin1 showed the lowest SD value and a high correlation with the BestKeeper index. Although elongation factor 1-α had a slightly higher correlation coefficient, actin1 exhibited lower Ct variation and a moderate expression level. Accordingly, actin1 was selected to normalize relative gene expression throughout the circadian time of M. sextelata, as this gene has been also adopted for circadian research on model fungi exemplified by Saccharomyces cerevisiae.

5. Conclusions

In summary, the present study demonstrates that the core circadian components are evolutionarily conserved in M. sextelata and exhibit distinct rhythmic expression patterns. These findings enrich the evolutionary framework of fungal chronobiology, and provide a new perspective for investigating the potential association between the circadian clock and mating-type regulation, thereby further advancing the current understanding of circadian regulatory mechanisms in fungi. Because stable and efficient genetic manipulation systems for Morchella species remain technically challenging, reverse genetics studies should be performed once such systems become available to elucidate the precise functions of core clock genes. Future studies should incorporate a larger number of strains with different mating types and their corresponding co-culture/crossed combinations to verify the relationship between circadian oscillations and mating type background. Moreover, manipulating circadian clock genes holds potential value for optimizing the growth and fruiting body production of Morchella. Further exploration of these strategies would benefit the efficient cultivation and industrial application of this important edible fungus in the food industry.

Author Contributions

Conceptualization, X.-H.D.; methodology, X.-H.D. and M.-Q.C.; software, M.-Q.C.; validation, M.-Q.C.; formal analysis, X.-H.D. and M.-Q.C.; investigation, M.-Q.C., J.-X.L. and J.L.; resources, X.-H.D.; data curation, M.-Q.C.; writing—original draft preparation, M.-Q.C.; writing—review and editing, X.-H.D. and M.-Q.C.; visualization, M.-Q.C.; supervision, X.-H.D.; project administration, X.-H.D.; funding acquisition, X.-H.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 32270023), the Natural Science Foundation of Chongqing (No. CSTB2022NSCQ-LZX0035), the Scientific and Technological Research Program of Chongqing Municipal Education Commission (No. KJQN202200562, No. KJQN202300503), and the Chongqing Germplasm Bank of Edible and Medicinal Macrofungi Program (No. WSWZZ2020001).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting the findings of this study are included within the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to acknowledge Xiaoqing Xin and Xin Liu for their assistance with culture and molecular experiments.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Lu, Q.; Yu, M.; Sun, X.; Zhou, X.; Zhang, R.; Zhang, Y.; Liu, X.L.; Li, Z.; Cai, L.; Liu, H.; et al. Circadian clock is critical for fungal pathogenesis by regulating zinc starvation response and secondary metabolism. Sci. Adv. 2025, 11, eads1341. [Google Scholar] [CrossRef] [PubMed]
  2. Larrondo, L.F. Circadian rhythms: Pervasive, and often times evasive. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2025, 380, 20230477. [Google Scholar] [CrossRef] [PubMed]
  3. Patke, A.; Young, M.W.; Axelrod, S. Molecular mechanisms and physiological importance of circadian rhythms. Nat. Rev. Mol. Cell Biol. 2020, 21, 67–84. [Google Scholar] [CrossRef] [PubMed]
  4. Zhou, Z.; Zhang, R.; Zhang, Y.; Xu, Y.; Wang, R.; Chen, S.; Lv, Y.; Chen, Y.; Ren, Y.; Luo, P.; et al. Circadian disruption in cancer hallmarks: Novel insight into the molecular mechanisms of tumorigenesis and cancer treatment. Cancer Lett. 2024, 604, 217273. [Google Scholar] [CrossRef]
  5. Hurley, J.M.; Loros, J.J.; Dunlap, J.C. Circadian oscillators: Around the transcription-translation feedback loop and on to output. Trends Biochem. Sci. 2016, 41, 834–846. [Google Scholar] [CrossRef]
  6. Cox, K.H.; Takahashi, J.S. Circadian clock genes and the transcriptional architecture of the clock mechanism. J. Mol. Endocrinol. 2019, 63, R93–R102. [Google Scholar] [CrossRef]
  7. Castillo, K.D.; Chapa, E.D.; Lamb, T.M.; Gangopadhyay, M.; Bell-Pedersen, D. Circadian clock control of tRNA synthetases in Neurospora crassa. F1000Researsh 2022, 11, 1556. [Google Scholar] [CrossRef]
  8. Lane, J.M.; Qian, J.; Mignot, E.; Redline, S.; Scheer, F.; Saxena, R. Genetics of circadian rhythms and sleep in human health and disease. Nat. Rev. Genet. 2023, 24, 4–20. [Google Scholar] [CrossRef]
  9. Bell-Pedersen, D.; Crosthwaite, S.K.; Lakin-Thomas, P.L.; Merrow, M.; Økland, M. The Neurospora circadian clock: Simple or complex? Philos. Trans. R. Soc. Lond. B Biol. Sci. 2001, 356, 1697–1709. [Google Scholar] [CrossRef][Green Version]
  10. Ma, H.; Li, L.; Yan, J.; Zhang, Y.; Ma, X.; Li, Y.; Yuan, Y.; Yang, X.; Yang, L.; Guo, J. The resonance and adaptation of Neurospora crassa circadian and conidiation rhythms to short light-dark cycles. J. Fungi 2021, 8, 27. [Google Scholar] [CrossRef]
  11. Heintzen, C.; Liu, Y. The Neurospora crassa circadian clock. Adv. Genet. 2007, 58, 25–66. [Google Scholar]
  12. Vitalini, M.W.; de Paula, R.M.; Park, W.D.; Bell-Pedersen, D. The rhythms of life: Circadian output pathways in Neurospora. J. Biol. Rhythm. 2006, 21, 432–444. [Google Scholar] [CrossRef] [PubMed]
  13. Fuller, K.K.; Hurley, J.M.; Loros, J.J.; Dunlap, J.C. 6 Photobiology and circadian clocks in Neurospora. In Fungal Genomics; Springer: Berlin/Heidelberg, Germany, 2024; pp. 121–148. [Google Scholar]
  14. Dunlap, J.C.; Borkovich, K.A.; Henn, M.R.; Turner, G.E.; Sachs, M.S.; Glass, N.L.; McCluskey, K.; Plamann, M.; Galagan, J.E.; Birren, B.W.; et al. Enabling a community to dissect an organism: Overview of the Neurospora functional genomics project. Adv. Genet. 2007, 57, 49–96. [Google Scholar]
  15. Chen, C.H.; Dunlap, J.C.; Loros, J.J. Neurospora illuminates fungal photoreception. Fungal Genet. Biol. 2010, 47, 922–929. [Google Scholar] [CrossRef]
  16. Loros, J.J.; Denome, S.A.; Dunlap, J.C. Molecular cloning of genes under control of the circadian clock in Neurospora. Science 1989, 243, 385–388. [Google Scholar] [CrossRef] [PubMed]
  17. Loros, J.J. Principles of the animal molecular clock learned from Neurospora. Eur. J. Neurosci. 2020, 51, 19–33. [Google Scholar] [CrossRef]
  18. Greene, A.V.; Keller, N.; Haas, H.; Bell-Pedersen, D. A circadian oscillator in Aspergillus spp. regulates daily development and gene expression. Eukaryot. Cell. 2003, 2, 231–237. [Google Scholar] [CrossRef] [PubMed]
  19. Lombardi, L.M.; Brody, S. Circadian rhythms in Neurospora crassa: Clock gene homologues in fungi. Fungal Genet. Biol. 2005, 42, 887–892. [Google Scholar] [CrossRef]
  20. Blackwell, M. The fungi: 1, 2, 3 … 5.1 million species? Am. J. Bot. 2011, 98, 426–438. [Google Scholar] [CrossRef]
  21. Lewis, M.T.; Feldman, J.F. Evolution of the frequency (frq) clock locus in Ascomycete fungi. Mol. Biol. Evol. 1996, 13, 1233–1241. [Google Scholar] [CrossRef]
  22. Dunlap, J.C.; Loros, J.J. How fungi keep time: Circadian system in Neurospora and other fungi. Curr. Opin. Microbiol. 2006, 9, 579–587. [Google Scholar] [CrossRef]
  23. Lewis, M.T.; Morgan, L.W.; Feldman, J.F. Analysis of frequency (frq) clock gene homologs: Evidence for a helix-turn-helix transcription factor. Mol. Gen. Genet. 1997, 253, 401–414. [Google Scholar] [CrossRef] [PubMed]
  24. Du, X.H.; Yang, Z.L. Mating systems in true morels (Morchella). Microbiol. Mol. Biol. Rev. 2021, 85, e0022020. [Google Scholar] [CrossRef]
  25. Yue, Y.; Hao, H.; Wang, Q.; Xiao, T.; Zhang, Y.; Chen, Q.; Chen, H.; Zhang, J. Dynamics of the soil microbial community associated with Morchella cultivation: Diversity, assembly mechanism and yield prediction. Front. Microbiol. 2024, 15, 1345231. [Google Scholar] [CrossRef] [PubMed]
  26. Bonito, G.; Miyauchi, S.; Hayes, R.D.; Tan, H.; Kuo, A.; Robinson, A.; Wang, X.; Van Wyk, J.; Kohler, A.; Fauchery, L.; et al. Pangeneric analyses reveal the divergent genome evolution and ecologies between morels and truffles in the Morchellaceae. Curr. Biol. 2025, 35, 4135–4150.e4136. [Google Scholar] [CrossRef]
  27. Liu, W.; He, P.; Shi, X.; Zhang, Y.; Perez-Moreno, J.; Yu, F. Large-scale field cultivation of Morchella and relevance of basic knowledge for its steady production. J. Fungi 2023, 9, 855. [Google Scholar] [CrossRef] [PubMed]
  28. Kim, H.; Borkovich, K.A. Pheromones are essential for male fertility and sufficient to direct chemotropic polarized growth of trichogynes during mating in Neurospora crassa. Eukaryot. Cell. 2006, 5, 544–554. [Google Scholar] [CrossRef]
  29. Bobrowicz, P.; Pawlak, R.; Correa, A.; Bell-Pedersen, D.; Ebbole, D.J. The Neurospora crassa pheromone precursor genes are regulated by the mating type locus and the circadian clock. Mol. Microbiol. 2002, 45, 795–804. [Google Scholar] [CrossRef]
  30. Bell-Pedersen, D.; Garceau, N.Y.; Loros, J.J. Circadian rhythms in fungi. J. Genet. 1996, 75, 387–401. [Google Scholar] [CrossRef]
  31. Zhu, H.; Nowrousian, M.; Kupfer, D.; Colot, H.V.; Berrocal-Tito, G.; Lai, H.; Bell-Pedersen, D.; Roe, B.A.; Loros, J.J.; Dunlap, J.C. Analysis of expressed sequence tags from two starvation, time-of-day-specific libraries of Neurospora crassa reveals novel clock-controlled genes. Genetics 2001, 157, 1057–1065. [Google Scholar] [CrossRef]
  32. Lee, S.J.; Kong, M.; Harrison, P.; Hijri, M. Conserved proteins of the RNA interference system in the arbuscular mycorrhizal fungus Rhizoglomus irregulare provide new insight into the evolutionary history of Glomeromycota. Genome Biol. Evol. 2018, 10, 328–343. [Google Scholar] [CrossRef]
  33. Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-blast: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
  34. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  35. Zhang, Q.; Liu, W.; Cai, Y.; Lan, A.F.; Bian, Y. Validation of internal control genes for quantitative real-time pcr gene expression analysis in Morchella. Molecules 2018, 23, 2331. [Google Scholar] [CrossRef]
  36. Dunlap, J.C. Molecular bases for circadian clocks. Cell 1999, 96, 271–290. [Google Scholar] [CrossRef] [PubMed]
  37. Dunlap, J.C.; Loros, J.J. The Neurospora circadian system. J. Biol. Rhythm. 2004, 19, 414–424. [Google Scholar] [CrossRef]
  38. Xu, Y.; Tang, J.; Wang, Y.; He, X.; Tan, H.; Yu, Y.; Chen, Y.; Peng, W. Large-scale commercial cultivation of morels: Current state and perspectives. Appl. Microbiol. Biotechnol. 2022, 106, 4401–4412. [Google Scholar] [CrossRef]
  39. Dunlap, J.C.; Loros, J.J. Making time: Conservation of biological clocks from fungi to animals. Microbiol. Spectr. 2017, 5, 10-1128. [Google Scholar] [CrossRef] [PubMed]
  40. Akman, O.E.; Rand, D.A.; Brown, P.E.; Millar, A.J. Robustness from flexibility in the fungal circadian clock. BMC Syst. Biol. 2010, 4, 88. [Google Scholar] [CrossRef]
  41. Salichos, L.; Rokas, A. The diversity and evolution of circadian clock proteins in fungi. Mycologia 2010, 102, 269–278. [Google Scholar] [CrossRef]
  42. Costa, J.I.; Muñoz-Guzmán, F.; Larrondo, L.F. Clock regulation and fungal physiology: Molecular mechanisms underpinning the timely control of just about everything. Annu. Rev. Microbiol. 2025, 79, 191–214. [Google Scholar] [CrossRef]
  43. Liu, Y.; Bell-Pedersen, D. Circadian rhythms in Neurospora crassa and other filamentous fungi. Eukaryot. Cell 2006, 5, 1184–1193. [Google Scholar] [CrossRef]
  44. Lakin-Thomas, P.L.; Bell-Pedersen, D.; Brody, S. The genetics of circadian rhythms in Neurospora. Adv. Genet. 2011, 74, 55–103. [Google Scholar]
  45. Hurley, J.M.; Dasgupta, A.; Emerson, J.M.; Zhou, X.; Ringelberg, C.S.; Knabe, N.; Lipzen, A.M.; Lindquist, E.A.; Daum, C.G.; Barry, K.W.; et al. Analysis of clock-regulated genes in Neurospora reveals widespread posttranscriptional control of metabolic potential. Proc. Natl. Acad. Sci. USA 2014, 111, 16995–17002. [Google Scholar] [CrossRef]
  46. Loros, J.J.; Dunlap, J.C. Genetic and molecular analysis of circadian rhythms in Neurospora. Annu. Rev. Physiol. 2001, 63, 757–794. [Google Scholar] [CrossRef]
  47. Zhang, R.; Lahens, N.F.; Ballance, H.I.; Hughes, M.E.; Hogenesch, J.B. A circadian gene expression atlas in mammals: Implications for biology and medicine. Proc. Natl. Acad. Sci. USA 2014, 111, 16219–16224. [Google Scholar] [CrossRef] [PubMed]
  48. Bell-Pedersen, D.; Cassone, V.M.; Earnest, D.J.; Golden, S.S.; Hardin, P.E.; Thomas, T.L.; Zoran, M.J. Circadian rhythms from multiple oscillators: Lessons from diverse organisms. Nat. Rev. Genet. 2005, 6, 544–556. [Google Scholar] [CrossRef]
  49. Glass, N.L.; Rasmussen, C.; Roca, M.G.; Read, N.D. Hyphal homing, fusion and mycelial interconnectedness. Trends Microbiol. 2004, 12, 135–141. [Google Scholar] [CrossRef] [PubMed]
  50. Gonçalves, A.P.; Heller, J.; Rico-Ramírez, A.M.; Daskalov, A.; Rosenfield, G.; Glass, N.L. Conflict, competition, and cooperation regulate social interactions in filamentous fungi. Annu. Rev. Microbiol. 2020, 74, 693–712. [Google Scholar] [CrossRef]
  51. Bell-Pedersen, D.; Lewis, Z.A.; Loros, J.J.; Dunlap, J.C. The Neurospora circadian clock regulates a transcription factor that controls rhythmic expression of the output eas (ccg-2) gene. Mol. Microbiol. 2001, 41, 897–909. [Google Scholar] [CrossRef] [PubMed]
Jof 12 00404 g001
Figure 1. Colony morphology of the MAT1-1 (A), MAT1-2 (B) and MAT1-1 × MAT1-2 co-culture/crossed condition (C) strains of Morchella sextelata sampled for assessing rhythmic oscillations in gene expression of seven clock homologous genes and four mating-type genes.
Figure 1. Colony morphology of the MAT1-1 (A), MAT1-2 (B) and MAT1-1 × MAT1-2 co-culture/crossed condition (C) strains of Morchella sextelata sampled for assessing rhythmic oscillations in gene expression of seven clock homologous genes and four mating-type genes.
Jof 12 00404 g001
Jof 12 00404 g002
Figure 2. Rhythmical oscillations in gene expression of seven clock homologous genes (frh, frq, fwd-1, wc-1, wc-2, ccg-8 and ccg-9) of M. sextelata in its MAT1-1 (A), MAT1-2 (B) and MAT1-1 × MAT1-2 co-culture/crossed condition (C) strains. Total RNA was isolated from each strain and harvested every 3 h for one day (x-axis). The expression levels of the seven homologous genes were quantified using the expression of the housekeeping actin1 as a reference (y-axis). Each dot represents the mean of three biological replicates. Note that the transcript profiles of seven homologous genes oscillate in generally similar patterns in each strain, but are totally different among the three strains, reaching peak levels at different timepoints. Zeitgeber time (ZT) is depicted. frh: frequency-interacting RNA helicase; frq: frequency; wc: white collar; ccg: clock-controlled gene. Statistical significance was assessed by one-way ANOVA (*: p < 0.05; **: p < 0.01; ***: p < 0.001; ns = not significant).
Figure 2. Rhythmical oscillations in gene expression of seven clock homologous genes (frh, frq, fwd-1, wc-1, wc-2, ccg-8 and ccg-9) of M. sextelata in its MAT1-1 (A), MAT1-2 (B) and MAT1-1 × MAT1-2 co-culture/crossed condition (C) strains. Total RNA was isolated from each strain and harvested every 3 h for one day (x-axis). The expression levels of the seven homologous genes were quantified using the expression of the housekeeping actin1 as a reference (y-axis). Each dot represents the mean of three biological replicates. Note that the transcript profiles of seven homologous genes oscillate in generally similar patterns in each strain, but are totally different among the three strains, reaching peak levels at different timepoints. Zeitgeber time (ZT) is depicted. frh: frequency-interacting RNA helicase; frq: frequency; wc: white collar; ccg: clock-controlled gene. Statistical significance was assessed by one-way ANOVA (*: p < 0.05; **: p < 0.01; ***: p < 0.001; ns = not significant).
Jof 12 00404 g002
Jof 12 00404 g003
Figure 3. Rhythmical oscillations in gene expression of four mating-type genes (MAT1-1-1, MAT1-2-1, MAT1-1-10 and MAT1-1-11) of M. sextelata in its MAT1-1 (A), MAT1-2 (B) and MAT1-1 × MAT1-2 co-culture/crossed condition (C) strains. Total RNA was isolated from each strain and harvested every 3 h for one day (x-axis). The expression levels of the four mating-type genes were quantified using the expression of the housekeeping actin1 as a reference (y-axis). Each dot represents the mean of three biological replicates. Note that the transcript profiles of the four mating-type genes (except MAT1-2-1) oscillate in generally similar patterns in each strain, but are totally different among the three strains, reaching peak levels at different timepoints. Zeitgeber time (ZT) is depicted. Statistical significance was assessed by one-way ANOVA (*: p < 0.05; **: p < 0.01; ***: p < 0.001; ns = not significant).
Figure 3. Rhythmical oscillations in gene expression of four mating-type genes (MAT1-1-1, MAT1-2-1, MAT1-1-10 and MAT1-1-11) of M. sextelata in its MAT1-1 (A), MAT1-2 (B) and MAT1-1 × MAT1-2 co-culture/crossed condition (C) strains. Total RNA was isolated from each strain and harvested every 3 h for one day (x-axis). The expression levels of the four mating-type genes were quantified using the expression of the housekeeping actin1 as a reference (y-axis). Each dot represents the mean of three biological replicates. Note that the transcript profiles of the four mating-type genes (except MAT1-2-1) oscillate in generally similar patterns in each strain, but are totally different among the three strains, reaching peak levels at different timepoints. Zeitgeber time (ZT) is depicted. Statistical significance was assessed by one-way ANOVA (*: p < 0.05; **: p < 0.01; ***: p < 0.001; ns = not significant).
Jof 12 00404 g003
Jof 12 00404 g004
Figure 4. Comparison of rhythmic oscillations of gene expression between seven clock homologous genes (frh, frq, fwd-1, wc-1, wc-2, ccg-8 and ccg-9) and four mating-type genes (MAT1-1-1, MAT1-2-1, MAT1-1-10 and MAT1-1-11) of M. sextelata in its MAT1-1 ((A1), all genes; (A2), significant genes), MAT1-2 ((B1), all genes; (B2), significant genes) and MAT1-1 × MAT1-2 co-culture/crossed condition ((C1), all genes; (C2), significant genes). Total RNA was isolated from each strain and harvested every 3 h for one day (x-axis). The expression levels of the seven homologous genes and four mating-type genes were quantified using the expression of the housekeeping act1 as a reference (y-axis). Each dot represents the mean of three biological replicates. Note that the transcript profiles of eleven genes oscillate in generally similar patterns in each strain, except MAT1-2-1 and MAT1-1-11 in the MAT1-1 × MAT1-2 co-culture/crossed condition, but are totally different among the three strains, reaching peak levels at different timepoints. Zeitgeber time (ZT) is depicted. frh: frequency-interacting RNA helicase; frq: frequency; wc: white collar; ccg: clock-controlled gene. Statistical significance was assessed by one-way ANOVA (*: p < 0.05; **: p < 0.01; ***: p < 0.001; ns = not significant).
Figure 4. Comparison of rhythmic oscillations of gene expression between seven clock homologous genes (frh, frq, fwd-1, wc-1, wc-2, ccg-8 and ccg-9) and four mating-type genes (MAT1-1-1, MAT1-2-1, MAT1-1-10 and MAT1-1-11) of M. sextelata in its MAT1-1 ((A1), all genes; (A2), significant genes), MAT1-2 ((B1), all genes; (B2), significant genes) and MAT1-1 × MAT1-2 co-culture/crossed condition ((C1), all genes; (C2), significant genes). Total RNA was isolated from each strain and harvested every 3 h for one day (x-axis). The expression levels of the seven homologous genes and four mating-type genes were quantified using the expression of the housekeeping act1 as a reference (y-axis). Each dot represents the mean of three biological replicates. Note that the transcript profiles of eleven genes oscillate in generally similar patterns in each strain, except MAT1-2-1 and MAT1-1-11 in the MAT1-1 × MAT1-2 co-culture/crossed condition, but are totally different among the three strains, reaching peak levels at different timepoints. Zeitgeber time (ZT) is depicted. frh: frequency-interacting RNA helicase; frq: frequency; wc: white collar; ccg: clock-controlled gene. Statistical significance was assessed by one-way ANOVA (*: p < 0.05; **: p < 0.01; ***: p < 0.001; ns = not significant).
Jof 12 00404 g004
Table 1. Gene homology comparison in M. sextelata using BLASTX searches based on 17 circadian clock genes identified from N. crassa, A. chevalieri, A. melleus and Lachnellula hyalina. “/” means the gene is unmatched in the genome of M. sextelata. E value, identity and coverage were used to evaluate sequence similarity between M. sextelata candidates and the corresponding query proteins. Putative homologs were selected using E value < 1 × 10−10, identity > 30%, and coverage ≥ 25% as the main criteria. Seven finally chosen homologous genes used in this study for assessing rhythmic oscillations in M. sextelata are indicated in bold.
Table 1. Gene homology comparison in M. sextelata using BLASTX searches based on 17 circadian clock genes identified from N. crassa, A. chevalieri, A. melleus and Lachnellula hyalina. “/” means the gene is unmatched in the genome of M. sextelata. E value, identity and coverage were used to evaluate sequence similarity between M. sextelata candidates and the corresponding query proteins. Putative homologs were selected using E value < 1 × 10−10, identity > 30%, and coverage ≥ 25% as the main criteria. Seven finally chosen homologous genes used in this study for assessing rhythmic oscillations in M. sextelata are indicated in bold.
Gene IDGene NameAccession NumberSpeciesE ValueIdentity
(%)		Coverage
(%)
H6S33_001260frhNC_026502.1Neurospora crassa061.0472
H6S33_012933frqNC_026507.1N. crassa4 × 10−2530.8536
H6S33_010463fwd-1NC_026507.1N. crassa4 × 10−9354.2825
H6S33_012964wc-1NC_057368.1Aspergillus chevalieri2 × 10−15045.2164
H6S33_003590wc-2NW_025763372.1A. mellus6 × 10−3138.2657
H6S33_003804ccg-8NW_022157136.1Lachnellula hyalina2 × 10−7038.7473
H6S33_008721ccg-9NC_026507.1N. crassa5 × 10−16342.6244
H6S33_008775ccg-15NC_026505.1N. crassa1 × 10−4333.3324
H6S33_005012ccg-16NC_026506.1N. crassa6 × 10−1351.7221
H6S33_009409ccg-14NC_026505.1N. crassa2 × 10−305012
/ccg-1NC_026505.1N. crassa///
/ccg-4NW_022157138.1L. hyalina///
/ccg-6NC_026505.1N. crassa///
/ccg-13NC_026505.1N. crassa///
/mfa-1NC_026505.1N. crassa///
/pre-1NC_026503.1N. crassa///
/pre-2NC_026507.1N. crassa///
Table 2. Primers used for amplifying the reference gene, seven clock homologous genes and four mating-type genes by RT-qPCR, along with their corresponding product sizes.
Table 2. Primers used for amplifying the reference gene, seven clock homologous genes and four mating-type genes by RT-qPCR, along with their corresponding product sizes.
Gene IDGene NamePrimer Sequence (5′→3′)Amplicon Size (bp)
Reference geneactin1Forward: GTACCCTGGTATTGCCGACC197
Reverse: GGACGATGGAAGGACCACTC
H6S33_001260frhForward: TCCTTTGCACAACTCTCCAC174
Reverse: GCGATGAATCCAAGACGTCT
H6S33_012933frqForward: AACACACATACCACCACACC150
Reverse: CCGTGATGTGTAGGTTGAGG
H6S33_010463fwd-1Forward: TCTGGAATCGAGAGCAGCTA147
Reverse: AGGTTGCTTGCTGGTTGTTA
H6S33_012964wc-1Forward: AGCGACATTGTACCGGTTAC192
Reverse: CAACTTGTAAACCGGCCTCT
H6S33_003590wc-2Forward: GGAACATCAGCAACAACAGC161
Reverse: GTGTAGGTTTTGCAGGTGGA
H6S33_003804ccg-8Forward: ATATGATGCAGCAGGTGAGC166
Reverse: TCCTCCAACCCCTCAAATCT
H6S33_008721ccg-9Forward: CTTCTGCGTACACACTCTCC178
Reverse: GCTCCATAGAAACGAAGGCA
NA *MAT1-1-1Forward: CCCACCTTCTGAGTCCGT143
Reverse: GAACCCAGATTCCACCGC
H6S33_000236 *MAT1-2-1Forward: GCCAGAAATACCCGGGGAT135
Reverse: GCTTTACGTGGTGCTCTCG
NA *MAT1-1-10Forward: CGATGAGCTTGGGGATGC137
Reverse: GATGCAGACACCCTTGGG
NA *MAT1-1-11Forward: CGTTAGATGAGGCGACGC107
Reverse: CTCAACCTGTCGTGCTGC
* NA: not available. The online genome (GenBank accession number: GCA_020137385.1) of the M. sextelata strain contains only MAT1-2-1. The sequences of MAT1-1-1, MAT1-1-10, and MAT1-1-11 were obtained via PCR amplication.
Table 3. BestKeeper-based stability analysis of candidate reference genes for RT-qPCR normalization.
Table 3. BestKeeper-based stability analysis of candidate reference genes for RT-qPCR normalization.
Candidate Reference GeneMean CtSDCV (%)Correlation with BestKeeper Index (r)Stability Ranking/Decision
Actin122.690.803.520.925Lowest SD; selected as internal reference
Elongation factor 1-α21.640.884.080.926Stable, but not selected
β-tubulin29.070.893.050.846Stable, but relatively low expression and lower correlation
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, M.-Q.; Liu, J.-X.; Ling, J.; Du, X.-H. Identification of Circadian Clock Homologs and Their Rhythmic Expression Differences Among Mating-Type Strains in Morchella sextelata. J. Fungi 2026, 12, 404. https://doi.org/10.3390/jof12060404

AMA Style

Chen M-Q, Liu J-X, Ling J, Du X-H. Identification of Circadian Clock Homologs and Their Rhythmic Expression Differences Among Mating-Type Strains in Morchella sextelata. Journal of Fungi. 2026; 12(6):404. https://doi.org/10.3390/jof12060404

Chicago/Turabian Style

Chen, Meng-Qian, Jun-Xi Liu, Jia Ling, and Xi-Hui Du. 2026. "Identification of Circadian Clock Homologs and Their Rhythmic Expression Differences Among Mating-Type Strains in Morchella sextelata" Journal of Fungi 12, no. 6: 404. https://doi.org/10.3390/jof12060404

APA Style

Chen, M.-Q., Liu, J.-X., Ling, J., & Du, X.-H. (2026). Identification of Circadian Clock Homologs and Their Rhythmic Expression Differences Among Mating-Type Strains in Morchella sextelata. Journal of Fungi, 12(6), 404. https://doi.org/10.3390/jof12060404

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop