Next Article in Journal
Lipid Metabolism and Membrane Remodeling Drive Sclerotium Formation in Morchella eximia: Insights from Integrated Transcriptomics and Metabolomics
Previous Article in Journal
Development of Experimental Techniques to Study Blueberry Rust (Pucciniastrum minimum) Urediniospore Survival
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 12
Issue 2
10.3390/jof12020132
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

An Efficient and Stable PEG-Mediated Transformation System for Medicinal Fungus Ophiocordyceps xuefengensis: Optimization and Functional Validation

by
Xiaoting Feng
1,
Xinyao Sheng
1,
Jun Liu
1,2,
Rongrong Zhou
1,
Zhongxu Yang
1,
Xiaojuan Tang
1 and
Shuihan Zhang
1,*
1
Hunan Academy of Traditional Chinese Medicine, Changsha 410013, China
2
School of Food Science and Bioengineering, Changsha University of Science & Technology, Changsha 410005, China
*
Author to whom correspondence should be addressed.
J. Fungi 2026, 12(2), 132; https://doi.org/10.3390/jof12020132
Submission received: 9 January 2026 / Revised: 7 February 2026 / Accepted: 10 February 2026 / Published: 12 February 2026
(This article belongs to the Section Fungal Genomics, Genetics and Molecular Biology)
Browse Figures
Versions Notes

Abstract

Ophiocordyceps xuefengensis is an important medicinal fungus with considerable pharmaceutical and economic value. However, its industrial and scientific utilization has been severely limited by the lack of an efficient genetic transformation system, largely due to limited genomic information and wild growth. In this study, we established an efficient and stable plasmid transformation system within O. xuefengensis protoplasts mediated by PEG. To overcome low protoplast yield and transformation efficiency, key factors influencing protoplast preparation including enzyme composition and concentration, fungal age, and digestion conditions were systematically optimized. The optimal protocol involved digesting 4-day-old mycelia with a mixture of 1.5% lywallzyme 1 and 1.5% snailase at 34 °C and 130 rpm for 3.5 h, yielding at least 9.42 × 107 CFU/mL protoplasts. Protoplast regeneration was significantly enhanced in PY medium supplemented with 0.6 M mannitol. Under these optimized conditions, a transformation efficiency of 45.5% was achieved, with stable plasmid integration confirmed over four successive generations. Furthermore, the transformation system was successfully applied to functional gene characterization by driving exogenous gene expression using the endogenous gpd1 promoter. This study provides a foundational platform for functional gene analysis and paves the way for further elucidation of growth and development mechanisms and metabolic engineering in O. xuefengensis.

1. Introduction

Ophiocordyceps xuefengensis (O. xuefengensis), the sister taxon of Ophiocordyceps sinensis (O. sinensis), is a traditional Chinese medicinal fungus of significant medicinal and economic importance [1]. It is classified as an insect-derived medicinal fungi and forms fruiting body by infecting the larvae of Phassus nodus (Hepialidae) insects [2]. O. xuefengensis is endemic to the Xuefeng Mountains of Hunan Province, China, and has been designated as a nationally protected medicinal fungus species. O. xuefengensis contains various bioactive compounds, including cordycepin, adenosine, polysaccharides, nucleotides, amino acids, and fatty acids [3,4]. Previous studies have demonstrated the O. xuefengensis exhibit diverse pharmacological activities, such as antitumor antibacterial, antiviral properties and antioxidant activities [5,6]. However, genetic study of O. xuefengensis remain technically challenging. To date, a chromosome-level genome assembly for this species has not been completed, and spore acquisition remains limited, which hinders in-depth molecular investigation and utilization of this valuable medicinal fungus. Therefore, the development an efficient genetic transformation system for O. xuefengensis remains an essential research priority.
O. xuefengensis is an ascomycete fungus. Currently, several major methods are employed for genetic transformation in ascomycete fungi, including electroporation, gene gun, Agrobacterium-mediated transformation, and polyethylene glycol (PEG)-mediated protoplast transformation. Among these approaches, electroporation is mainly applicable to fungal spores; however, this process frequently results in DNA damage, and the limited spore production of O. xuefengensis on artificial media restricts its applicability [7]. Gene gun transformation causes substantial damage to target tissues, exhibits limited penetration depth, and often results in random gene integration, rendering it unsuitable for most fungi [8]. Agrobacterium-mediated transformation is relatively stable and efficient but is labor-intensive, time-consuming, exhibits strong genotype dependence, and generally shows low transformation efficiency in ascomycete fungi [9,10,11]. In contrast, PEG-mediated protoplast transformation offers several advantages, including minimal equipment requirements, procedural simplicity, relatively high transformation efficiency, and stable inheritance of exogenous genes [12,13,14,15]. To date, this method has been successfully applied in several ascomycete species, including Cordyceps javanica [16], Cordyceps militaris [17], Aspergillus nidulans [18], and Auricularia cornea [19], suggesting its potential suitability for the genetic manipulation of O. xuefengensis.
PEG-mediated protoplast transformation primarily depends on the enzymatic removal of the rigid fungal cell wall under optimized digestion conditions to generate protoplasts [20,21]. The composition of fungal cell walls varies significantly among different species; therefore, the selection of appropriate hydrolytic enzymes is critical for obtaining high-quality protoplasts in protoplast-mediated transformation studies [22,23]. Furthermore, transformation conditions significantly affect DNA delivery efficiency, while the resuscitation and regeneration capacity of protoplasts directly determines the yield of transformants [24,25]. However, an efficient PEG-mediated genetic transformation protocol has not yet been developed for O. xuefengensis, as effective transformation methods must be tailored to the specific biological characteristics of individual fungal species. This limitation has impeded research on gene function, physiological and biochemical processes, and the molecular mechanisms underlying fruiting body development in O. xuefengensis.
In ascomycetes, genetic transformation serves as a fundamental tool for functional studies, including gene expression analysis [26,27]. Strong promoters are routinely employed to drive high-level expression of heterologous genes in fungal transformation systems [28]. In many cases, homologous promoters are preferred due to their enhanced compatibility with native RNA polymerase and transcription factors, resulting in more efficient transcription initiation. For instance, in Ganoderma lucidum, a homologous promoter has demonstrated significantly higher transcriptional initiation efficiency than the heterologous small GTPase promoter Pras derived from Lentius. edodes [29].
In this study, we established an efficient and stable PEG-mediated plasmid transformation system for O. xuefengensis, which has not previously been reported for this species. By systematically optimizing protoplast preparation and regeneration conditions, we achieved a high yield of protoplasts, thereby overcoming the cell wall–related limitations of O. xuefengensis. We further evaluated the transformation efficiency and stability of the established system. In addition, this system was applied to evaluate the heterologous expression capacity of the pCAMBIA1300-CBHI plasmid in O. xuefengensis protoplasts. This work provides a crucial technical platform for future gene functional analysis and metabolic engineering studies in this medicinal fungus.

2. Materials and Methods

2.1. O. xuefengensis Strain and Reagents

O. xuefengensis strain HACM001 was preserved at the Institute of Chinese Medicine Resources, Hunan Academy of Traditional Chinese Medicine, Changsha, China [2]. The strain HACM001 was initially activated on PDA medium at 28 °C in the dark for 10–14 days.
The main reagents included PDA (Solarbio, Beijing, China), mannitol (Solarbio, Beijing, China), lywallzyme 1 (specific activity ≥ 200 U/mg, Solarbio, Beijing, China), lywallzyme 2 (specific activity ≥ 200 U/mg, Guangdong Institute of Microbiology, Guangzhou, China), lyticase (specific activity ≥ 200 U/mg, Sigma, St. Louis, MO, USA), snailase (Solarbio, Beijing, China), hygromycin B (50 mg/mL, VWR, Radnor, PA, USA), DNA polymerase (Vazyme, Nanjing, China), one-step cloning kit (Vazyme, Nanjing, China). The other reagents were purchased from Sinopharm Chemical Reagent Co., Ltd., Shanghai, China.

2.2. Preparation of Protoplasts from O. xuefengensis

A mycelial plug (0.5 × 0.5 cm) was aseptically excised from the solid PDA medium using a flame-sterilized scalpel and transferred to 50 mL of PY liquid medium containing 15.0 g/L glucose, 5.0 g/L peptone, 2.0 g/L yeast extract powder, 1.0 g/L KH2PO4, 0.5 g/L MgSO4·7H2O [30]. The culture was incubated at 25 °C with shaking at 130 rpm in the dark. After incubation, mycelia were harvested by filtration through sterile gauze. The mycelia were thoroughly washed three times with S1 buffer solution (0.8 M mannitol, pH 4.5) and filtered again. Next, 0.5 g of mycelia were gently mixed with 5 mL of the enzymatic lysis solution incubated at 30 °C. After incubation, the protoplast suspension was filtered through four-layer filter paper and collected by centrifugation at 4 °C, 4200 rpm for 10 min. The pellet was rinsed twice in 10 mL of S2 buffer solution (0.6 M mannitol, 10 mM Tris-HCl pH 7.5, 25 mM CaCl2), and centrifuged (4 °C, 4000 rpm, 10 min). Finally, the protoplast pellets were resuspended in ice-cold S2 buffer, stored at ice, and counted using a hemocytometer [31].

2.3. Optimization of Protoplast Preparation from O. xuefengensis

The optimization of protoplast preparation was conducted under different enzymatic systems, fungal age, and digestion conditions as described by Qi, et al. [21] with minor modifications. Firstly, six enzymatic lysis solutions combinations were tested: 1.5% lywallzyme 1; 1.5% lywallzyme 2; 50 U lyticase; a combination of 0.75% lywallzyme 1 and 0.75% snailase; a combination of 0.75% lywallzyme 2 and 0.75% snailase, and a combination of 25 U lyticase and 0.75% snailase. Subsequently, the concentration of the selected optimal combination was further tested at 0.75%, 1%, 1.25%, and 1.5%. Furthermore, O. xuefengensis mycelia samples were harvested at different culture ages (4, 5, 6, and 7 days) and subjected to protoplast preparation. Finaly, the enzymatic digestion parameters were investigated by varying the digestion time (2, 2.5, 3, 3.5, and 4 h), temperature (28, 30, 32, and 34 °C), and agitation speed (0, 50, 100, 130, and 150 rpm), following the protocol described in Section 2.2. In all experiments, the protoplast yields were quantified using a hemocytometer to determine the optimal preparation conditions.

2.4. Regeneration Medium Screening of O. xuefengensis Protoplasts

Three culture mediums (PPDA, PPY, TB3) were evaluated for protoplast regeneration. The O. xuefengensis protoplasts were diluted to 1 × 107 CFU/mL using S2 buffer. A 200 μL aliquot of the protoplast suspension was mixed with 5 mL of PPDA/PPY/TB3 liquid medium. The mixture was incubated at 28 °C overnight for recovery activity. After centrifugation (4000 rpm, 5 min), the pellet was resuspended in 400–600 μL of the corresponding liquid medium, respectively. The recovered protoplast solutions were mixed with the PPDA/PPY/TB3 low-melting-point to prepare the agar plates. The plates were incubated at 28 °C in the dark for 6–7 days to assess protoplasts regeneration efficiency. PPDA medium containing 0.6 M mannitol, 20 g/L glucose, 10 g/L peptone, 1 g/L KH2PO4, 0.5 g/L MgSO4·7H2O, 0.02 g/L vitamin B1. PPY regeneration mediums were prepared by supplementing 0.6 M mannitol in PY medium. TB3 liquid medium containing 0.6 M mannitol, 3.0 g/L acid casein hydrolysate, 3.0 g/L yeast extract powder, and 20.0 g/L sucrose.

2.5. Selection Pressure Determination of O. xuefengensis to Hygromycin B

Hygromycin B serves as an ideal screening reagent due to its high selection efficiency and low genotype differences [32]. Briefly, PDA medium supplemented with hygromycin B at six concentrations (100, 200, 300, 400, 500, and 600 μg/mL) were prepared. Mycelial plugs (7 mm diameter) were excised from 14-day-old solid PDA cultures of O. xuefengensis strain HACM001 using a sterile disposable punch. Each plug was placed onto hygromycin B-amended PDA plates with the mycelial surface facing upward. A control group (without hygromycin B) was included in parallel. All petri dishes were incubated in the dark at 28 °C for 14 days. The sensitivity of O. xuefengensis strain HACM001 to hygromycin B was evaluated by observing the diameter of the colonies.

2.6. The PEG-Mediated Transformation of O. xuefengensis Protoplast

A 200 μL aliquot of protoplast suspension was transferred to a sterile 50 mL centrifuge tube and gently mixed with 6 μg of the linearized plasmid pCAMBIA1300 carring hygromycin B resistance (hygR) gene [33]. The mixture was incubated on ice for 5 min. Subsequently, 50 μL of S3 buffer (25% PEG 4000, 10 mM Tirs-HCl pH 7.5, 25 mM CaCl2) was added dropwise to the mixture with gentle agitation. After an additional 30 min of incubation on ice, 1 mL of S3 buffer was carefully introduced along the inner wall of the tube, followed by incubation at room temperature for 5 min. The mixture was then added to 5 mL of liquid PPY regeneration medium and incubated overnight at 28 °C with shaking at 130 rpm. After centrifugation, the pellet was resuspended in PPY liquid medium and transferred to 30 mL of molten PPY low-melting-point medium containing 600 μg/mL hygromycin B for plate pouring. The plates were incubated in the dark at 28 °C for 6–7 days. Putative transformants that appeared after four rounds of screening in antibiotic-containing medium were considered positive transformants.

2.7. Transformants Verification

The genomic DNA extracted from both wild-type O. xuefengensis and transformant strains was used as a template for PCR amplification with the primer pair (PF1: CTTATATGCTCAACACATGAGCG; PR1: ATCTCCACTGACGTAAGGGATGAC). The amplification products were then analyzed by agarose gel electrophoresis to determine their molecular weights.

2.8. Construction of the CBHI Recombinant Plasmid and Transformation

Cellobiohydrolase (CBH) is the main cellulase for lignocellulose degradation. The cbhI gene fragment (PDE_07945) and Ttrpc terminator gene fragment were amplified from penicillium oxalicum 114 and Aspergillus niger, respectively, using high-fidelity DNA polymerase [12,34]. To enhance intracellular heterologous gene expression, the endogenous gpd1 promoter (POxgpd1) from O. xuefengensis was cloned. These three fragments were subcloned into pCAMBIA1300 vector backbone to construct the recombinant plasmid pCAMBIA1300-CBHI using one-step cloning kit. The recombinant plasmid was subsequently transformed into O. xuefengensis host cells.

2.9. CBHI Validation, Purification and Enzyme Activity Assays

The single well-growing recombinant O. xuefengensis-CBHI transformants were randomly selected from PPY medium containing 600 μg/mL hygromycin B. They were transferred to fresh PY medium containing the same antibiotic concentration and cultured in the dark at 28 °C for 7 days. Mycelial samples were then harvested for genomic DNA extraction. The extracted DNA was used as a template for target gene amplification, following the experimental procedures outlined in Section 2.7 with the primer pair (PF2: GGTGGCTACCTGAGCAGGGA; PR2: ACGGCTGCACTGAACGTCAG).
For CBHI production, two positive transformants were cultured on resistance plates, and then cultured in a 500 mL triangular flask containing 100 mL of PY liquid medium at 30 °C with shaking at 130 rpm for 120 h. After fermentation incubation, extracellular protein was collected from the culture supernatant and purified using HisTrapTM FF column (Cytiva, Marlborough, MA, USA). The CBHI enzyme activity was measured according to the method described by song, et al. [35].

2.10. Statistical Analysis

All optimization experiments and selection pressure assays were conducted with three independent biological replicates. Data were presented as the mean ± standard deviation (SD). One-way analysis of variance (ANOVA) followed by Duncan’s multiple range test was used to determine significant differences between groups. Differences were considered statistically significant at p ≤ 0.05. Microsoft Excel and SPSS software (v19, IBM Corp., Armonk, NY, USA) was used to process data. Origin 2025 (OriginLab Corp., Northampton, MA, USA) was utilized for figure graphing.

3. Results

3.1. Optimization of O. xuefengensis Protoplasts Preparation Under Different Factors

3.1.1. Effect of Enzymatic Systems and Concentration on Protoplasts Preparation

To generate sufficient quantities of protoplasts for subsequent genetic manipulation, we first evaluated the efficacy of six different enzyme combinations for enzymatic digestion of O.xuefengensis mycelia. As illustrated in Figure 1A, protoplast production varied significantly among different enzymatic treatments. Initially, the single-enzyme treatments resulted in relatively low yields, specifically, 1.5% lywallzyme 1 (0.88 × 106 CFU/mL), 1.5% lywallzyme 2 (1.05 × 106 CFU/mL), and 50 U lyticase (0.85 × 106 CFU/mL) produced limited numbers of protoplasts, with no statistically significant differences observed among them (p > 0.05). These yields appeared insufficient to meet the requirements for efficient genetic manipulation. In contrast, the dual-enzyme systems offered a promising strategy to overcome this yield limitation, consistently outperforming the single-enzyme preparations. Among the combinations tested, combination 4 (consisting of 1.5% lywallzyme 1 and 1.5% snailase) yielded the highest protoplast concentration at 2.23 × 106 CFU/mL. This yield was significantly higher than those of combination 5 (1.46 × 106 CFU/mL, p < 0.01) and combination 6 resulted in the lowest yield (1.25 × 106 CFU/mL, p < 0.01). Consequently, combination 4 was determined as the optimal enzyme system for further optimization.
To further ensure the protoplast yields required for efficient genetic transformation, the effect of enzyme concentration on the efficiency of the selected system was investigated. A significant positive correlation was observed between protoplast yield and enzyme concentration (Figure 1B). The highest protoplast yield was achieved at an enzyme concentration of 1.5%, reaching 9.11 × 106 CFU/mL. This value was markedly higher than the yields obtained at 0.75% (5.83 × 106 CFU/mL, p < 0.001), 1% (4.48 × 106 CFU/mL, p < 0.001), and1.25% (3.95 × 106 CFU/mL, p < 0.01). These results demonstrated that optimizing the enzyme concentration to 1.5% effectively improves protoplast yield. Accordingly, a concentration of 1.5% was selected for subsequent experiments.

3.1.2. Effect of Fungal Age on Protoplast Preparation

The preparation of protoplasts was strongly influenced by fungal age. This study evaluated protoplast production using liquid cultured mycelia harvested at various incubation times (4, 5, 6, and 7 days). As shown in Figure 2A, a clear negative correlation was observed between culture duration and protoplast yield. The highest protoplast yield was obtained from 4-day-old mycelia, achieving a concentration of 4.03 × 107 CFU/mL. In contrast, extending the culture time to 5 days resulted in a significant drop to 2.81 × 107 CFU/mL. This declining trend was further exacerbated at 6 and 7 days, with yields plummeting to 1.42 × 107 CFU/mL and 0.85 × 107 CFU/mL, respectively. Statistical analysis confirmed that the yields from 5-, 6-, and 7- days were all significantly lower than the 4-day (p < 0.001). This progressive reduction in yields indicated that older mycelia possess greater resistance to enzymatic digestion. Thus, 4-day-old mycelia were identified as the optimal physiological state for subsequent protoplast preparations.

3.1.3. Effect of Enzymatic Digestion Conditions on Protoplast Preparation

In addition to fungal age, enzyme composition, and concentration, environmental factors during enzymatic digestion, such as the enzymatic digestion time, enzymatic digestion temperature, and agitation speed, also have a significant impact on protoplast yield. As shown in Figure 2B, the number of O. xuefengensis protoplasts increased rapidly with increasing enzymatic digestion time, reaching a maximum yield of 6.03 × 107 CFU/mL after 3.5 h. However, extending digestion time to 4 h, the protoplast yield decreased to 4.68 × 107 CFU/mL (p < 0.001), indicating that prolonged enzymatic digestion leads to protoplast rupture. Based on these trends, an enzyme digestion time of 3.5 h was selected as the preferred time for protoplast preparation.
The protoplast yield exhibited a positive correlation with the enzymatic digestion temperature in the range of 28–36 °C (Figure 2C). The highest yield, 7.01 × 107 CFU/mL, was achieved at 34 °C following cell wall digestion, which was significantly surpassing than those obtained at 28 °C (3.03 × 107 CFU/mL, p < 0.001), 30 °C (4.51 × 107 CFU/mL, p < 0.001), and 32 °C (5.29 × 107 CFU/mL, p < 0.01). The protoplast production decreased to 4.90 × 107 CFU/mL with increase temperature to 36 °C. Therefore, 34 °C was identified as the optimal digestion temperature for subsequent experimental procedures.
Furthermore, the effect of agitation speed on protoplast preparation was evaluated, four speeds (75, 100, 130, and 150 rpm) were applied while maintaining the previously optimized enzymatic digestion conditions (Figure 2D). The protoplast yields were significantly higher under all agitated conditions compared to static digestion. The highest protoplast yield of 9.42 × 107 CFU/mL was obtained at 130 rpm. Deviation from this speed resulted in reduced protoplast production, with yields of 7.54 × 107 CFU/mL and 7.93 × 107 CFU/mL (p < 0.01) protoplasts at 100 rpm and 150 rpm, respectively. Consequently, the optimal protoplast preparation protocol consisted of digesting 4-day-old mycelia for 3.5 h at 34 °C with agitation at 130 rpm using an enzyme mixture of 1.5% lywallzyme and 1.5% snailase. These conditions overcame the bottleneck of low protoplast yield, ensuring a reliable supply for subsequent genetic studies in O. xuefengensis.

3.2. Optimal Regeneration Medium for O. xuefengensis Protoplast Regeneration

The composition of protoplast regeneration medium plays a critical role in cellular recovery by providing essential nutrients and osmotic protection, thereby facilitating cell wall reconstitution and promoting sustained mitotic activity. In this study, the protoplasts were diluted to a concentration of 1 × 107 CFU/mL. 0.6 M sorbitol was selected as the osmotic stabilizer, three regeneration media (PPDA, PY and TB3) were evaluated to determine the regeneration efficiency of O. xuefengensis protoplasts and identify the most suitable regeneration medium. Protoplast regeneration occurred successfully in all tested medium (Figure 3). Notably, visible colonies on the PPY medium almost covered the entire plate, exhibiting markedly higher regeneration compared to the PPDA and TB3 medium. This result indicates that the PPY medium provides an optimal microenvironment that preserves protoplast integrity while supplying necessary nutrients for cell wall regeneration and subsequent colony development. Based on these findings, the PPY liquid low- melting-point medium was selected for all subsequent protoplast regeneration and transformation procedures.

3.3. Resistance Gene Selection and O. xuefengensis Sensitivity Test

The sensitivity of wild-type O. xuefengensis strain HACM001 to hygromycin B was investigated across six gradient concentrations. As illustrated in Figure 4, mycelial growth was significantly inhibited as the antibiotic concentration increased, with the colony diameter decreasing progressively from 100 to 500 μg/mL. Notably, 600 μg/mL hygromycin B completely suppressed mycelial growth, with no visible colony expansion was observed from the inoculated plugs after 14 days of incubation. In contrast, the strain HACM001 exhibited robust growth on the control plates without antibiotic supplementation. Consequently, 600 μg/mL was identified as the optimal working concentration for O. xuefengensis and was selected for subsequent transformant screening.

3.4. PEG-Mediated hygR Transformation and Transformants Verification of O. xuefengensis

To assess the transformation efficiency of O. xuefengensis protoplasts, the plasmid pCAMBIA1300, containing the hygromycin B resistance gene (hygR) was integrated into the O. xuefengensis genome using a PEG-mediated transformation approach. Following the introduction of the pCAMBIA1300 plasmid, transformants exhibiting selective growth were observed in PPY medium supplemented with hygromycin B. Using 6 µg of plasmid DNA, approximately 50 transformants were obtained (Figure 5A). In contrast, no colonies appeared on the wild-type plates (Figure 5B). PCR amplification confirmed the presence of the hygR gene in the eleven transformants. Among these, five positive transformants were identified, achieving a high transformation efficiency of 45.5% (Figure 5C). The transformation efficiency was calculated as the ratio of PCR-positive transformants to the total number of transformants subjected to PCR analysis. These results confirm the successful establishment of a genetic transformation system in O. xuefengensis.

3.5. Stability Analysis of O. xuefengensis Transformants Integrating the hygR Gene

To evaluate the genetic stability of the hygR gene, three wild-type strains and three transformants were subjected to successive subculturing of four generations. Figure 6A presents a phenotypic comparison of wild-type strains and transformants under both non-selective and selective conditions. Initially, under non-selective (antibiotic-free) conditions, both wild-type strains and transformants (second and third generation) exhibited rapid and vigorous growth, indicating that the subculturing process did not compromise mycelium viability. In contrast, a distinct difference emerged when these strains were then transferred to PY medium containing hygromycin B. The wild-type strains displayed complete growth inhibition along with no mycelial expansion, whereas the transformants maintained robust colony growth (Figure 6A, right). PCR analysis further verified the continued presence of the hygR gene in the genomes of all transformants (Figure 6B). These results demonstrate that the hygR gene was stably integrated into the O. xuefengensis genome and effectively maintained over multiple generations.

3.6. Elucidation of PEG-Mediated Protoplast Transformation for Heterologous CBHI Expression

To validate this system established in this study, the PEG-mediated genetic transformation system was employed to assess the heterologous expression capacity of a target gene. The pCAMBIA1300-CBHI recombinant expression cassette was successfully constructed via homologous recombination using the endogenous promoter POxgpd1, the exogenous glycoside hydrolase gene cbhI (encoding cellobiohydrolase I, CBHI), and the terminator Ttrpc (Figure 7A).
Transformants were initially selected on PPY medium and subsequently subjected to three rounds of antibiotic screening. The presence of a 2.02 kb fragment of the glycoside hydrolase cbhI gene in the genomic DNA of randomly selected transformants indicated successful integration of desired genes, while no amplification product was detected in the wild-type strain (Figure 7B). Furthermore, two positive transformants were cultured in fermentation broth and extracellular proteins were recovered and purified. SDS-PAGE analysis confirmed the successful expression and secretion of CBHI (Figure 7C). Subsequent enzymatic assays demonstrated that the purified CBHI enzyme exhibited cellobiose hydrolyzing activity, confirming its functional expression (Figure 7D). These results collectively demonstrate the reliability of the established transformation system and provide a solid technical foundation for future functional genomic studies in O. xuefengensis, including gene knockout, overexpression, and the investigation of genes regulating fruiting body development.

4. Discussion

Efficient protoplast preparation is the cornerstone of PEG-mediated transformation in ascomycetous fungi, as both transformation efficiency and genetic stability are highly dependent on protoplast yield and integrity [36,37]. Although genetic transformation techniques have been successfully established in other cordyceps species and edible fungi [38,39], the considerable variation in cellular structures across taxonomic groups indicates that no universal protocol exists for O. xuefengensis. In this study, we successfully established a stable and efficient PEG-mediated protoplast transformation system.
The type and concentration of cell wall lytic enzymes are strongly correlated with protoplast production [40,41]. Some fungi, such as cordyceps cicadae and Trichoderma reesei, require only a single enzyme for effective protoplast preparation [21,42]. However, our results demonstrated that the cell wall of O. xuefengensis is more effectively degraded by a synergistic enzyme mixture. Specifically, a combination of lywallzyme 1 and snailase (Combination 4) was superior to single-enzyme treatments (Figure 1A). This high yield was attributed to the ability of appropriate and highly active enzyme mixtures to digest the mycelial cell wall more effectively, thereby releasing a greater number of intact protoplasts [43,44]. A similar strategy employing multiple and mixed enzyme systems for protoplasts preparation has been successfully applied to other fungi. For example, a four-enzyme mixture has been used for efficient protoplast isolation from Penicillium sclerotiorum mycelium, and a two-enzyme system for Colletotrichum falcatum [45,46]. Further optimization revealed that increasing enzyme concentration did not linearly improve yield, 1.5% was identified as the optimal threshold, yielding a 9.11 × 106 CFU/mL of protoplast (Figure 1B).
Mycelium age, enzymatic digestion conditions are critical factors affecting protoplasts yield and viability [47,48]. The structure and metabolic activity of the cell wall vary considerably between developmental phases. Very young mycelia exhibit thin and fragile cell walls, whereas older mycelia develop thick and rigid walls, both states are suboptimal for protoplast isolation [49]. In our study, 4-day-old mycelia was identified as the optimal material (Figure 2A), this was consistent with studies from Jin, et al., who reported that young, actively growing mycelia could provide the best balance of structural integrity and digestibility [50]. The control of enzymatic digestion parameters is critical for successful protoplast isolation. Insufficient digestion time typically results in incomplete cell wall lysis, whereas excessive duration can lead to protoplast rupture and diminished regeneration capacity [21,51]. Furthermore, digestion temperature is a key regulator of enzyme kinetics, and moderate agitation is essential to enhance enzyme-substrate interactions as well as ensure digestion homogeneity [52]. In the present study, optimizing these variables allowed us to identify the most effective conditions for protoplast preparation. A yield of no less than 9.42 × 107 CFU/mL protoplast was obtained by digesting 4-day-old mycelia with a combination of 1.5% lywallzyme 1 and 1.5% snailase at 34 °C and 130 rpm for 3.5 h (Figure 2B–D), ensuring a sufficient quantity for genetic transformation.
Protoplast regeneration and antibiotic selection are equally critical for successful transformation and downstream applications. Osmotic stabilizers play a decisive role in maintaining protoplast integrity and promoting cell wall re-synthesis, yet their effectiveness is species dependent [53,54]. Our results demonstrated that PY medium supplemented with 0.6 M mannitol supported the highest regeneration rate for O. xuefengensis protoplasts (Figure 3). This aligns with previous reports in Cordyceps militaris, where mannitol is the preferred stabilizer [55], but contrasts with other species, such as Ganoderma lucidum, where KCl has proven more effective [56], or Penicillium oxalicum, where sorbitol yields optimal results [12]. This optimized regeneration system ensuring the high protoplast yield obtained during digestion, which could be effectively translated into viable transformants, thereby enhancing overall transformation efficiency. Hygromycin B is widely used to screen transformants in ascomycetous fungi, with effective concentrations typically ranging from 50 to 400 μg/mL [40,57]. Notably, O. xuefengensis exhibited relatively high resistance to hygromycin B, with a minimum inhibitory concentration of 600 μg/mL (Figure 4). This finding is consistent with previous reports by Sun et al., who employed 650 mg/L hygromycin B for selecting transformants of Cordyceps militaris [58].
By integrating the optimized protocols for protoplast preparation, regeneration, and selection, the hygR gene was successfully integrated into O. xuefengensis genome via PEG-mediated transformation (Figure 5). This system exhibited superior efficiency, yielding approximately 70 transformants per 6 μg of plasmid DNA (45.54% success rate). Notably, this performance significantly outperforms reported optimal yields for related medicinal fungi such as Cordyceps guangdongensis and Ganoderma lucidum (28 and 25 transformants, respectively) [50,59]. Moreover, the stable inheritance of the hygromycin resistance marker across four successive generations under both non-selective and selective conditions (Figure 6) confirms the robustness and genetic stability of this platform.
To further validate the functional applicability of the PEG-mediated plasmid transformation system, we expressed the exogenous glycoside hydrolase gene cbhI using the endogenous O. xuefengensis GPD promoter (POxgpd1). Previous studies have shown that endogenous promoters are more readily recognized by host transcriptional machinery, thereby enhancing transcriptional initiation and expression stability [60,61]. The successful genomic integration of the recombinant pCAMB1A1300-CBHI plasmid and the measurable cellobiose hydrolyzing activity of CBHI confirmed that the established system is not only suitable for marker gene integration but also effective for functional gene expression and protein production (Figure 7). This transformation system is well suited for routine gene integration, heterologous gene expression, and single-gene functional characterization in O. xuefengensis. Although the potential for complex molecular breeding with superior traits is currently limited by the lack of a complete chromosome-level genome assembly, this established system substantially expands the molecular toolbox for O. xuefengensis and provides a solid foundation for future investigations into molecular mechanisms and metabolic engineering.

5. Conclusions

In conclusion, we successfully developed a PEG-mediated transformation system for the medical fungus O. xuefengensis. This system serves as an effective tool for genetic manipulation, enabling stable genomic integration and functional gene expression. The optimal protoplast isolation conditions as: 4-day-old mycelia with 1.5% lywallzyme 1 and 1.5% snailase digested at 34 °C, 130 rpm for 3.5 h, achieving no less than 9.42 × 107 CFU/mL protoplasts, with PPY medium identified as the best for regeneration. Stable genomic integration of the pCAMBIA1300 plasmid containing the hygR gene confirmed the successful establishment of the system. Additionally, functional validation was demonstrated through the heterologous expression of CBHI, confirming its utility, this work provides a platform for future molecular research and genetic improvement in O. xuefengensis.

Author Contributions

Conceptualization, investigation, data curation, writing—original draft, writing—review & editing, validation, and funding acquisition, X.F.; formal analysis, data curation and visualization, X.S.; methodology, writing—review & editing and funding acquisition, J.L. and R.Z.; formal analysis, investigation, Z.Y. and X.T.; conceptualization, funding acquisition, project administration, supervision, S.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Natural Science Foundation of Hunan Province of China (No. 2025JJ60526, 2024JJ7292, 2023JJ40017), the Health Research Project of Hunan Provincial Health Commission (No. 20255256), and the Key project at central government level: The ability establishment of sustainable use for valuable Chinese medicine resources (No. 2060302-2304-02, 2060302-2503-22).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article.

Acknowledgments

The authors thank Liping Lin for her assistance in optimizing protoplast preparation and Yifan Jiang for her assistance in the CBHI enzyme activity determination experiment at Changsha University of Science & Technology.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
PEGpolyethylene glycol
HygRhygromycin B resistance
CBHCellobiohydrolase

References

  1. Wen, T.C.; Zhu, R.C.; Kang, J.C.; Huang, M.H.; Tan, D.B.; Ariyawansha, H.; Hyde, K.D.; Liu, H. Ophiocordyceps xuefengensis sp. nov. from larvae of Phassus nodus (Hepialidae) in Hunan Province, southern China. Phytotaxa 2013, 123, 41–50. [Google Scholar] [CrossRef]
  2. Zhong, C.; Zhou, R.R.; Jin, J.; Liu, H.; Xie, J.; Zhen, L.P.; Xiao, S.G.; Zhang, S.H. Cloning and analysis of the photoreceptor genes Oxwc-1 and Oxwc-2 from ethnopharmacological fungus Ophiocordyceps xuefengensis. Mycoscience 2021, 62, 189–197. [Google Scholar] [CrossRef]
  3. Qin, Y.; Chen, L.; Jin, J.; Huang, J.; Li, J.; Zhou, Q.; Zhou, R.; Zhang, S.H. Screening and Identification of Antioxidants from Ophiocordyceps xuefengensis (Ascomycetes) by Using DPPH-HPLC-DAD-Q-TOF-MS/MS. Int. J. Med. Mushrooms 2018, 20, 887–899. [Google Scholar] [CrossRef]
  4. Qin, Y.; Zhou, R.R.; Jin, J.; Cheng, F.; Shen, B.B.; Zeng, H.L.; Wan, D.; Zhong, C.; Xie, J.; Shu, J.; et al. Indole-based alkaloids from Ophiocordyceps xuefengensis. Phytochemistry 2021, 181, 112536. [Google Scholar] [CrossRef]
  5. Jin, J.; Kang, W.L.; Zhong, C.; Qin, Y.; Zhou, R.R.; Liu, H.; Xie, J.; Chen, L.; Qin, Y.H.; Zhang, S.H. The pharmacological properties of Ophiocordyceps xuefengensis revealed by transcriptome analysis. J. Ethnopharmacol. 2019, 219, 195–201. [Google Scholar] [CrossRef]
  6. Qin, Y.; Zhou, R.R.; Liu, H.; Shi, S.Y.; Zhang, S.H. New insights into the chemistry and anticancer activity of Ophiocordyceps xuefengensis. J. Pharm. Biomed. Anal. 2024, 249, 116345. [Google Scholar] [CrossRef]
  7. Campelo, S.N.; Huang, P.H.; Buie, C.R.; Davalos, R.V. Recent Advancements in Electroporation Technologies: From Bench to Clinic. Annu. Rev. Biomed. Eng. 2023, 25, 77–100. [Google Scholar] [CrossRef] [PubMed]
  8. Cunningham, F.J.; Goh, N.S.; Demirer, G.S.; Matos, J.L.; Landry, M.P. Nanoparticle-Mediated Delivery towards Advancing Plant Genetic Engineering. Trends. Biotechnol. 2018, 36, 882–897. [Google Scholar] [CrossRef] [PubMed]
  9. Azizi-Dargahlou, S.; Pouresmaeil, M. Agrobacterium tumefaciens-Mediated Plant Transformation: A Review. Mol. Biotechnol. 2024, 66, 1563–1580. [Google Scholar] [CrossRef] [PubMed]
  10. Faion-Molina, M.; Molina-Risco, M.D.; Bellinatti-Della Gracia, M.D.; Ibarra, O.; Kim, B.; Septiningsih, E.M.; Thomson, M.J. Agrobacterium tumefaciens-Mediated Plant Transformation and Gene Editing in Rice. Methods. Mol. Biol. 2025, 2911, 45–59. [Google Scholar] [CrossRef] [PubMed]
  11. Calabuig-Serna, A.; Mir, R.; Porcel, R.; Seguí-Simarro, J.M. The Highly Embryogenic Brassica napus DH4079 Line Is Recalcitrant to Agrobacterium-Mediated Genetic Transformation. Plants 2023, 12, 2008. [Google Scholar] [CrossRef]
  12. Feng, X.T.; Yao, Y.N.; Xu, N.; Jia, H.; Li, X.Z.; Zhao, J.; Chen, S.; Qu, Y. Pretreatment Affects Profits From Xylanase During Enzymatic Saccharification of Corn Stover Through Changing the Interaction Between Lignin and Xylanase Protein. Front. Microbiol. 2021, 12, 754593. [Google Scholar] [CrossRef] [PubMed]
  13. Pré, D.S.; Konings, M.; Schoorl, D.J.A.; Fahal, A.H.; Arentshorst, M.; Ram, A.F.J.; Sande, W.W.J.V.D. Protoplast-mediated transformation of Madurella mycetomatis using hygromycin resistance as a selection marker. PLoS Negl. Trop. Dis. 2024, 18, e0012092. [Google Scholar] [CrossRef]
  14. Figueroa-Varela, P.; Susunaga-Gómez, D.; Restrepo-Osorio, C.; Harms, C.; Villanueva-Mejía, D. An efficient method for protoplast-mediated production of transformed castor bean (Ricinus communis) lines. BMC Res. Notes 2023, 16, 140. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, M.; Xiao, C.; Tan, Q.; Dong, L.; Liu, X.; Pu, J.; Zhang, H. The Involvement of the Laccase Gene Cglac13 in Mycelial Growth, Germ Tube Development, and the Pathogenicity of Colletotrichum gloeosporioides from Mangoes. J. Fungi 2023, 9, 503. [Google Scholar] [CrossRef]
  16. Wang, W.; Wang, Y.; Dong, G.; Chen, F. Development of Cordyceps javanica BE01 with enhanced virulence against Hyphantria cunea using polyethylene glycol-mediated protoplast transformation. Front. Microbiol. 2022, 13, 972425. [Google Scholar] [CrossRef]
  17. Hu, Y.; Wu, Y.; Song, J.; Ma, M.; Xiao, Y.; Zeng, B. Advancing Cordyceps militaris Industry: Gene Manipulation and Sustainable Biotechnological Strategies. Bioengineering 2024, 11, 783. [Google Scholar] [CrossRef]
  18. Gray, K.; Edwards, H.; Doan, A.G.; Huso, W.; Lee, J.; Pan, W.; Bolima, N.; Morse, M.E.; Yoda, S.; Gautam, I.; et al. Aspergillus nidulans cell wall integrity kinase, MpkA, impacts cellular phenotypes that alter mycelial-material mechanical properties. Fungal Biol. Biotechnol. 2024, 11, 22. [Google Scholar] [CrossRef]
  19. Qian, K.; Qi, Z.; Xu, A.; Li, X.; Zhang, B.; Li, Y. Interspecies hybridization between Auricularia cornea cv. Yu Muer and Auricularia heimuer cv. Bai Muer through protoplast fusion. Front. Microbiol. 2023, 14, 1280420. [Google Scholar] [CrossRef]
  20. Ju, F.Y.; Qi, Z.Q.; Tan, J.J.; Dai, T.T. Development of Green Fluorescent Protein-Tagged Strains of Fusarium acuminatum via PEG-Mediated Genetic Transformation. Microorganisms 2024, 12, 2427. [Google Scholar] [CrossRef]
  21. Qi, H.K.; Ruan, H.H.; Wu, T.; Zhang, H.Y.; Dong, R.; Jiang, Y.J. Optimization of Protoplast Preparation and Establishment of PEG-Mediated Genetic Transformation Method in Cordyceps cicadae. J. Fungi 2025, 11, 219. [Google Scholar] [CrossRef] [PubMed]
  22. Agisha, V.N.; Ashwin, N.M.R.; Vinodhini, R.T.; Nalayeni, K.; Sundar, A.R.; Malathi, P.; Viswanathan, R. Protoplast-mediated transformation in Sporisorium scitamineum facilitates visualization of in planta developmental stages in sugarcane. Mol. Biol. Rep. 2021, 48, 7921–7932. [Google Scholar] [CrossRef] [PubMed]
  23. Li, J.; Wu, J.; You, D.; Igarashi, Y.; Luo, F.; Chang, P. Optimized electroporation for efficient evaluation of genetic elements in Dichomitus squalens. World. J. Microbiol. Biotechnol. 2025, 41, 107. [Google Scholar] [CrossRef]
  24. Lim, F.H.; Rasid, O.A.; Idris, A.S.; As’wad, A.W.M.; Vadamalai, G.; Parveez, G.K.A.; Wong, M.Y. Enhanced polyethylene glycol (PEG)–mediated protoplast transformation system for the phytopathogenic fungus, Ganoderma boninense. Folia Microbiol. 2021, 66, 677–688. [Google Scholar] [CrossRef] [PubMed]
  25. Ma, T.L.; Yan, C.Y.; Zhang, S.Y.; Liang, D.; Mao, C.X.; Zhang, C.Q. High-quality genome assembly and genetic transformation system of Lasiodiplodia theobromae strain LTTK16-3, a fungal pathogen of Chinese hickory. Microbiol. Spectr. 2024, 12, e0331123. [Google Scholar] [CrossRef]
  26. Li, X.; Liu, M.; Dong, C. Hydrophobin Gene Cmhyd4 Negatively Regulates Fruiting Body Development in Edible Fungi Cordyceps militaris. Int. J. Mol. Sci. 2023, 24, 4586. [Google Scholar] [CrossRef]
  27. Cheng, B.; Tao, N.; Ma, Y.; Chai, H.; Liu, P.; Chen, W.; Zhao, Y. Overexpression of the Capebp2 Gene Encoding the PEBP-like Protein Promotes the Cap Redifferentiation in Cyclocybe aegerita. J. Fungi 2023, 9, 657. [Google Scholar] [CrossRef]
  28. Mathis, H.; Naquin, D.; Margeot, A.; Bidard, F. Enhanced heterologous gene expression in Trichoderma reesei by promoting multicopy integration. Appl. Microbiol. Biotechnol. 2024, 108, 470. [Google Scholar] [CrossRef]
  29. Shi, L.; Fang, X.; Li, M.; Mu, D.; Ren, A.; Tan, Q.; Zhao, M. Development of a simple and efficient transformation system for the basidiomycetous medicinal fungus Ganoderma lucidum. World J. Microbiol. Biotechnol. 2012, 28, 283–291. [Google Scholar] [CrossRef]
  30. Jin, J.; Zhong, C.; Qin, Y.; Cai, Y.; Zhen, L.; Shen, B.; Chen, L.; Wan, D.; Qin, Y.; Zhang, S. A new cordycepin-producing caterpillar fungus Ophiocordyceps xuefengensis with artificial infection to the host, cultivation of mycelia and stromata. FEMS Microbiol. Lett. 2017, 1, 364. [Google Scholar] [CrossRef]
  31. Kang, H.H.; Naing, A.H.; Kim, C.K. Protoplast Isolation and Shoot Regeneration from Protoplast-Derived Callus of Petunia hybrida Cv. Mirage Rose. Biology 2020, 9, 228. [Google Scholar] [CrossRef] [PubMed]
  32. Yang, D.; Zhao, Y.; Liu, Y.; Han, F.; Li, Z. A high-efficiency PEG-Ca2+-mediated transient transformation system for broccoli protoplasts. Front. Plant Sci. 2022, 13, 1081321. [Google Scholar] [CrossRef] [PubMed]
  33. Qin, Y.; Hua, S.; Zhu, L.; Nie, P.; Yang, C.; Xu, F.; Wu, D.; Dong, W. Application of graphene oxide in Agrobacterium-mediated genetic transformation and construction of a novel DNA delivery system for watermelon. Sci. Rep. 2025, 15, 5465. [Google Scholar] [CrossRef]
  34. Lu, X.; Feng, X.; Li, X.; Zhao, J. Binding and hydrolysis properties of engineered cellobiohydrolases and endoglucanases. Bioresour. Technol. 2018, 267, 235–241. [Google Scholar] [CrossRef]
  35. Song, W.X.; Lu, X.Q.; Han, X.L.; Qu, Y.B. Enzymatic Properties of Cel5B and Cel7 A-2 from Penicillium oxalicum and Their Role in the Enzymatic Saccharification of Lignocellulose. Appl. Biochem. Biotechnol. 2025, 197, 4817–4836. [Google Scholar] [CrossRef]
  36. Chen, Y.; Hou, X.R.; Zheng, Y.P.; Lyu, Y.M. The Establishment of a Genetic Transformation System and the Acquisition of Transgenic Plants of Oriental Hybrid Lily (Lilium L.). Int. J. Mol. Sci. 2023, 24, 782. [Google Scholar] [CrossRef]
  37. Han, X.; Rong, H.; Feng, Y.; Xin, Y.; Luan, X.; Zhou, Q.; Xu, M.; Xu, L.A. Protoplast isolation and transient transformation system for Ginkgo biloba L. Front. Plant Sci. 2023, 14, 1145754. [Google Scholar] [CrossRef]
  38. Luo, N.; Li, Z.Y.; Ling, J.; Zhao, J.L.; Li, Y.; Yang, Y.H.; Mao, Z.C.; Xie, B.Y.; Li, H.X.; Jiao, Y. Establishment of a CRISPR/Cas9-Mediated Efficient Knockout System of Trichoderma hamatum T21 and Pigment Synthesis PKS Gene Knockout. J. Fungi 2023, 9, 595. [Google Scholar] [CrossRef]
  39. Men, P.; Wang, M.; Li, J.; Geng, C.; Huang, X.; Lu, X. Establishing an Efficient Genetic Manipulation System for Sulfated Echinocandin Producing Fungus Coleophoma empetri. Front. Microbiol. 2021, 12, 734780. [Google Scholar] [CrossRef] [PubMed]
  40. Cai, R.H.; Xiao, Y.; Xing, J.J.; Yu, K.J.; Li, X.L.; Chai, Y.Q. Establishment of a genetic transformation system for cordycipitoid fungus Cordyceps chanhua. Front. Microbiol. 2024, 15, 1333793. [Google Scholar] [CrossRef]
  41. Li, X.B.; Qin, Y.; Kong, Y.F.; Karunarathna, S.C.; Liang, Y.J.; Xu, J.Z. Optimization of Protoplast Preparation Conditions in Lyophyllum decastes and Transcriptomic Analysis Throughout the Process. J. Fungi 2024, 10, 886. [Google Scholar] [CrossRef]
  42. Wang, L.; Liu, J.L.; Tang, J.X.; Dang, Y.Q.; Sun, L.Y.; Liu, B.; Li, H.Y.; He, X.Y.; Shuai, Q.Z.; Peng, Z.W.; et al. Development of a quinic acid-induced CRISPR/Cas9 genome editing system and its application for the activation of ilicicolin H biosynthesis in Trichoderma reesei. Int. J. Biol. Macromol. 2024, 279, 135339. [Google Scholar] [CrossRef]
  43. Zhang, L.; Yung, W.S.; Wang, Z.L.; Li, M.W.; Huang, M.K. Optimization of an Efficient Protoplast Transformation System for Transient Expression Analysis Using Leaves of Torenia fournieri. Plants 2022, 11, 2106. [Google Scholar] [CrossRef] [PubMed]
  44. Yang, P.; Sun, Y.; Sun, X.; Li, Y.; Wang, L. Optimization of preparation and transformation of protoplasts from Populus simonii × P. nigra leaves and subcellular localization of the major latex protein 328 (MLP328). Plant. Methods 2024, 20, 3. [Google Scholar] [CrossRef]
  45. Jahan, I.; Yang, Q.L.; Guan, Z.J.; Wang, Y.H.; Li, P.; Jian, Y. PEG-Mediated Protoplast Transformation of Penicillium sclerotiorum (scaumcx01): Metabolomic Shifts and Root Colonization Dynamics. J. Fungi 2025, 11, 386. [Google Scholar] [CrossRef] [PubMed]
  46. Amalamol, D.; Ashwin, N.M.R.; Lakshana, K.V.; Bharathi, M.N.; Sundar, A.R.; Sukumaran, R.K.; Malathi, P.; Viswanathan, R. A highly efficient stratagem for protoplast isolation and genetic transformation in filamentous fungus Colletotrichum falcatum. Folia Microbiol. 2022, 67, 479–490. [Google Scholar] [CrossRef]
  47. Ning, Y.D.; Hu, B.; Yu, H.B.; Liu, X.Y.; Jiao, B.H.; Lu, X.L. Optimization of Protoplast Preparation and Establishment of Genetic Transformation System of an Arctic-Derived Fungus Eutypella sp. Front. Microbiol. 2022, 13, 769008. [Google Scholar] [CrossRef]
  48. Ren, R.; Gao, J.; Lu, C.Q.; Wei, Y.L.; Jin, J.P.; Wong, S.M.; Zhu, G.F.; Yang, F.X. Highly Efficient Protoplast Isolation and Transient Expression System for Functional Characterization of Flowering Related Genes in Cymbidium orchids. Int. J. Mol. Sci. 2020, 21, 264. [Google Scholar] [CrossRef] [PubMed]
  49. Shin, J.H.; Han, J.H.; Park, H.H.; Fu, T.; Kim, K.S. Optimization of Polyethylene Glycol-Mediated Transformation of the Pepper Anthracnose Pathogen Colletotrichum scovillei to Develop an Applied Genomics Approach. Plant Pathol. J. 2019, 35, 575–584. [Google Scholar] [CrossRef]
  50. Jin, L.Q.; Xu, Z.W.; Men, X.H.; Bo, Z.; Liu, Z.Q.; Zheng, Y.G. Enhancement of protoplast preparation and regeneration of Hirsutella sinensis based on process optimization. Biotechnol. Lett. 2020, 42, 2357–2366. [Google Scholar] [CrossRef]
  51. Li, X.; Yu, C.; Jiang, H.; Li, J.; Hu, H.; Yang, Z.; Jia, Y.; Wu, Y. Establishment of protoplast isolation, purification and transient transformation system from Rhododendron petals. Protoplasma 2025. ahead of print. [Google Scholar] [CrossRef]
  52. Jia, H.X.; Feng, X.T.; Huang, J.M.; Guo, Y.J.; Zhang, D.L.; Li, X.Z.; Zhao, J. Recombinant Family 1 Carbohydrate-Binding Modules Derived From Fungal Cellulase Enhance Enzymatic Degradation of Lignocellulose as Novel Effective Accessory Protein. Front. Microbiol. 2022, 13, 876466. [Google Scholar] [CrossRef]
  53. Wu, J.D.; Chou, J.C. Optimization of Protoplast Preparation and Regeneration of a Medicinal Fungus Antrodia cinnamomea. Mycobiology 2019, 47, 483–493. [Google Scholar] [CrossRef] [PubMed]
  54. Welsh, L.R.J.; Whisson, S.C. Protoplast Transformation of Phytophthora spp. Methods Mol. Biol. 2025, 2892, 35–47. [Google Scholar] [CrossRef]
  55. Choi, H.; Park, S.W.; Oh, J.; Kim, C.S.; Sung, G.H.; Sang, H. Efficient disruption of CmHk1 using CRISPR/Cas9 ribonucleoprotein delivery in Cordyceps militaris. FEMS Microbiol. Lett. 2023, 17, 370. [Google Scholar] [CrossRef]
  56. Zhang, C.H.; Haung, H.; Chen, H.J.; Wang, G.Z.; Chen, X.N.; Zhong, G.R.; Li, T.H.; Deng, W.Q. Protoplast Preparation and Establishment of PEG-Mediated Genetic Transformation System of Cordyceps guangdongensis. Guangdong Agric. Sci. 2024, 51, 16–28. [Google Scholar] [CrossRef]
  57. Li, S.; Liu, Q.; Zhong, Z.Y.; Deng, Z.X.; Sun, Y.H. Exploration of Hygromycin B Biosynthesis Utilizing CRISPR-Cas9-Associated Base Editing. ACS Chem. Biol. 2020, 15, 1417–1423. [Google Scholar] [CrossRef]
  58. Sun, D.; Zhang, M.; Xie, C.R.; Guo, X.W.; Xu, H.H.; Gao, H.T.; Li, X.W.; Sun, T.X.; Li, H.Y. Establishment of Genetic Transformation System of Cordyceps militaris using PEG Mediated Method. China Biotechnol. 2017, 37, 76–82. [Google Scholar] [CrossRef]
  59. Yu, X.Y.; Ji, S.L.; He, Y.L.; Ren, M.F.; Xu, J.W. Development of an expression plasmid and its use in genetic manipulation of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes). Int. J. Med. Mushrooms 2014, 16, 161–168. [Google Scholar] [CrossRef] [PubMed]
  60. Zhang, Q.; Zhao, L.J.; Shen, M.Y.; Liu, J.Y.; Li, Y.R.; Xu, S.; Chen, L.; Shi, G.Y.; Ding, Z.Y. Establishment of an Efficient Polyethylene Glycol (PEG)-Mediated Transformation System in Pleurotus eryngii var. ferulae Using Comprehensive Optimization and Multiple Endogenous Promoters. J. Fungi 2022, 8, 186. [Google Scholar] [CrossRef]
  61. Gao, S.Z.; Zhao, M.F.; Sun, S.Y.; Fan, X.; Yan, J.L.; Xin, Y.; Zhan, Y.G.; Zeng, F.S. Development of an endogenous promoter-driven CRISPR/Cas9 system for genome editing in Fraxinus mandshurica. For. Res. 2025, 5, e016. [Google Scholar] [CrossRef] [PubMed]
Jof 12 00132 g001
Figure 1. Optimization of the preparation enzyme system for O. xuefengensis protoplasts. (A) Types of enzymes: L1: 1.5% lywallzyme 1, L2: 1.5% lywallzyme 2, L3: 50 U lyticase, L1 + S: 0.75% lywallzyme 1 and 0.75% snailase, L2 + S: 0.75% lywallzyme 2 and 0.75% snailase, L3 + S: 25 U lyticase and 0.75% snailase; (B) enzyme concentration: C1: 0.75% lywallzyme 1 and 0.75% snailase, C2: 1% lywallzyme 1 and 1% snailase, C3: 1.25% lywallzyme 1 and 1.25% snailase, C4: 1.5% lywallzyme 1 and 1.5% snailase. Values are presented as mean ± SD (n = 3). Significance analysis between two different groups: ** p < 0.01, *** p < 0.001.
Figure 1. Optimization of the preparation enzyme system for O. xuefengensis protoplasts. (A) Types of enzymes: L1: 1.5% lywallzyme 1, L2: 1.5% lywallzyme 2, L3: 50 U lyticase, L1 + S: 0.75% lywallzyme 1 and 0.75% snailase, L2 + S: 0.75% lywallzyme 2 and 0.75% snailase, L3 + S: 25 U lyticase and 0.75% snailase; (B) enzyme concentration: C1: 0.75% lywallzyme 1 and 0.75% snailase, C2: 1% lywallzyme 1 and 1% snailase, C3: 1.25% lywallzyme 1 and 1.25% snailase, C4: 1.5% lywallzyme 1 and 1.5% snailase. Values are presented as mean ± SD (n = 3). Significance analysis between two different groups: ** p < 0.01, *** p < 0.001.
Jof 12 00132 g001
Jof 12 00132 g002
Figure 2. Optimization of the enzymatic digestion conditions for O. xuefengensis protoplasts. (A) fungal age; (B) enzymatic digestion time; (C) enzyme digestion temperature; (D) agitation speed. Values are presented as mean ± SD (n = 3). Significance analysis between two different groups: ** p < 0.01, *** p < 0.001.
Figure 2. Optimization of the enzymatic digestion conditions for O. xuefengensis protoplasts. (A) fungal age; (B) enzymatic digestion time; (C) enzyme digestion temperature; (D) agitation speed. Values are presented as mean ± SD (n = 3). Significance analysis between two different groups: ** p < 0.01, *** p < 0.001.
Jof 12 00132 g002
Jof 12 00132 g003
Figure 3. Effects of different regeneration media (PPY, PPDA, TB3) on O. xuefengensis protoplasts regeneration.
Figure 3. Effects of different regeneration media (PPY, PPDA, TB3) on O. xuefengensis protoplasts regeneration.
Jof 12 00132 g003
Jof 12 00132 g004
Figure 4. Sensitivity of wild-type strain HACM001 to hygromycin B. PY medium was supplemented with different concentrations of hygromycin B (100–600 μg/mL) and without hygromycin B (CK).
Figure 4. Sensitivity of wild-type strain HACM001 to hygromycin B. PY medium was supplemented with different concentrations of hygromycin B (100–600 μg/mL) and without hygromycin B (CK).
Jof 12 00132 g004
Jof 12 00132 g005
Figure 5. Comparison of colony regeneration before and after protoplasts transformed with pCAMBIA1300 and molecular verification of transformants. (A) The growth of protoplasts transformants with pCAMBIA1300 on PPY medium with hygromycin B. (B) The growth of wild-type protoplasts on PPY with hygromycin B. (C) PCR verification of the hygR gene (1315 bp) in wild-type (WT) and putative transformants (T1–T11) using gene-specific primers. M: marker. CK+: positive control (plasmid pCAMBIA1300).
Figure 5. Comparison of colony regeneration before and after protoplasts transformed with pCAMBIA1300 and molecular verification of transformants. (A) The growth of protoplasts transformants with pCAMBIA1300 on PPY medium with hygromycin B. (B) The growth of wild-type protoplasts on PPY with hygromycin B. (C) PCR verification of the hygR gene (1315 bp) in wild-type (WT) and putative transformants (T1–T11) using gene-specific primers. M: marker. CK+: positive control (plasmid pCAMBIA1300).
Jof 12 00132 g005
Jof 12 00132 g006
Figure 6. Analysis of genetic stability for hygR gene after four generation culture. (A) Phenotypes of wild type strain (WT) and O. xuefengensis transformed with pCAMBIA1300 plasmid (Transformant) under non-selective pressure condition (−) and selective pressure condition (+). (B) PCR amplification of the hygR gene in wild-type (WT, 1–6) and transformants (T, 7–12) under non-selective pressure condition (−) and selective pressure condition (+). M: marker. CK+: hygR gene positive control.
Figure 6. Analysis of genetic stability for hygR gene after four generation culture. (A) Phenotypes of wild type strain (WT) and O. xuefengensis transformed with pCAMBIA1300 plasmid (Transformant) under non-selective pressure condition (−) and selective pressure condition (+). (B) PCR amplification of the hygR gene in wild-type (WT, 1–6) and transformants (T, 7–12) under non-selective pressure condition (−) and selective pressure condition (+). M: marker. CK+: hygR gene positive control.
Jof 12 00132 g006
Jof 12 00132 g007
Figure 7. Elucidation of glycoside hydrolase gene cbhI exogenous expression in O. xuefengensis. (A) The construction of recombinant expression cassette pCAMBIA1300-CBHI. (B) PCR amplification of the gpd1 + cbhI gene (2026 bp). (C) Phenotypes of wild type strain (WT) and transformants (T1 and T4) on antibiotic medium (left), and SDS-PAGE analysis of the purified CBHI protein (right). (D) Enzyme activity analysis of the purified CBHI enzyme. CK+: positive control (plasmid pCAMBIA1300-CBHI). T1–4: transformant 1–4. M: marker.
Figure 7. Elucidation of glycoside hydrolase gene cbhI exogenous expression in O. xuefengensis. (A) The construction of recombinant expression cassette pCAMBIA1300-CBHI. (B) PCR amplification of the gpd1 + cbhI gene (2026 bp). (C) Phenotypes of wild type strain (WT) and transformants (T1 and T4) on antibiotic medium (left), and SDS-PAGE analysis of the purified CBHI protein (right). (D) Enzyme activity analysis of the purified CBHI enzyme. CK+: positive control (plasmid pCAMBIA1300-CBHI). T1–4: transformant 1–4. M: marker.
Jof 12 00132 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Feng, X.; Sheng, X.; Liu, J.; Zhou, R.; Yang, Z.; Tang, X.; Zhang, S. An Efficient and Stable PEG-Mediated Transformation System for Medicinal Fungus Ophiocordyceps xuefengensis: Optimization and Functional Validation. J. Fungi 2026, 12, 132. https://doi.org/10.3390/jof12020132

AMA Style

Feng X, Sheng X, Liu J, Zhou R, Yang Z, Tang X, Zhang S. An Efficient and Stable PEG-Mediated Transformation System for Medicinal Fungus Ophiocordyceps xuefengensis: Optimization and Functional Validation. Journal of Fungi. 2026; 12(2):132. https://doi.org/10.3390/jof12020132

Chicago/Turabian Style

Feng, Xiaoting, Xinyao Sheng, Jun Liu, Rongrong Zhou, Zhongxu Yang, Xiaojuan Tang, and Shuihan Zhang. 2026. "An Efficient and Stable PEG-Mediated Transformation System for Medicinal Fungus Ophiocordyceps xuefengensis: Optimization and Functional Validation" Journal of Fungi 12, no. 2: 132. https://doi.org/10.3390/jof12020132

APA Style

Feng, X., Sheng, X., Liu, J., Zhou, R., Yang, Z., Tang, X., & Zhang, S. (2026). An Efficient and Stable PEG-Mediated Transformation System for Medicinal Fungus Ophiocordyceps xuefengensis: Optimization and Functional Validation. Journal of Fungi, 12(2), 132. https://doi.org/10.3390/jof12020132

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop