Next Article in Journal
Invasive Aspergillosis with Intracranial Extension Initially Misdiagnosed as a Granulomatous Disease: A Case Report
Previous Article in Journal
Foliar Epichloë gansuensis Endophyte and Root-Originated Bacillus subtilis LZU7 Increases Biomass Accumulation and Synergistically Improve Nitrogen Fixation in Achnatherum inebrians
Previous Article in Special Issue
Isolation and Identification of Spoilage Fungi in Potato Fresh Wet Vermicelli and Inhibition Effect of Different Fungicides on Spoilage Fungi
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 11
Issue 7
10.3390/jof11070467
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Elicitor from Trichothecium roseum Activates the Disease Resistance of Salicylic Acid, Jasmonic Acid, and Ca2+-Dependent Pathways in Potato Tubers

by
Di Wang
,
Rong Liu
,
Haijue Zhang
,
Zhifei Pei
,
Xiaoyan Yu
,
Xueyan Ren
* and
Qingjun Kong
*
Xi’an Key Laboratory of Characteristic Fruit Storage and Preservation, Shaanxi Engineering Laboratory of Food Green Processing and Safety Control, College of Food Engineering and Nutritional Science, Shaanxi Normal University, Xi’an 710119, China
*
Authors to whom correspondence should be addressed.
J. Fungi 2025, 11(7), 467; https://doi.org/10.3390/jof11070467
Submission received: 2 April 2025 / Revised: 16 April 2025 / Accepted: 22 April 2025 / Published: 20 June 2025
(This article belongs to the Special Issue Control of Postharvest Fungal Diseases, 2nd Edition)
Browse Figures
Versions Notes

Abstract

:
The effects of a fungal elicitor from Trichothecium roseum on signal pathways of salicylic acid (SA), jasmonic acid (JA), and Ca2+ in potato tubers were investigated. The results showed that fungal elicitor treatment effectively inhibited the lesion diameter of Fusarium sulphureum in vivo, which was 17.5% lower than that of the control. In addition, fungal elicitor treatment triggered an increase in O2− production and H2O2 content. The fungal elicitor enhanced the activities and gene expression levels of isochorismate synthase (ICS), phenylalanine ammonia lyase (PAL), allene oxide cyclase (AOC), allene oxide synthase (AOS), lipoxygenase (LOX), and Ca2+-ATPase. Furthermore, the fungal elicitor promoted an increase in calmodulin (CaM) content. Protective enzymes (dismutase (SOD), catalase (CAT), polyphenol oxidase (PPO), chitinase (CHI), and β-1,3-glucanase (Glu)) and disease-resistance-related genes (PR1, PR2, and PDF1.2) were induced to be upregulated by elicitor treatment. These results indicated that the fungal elicitor induced disease resistance by accelerating the accumulation of reactive oxygen species (ROS), activating SA, JA, and Ca2+ signaling, and upregulating resistance genes. The results of this study revealed the molecular mechanism of fungal elicitor-induced resistance in the potato, which provides a theoretical basis for the mining of new, safe, and efficient elicitor-sourced antifungal agents and is of great importance for the effective control of potato dry rot disease.

1. Introduction

The potato (Solanum tuberosum L.) is a critical economic crop in China, and it is susceptible to pathogens during postharvest storage, potentially leading to spoilage and causing a great loss [1]. The common diseases affecting potato tubers include late blight, dry rot, soft rot, bud rot, ring rot, black heart rot, and hollow rot, with the principal one being dry rot caused by Fusarium spp. [2]. The toxins generated by Fusarium spp. include trichothecene mycotoxins, fumonisin mycotoxins, zearalenone, and moniliformin, which would harm people’s health and cause a series of diseases, for instance, acute poisoning, cancer, and abnormalities [3]. To solve these problems, antibacterial and antifungal agents are widely used to preserve potatoes and for their antibacterial activities [2]. However, serious side effects are caused by fungicides, including drug resistance, pollution of the environment, and risks to food safety [4]. Therefore, it is essential to find an environmentally friendly and effective way to keep potato tubers from decaying and extend their shelf life.
Elicitors are a class of substances that can induce defensive responses to abiotic and biotic stresses in plants. Elicitors can induce the expression of disease-resistant genes and resistance proteins, thereby triggering defensive responses against pathogens in plants [5]. Elicitors are divided into biological and non-biological elicitors according to their source. Biological elicitors are divided into endogenous elicitors derived from plants and exogenous elicitors derived from pathogenic or non-pathogenic microorganisms, including polysaccharides, glycoproteins, polypeptides, proteins, oligosaccharides, etc. Non-biological elicitors mainly refer to some non-biological compounds or physical stimulation [6]. In recent years, fungal protein elicitors have attracted more and more attention for their regulation of stresses in plants [7,8]. Some protein elicitors have been separated from Magnaporthe oryzae [9], Alternaria tenuissima [10], Botrytis cinerea [11], and other fungal species, and can regulate signal transduction, activate the immune system, and thereby enhance plant defenses [9].
During the entire life cycle of growth and development, plants are vulnerable to the attacks of various pathogenic agents, such as viruses, bacteria, fungi, oomycetes, etc. Through long-term co-evolution with a variety of pathogenic agents, plants have evolved a diverse and sophisticated immune system. The innate immune system of plants consists of two different levels of responses: pathogen-associated molecular patterns (PAMPs)-triggered immunity (PTI) and effector-triggered immunity (ETI) [12]. The activation of PTI and/or ETI will trigger a series of immune responses, such as a burst of reactive oxygen species, a large influx of Ca2+, the activation of receptor-like cytoplasmic kinases (RLCKs), the mitogen-activated protein kinase (MAPK) cascade, and the transcriptional reprogramming of immune-related genes (including plant hormones, pathogenesis-related proteins, etc.) [13,14,15].
A burst of reactive oxygen species (ROS) is one of the primary immune responses of plants against pathogens. It not only directly inhibits the growth of pathogens but also prevents pathogen infection through cell wall thickening and can induce systemic acquired resistance (SAR) in plants [16]. However, excessive ROS production causes cellular oxidative damage to plant cells, leading to the acceleration of cellular senescence. To prevent this, the ROS scavenging system in plants is activated in response to oxidative stress, which includes antioxidant substances (ascorbic acid (AsA), glutathione (GSH), polyphenols, and flavonoids) and antioxidant enzymes (superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and polyphenol oxidase (PPO)) [17]. The antioxidative effects of fungal elicitors have been reported in the grapefruit [18], tomato [19], and broccoli leaf [5]. ROS metabolism is currently receiving attention as a potentially effective target for fungal disease in horticultural products; however, there are few studies thus far on fungal elicitor-mediated ROS production and its interaction with other signaling molecules.
Jasmonic acid (JA) and salicylic acid (SA) are two of the most crucial defense hormones in plants for coping with biotic stresses. JA and SA can activate the signal transduction pathways of JA and SA, as well as the expression of defense genes. They also promote the synthesis or release of resistant metabolites, enzymes, volatile compounds, and other substances within plants, thereby enhancing the plants’ resistance [20,21]. SA is a phenolic compound in plants. Besides participating in the regulation of normal plant physiological activities as a hormone, SA can also act as a key signaling molecule during the plant immune process, triggering the plants to develop systemic resistance against pathogenic agents. JA, a derivative of fatty acids, serves as an endogenous signaling molecule in plants. JA not only regulates plant growth and development but also participates in the response to various biotic and abiotic stresses by inducing the expression of defense genes and the synthesis of resistant substances. The disease-resistant effects of JA and SA have been confirmed in numerous plant species, such as tomatoes, bananas, and cotton. Furthermore, research indicates that the exogenous application of JA and/or SA can also induce an increase in the activity of defense-related substances, such as peroxidase (POD), in various plants, including Arabidopsis thaliana [22], rice [23], winter wheat [24], peach [25], and kiwifruit [26]. This enhancement contributes to improving the plants’ resistance to biotic stress.
Acting as a widespread signaling molecule within cells, Ca2+ is typically bound to calmodulin (CaM) and activates kinase proteins in response to abiotic and biotic stress, regulating physiological metabolism and gene expression in plants [27]. Studies have shown that Ca2+ is closely related to plant disease resistance. Song et al. [28] found that exogenous Ca2+ treatment could induce an increase in endogenous Ca2+ concentrations in blueberry leaves, enhancing resistance to Botrytis cinerea. In tomatoes, elevated Ca2+ levels were found to stimulate the accumulation of phytochemicals and activate phenylalaninammo-nialyase (PAL) [29]. It has also been reported that Ca2+ might enhance resistance to Botryosphaeria dothidea by increasing antioxidant capacity in pear fruit [30].
Numerous reports have centered on the pathogenicity of Trichothecium roseum towards fruits and vegetables, while its potential positive applications have been given far less attention [31]. Although previous studies have shown that elicitors can induce disease resistance in various plants, the impact of an elicitor from T. roseum specifically on induced resistance has remained poorly understood in potato tubers. In our previous studies, a fungal elicitor named elicitor was isolated and purified from T. roseum, which was proven to be able to initially activate phenylaprapanoid metabolism and induce disease resistance in potatoes [32]. However, its detailed regulatory mechanism is unclear. With this in mind, the current study aimed to investigate changes in the signaling pathways of salicylic acid (SA), jasmonic acid (JA), and Ca2+ in order to illustrate the regulatory mechanisms underlying induced resistance.

2. Materials and Methods

2.1. Chemicals and Reagents

Potato dextrose agar (PDA) and potato dextrose broth (PDB) were obtained from Solarbio Chemical Co. (Beijing, China). All other reagents were of analytical grade and bought from Beijing Chemical Corporation (Beijing, China).

2.2. Collection, Treatment, and Storage of Potato Tubers, Pathogens, and the Fungal Elicitor

Fusarium sulphureum was obtained from the Institute of Plant Protection, Gansu Academy of Agricultural Sciences, China. The F. sulphureum was cultured on potato dextrose agar (PDA) for seven days, and the spore suspension (106 spores × 10−3 L−1) was prepared for inoculation.
The identification, isolation, and purification of fungal elicitors were performed according to the method of Yu et al. [32]. The mycelia of T. roseum were collected after seven days of growth in potato dextrose broth (PDB) at 25 °C and dried with a suction filter device. The mycelia were extracted with Tris-HCl buffer (pH 7.0) to prepare the elicitor. After centrifugation at 12,000× g for 30 min and purification with an ammonium sulfate precipitation, the fungal elicitor was obtained. The protein concentration was measured as described in Bradford [33].
Potato tubers (Solanum tuberosum cv. Xindaping) at optimum maturity (firmness of 50 N ± 1 N, total soluble solid content of 5.8% ± 6.6%, and starch content of 13.9% ± 0.3%) were collected from a market (Dingxi city, Gansu province, China) and transported to the laboratory for immediate treatment. The potato tubers collected were of the same size and without surface blemishes. The tubers were washed and dipped into sodium hypochlorite before treatment. After washing with sterile water, the potato tuber was air-dried. During the storage period, potato samples were stored at 5 °C.
Based on our previous study [32], potato tubers were cut into slices (35 mm in diameter and 10 mm in thickness). Then, 20, 40, 60, and 80 μg mL−1 of elicitor solution were applied to the surface of the potato slices, and sterile water was used as the control. Agar discs containing F. sulphureum mycelium were taken with a punch and inoculated in the center of the potato slices. All inoculated slices were incubated in the dark at 25 °C for 0, 2, 4, 8, 12, 24, 48, and 72 h, and then 3.0 g of tissue (3 mm in thickness) was collected. Each treatment consisted of 360 slices (3 replicates of 120 each). The tissue samples were promptly frozen in liquid nitrogen and stored at −80 °C for in-depth analysis.

2.3. In Vivo Inhibitory Activity Assessment of the Elicitor

F. sulphureum was cultured on potato dextrose agar (PDA) for seven days, and the spore suspension (106 spores × 10−3 L−1) was prepared for inoculation. In total, 300 potatoes were selected and randomly divided into two groups of 150 (control group and elicitor-treated group), with 3 replicates of 50 each. The potato’s surface was sterilized with 75% alcohol and air-dried, and then the surface of the tubers was punched uniformly with a perforator (4 mm in diameter). The holes were inoculated with 20 μL of the spore suspension, dried, and stored at 22 (±2 °C). Potato samples in the elicitor-treated group were sprayed with 20, 40, 60, and 80 μg mL−1 of the elicitor at room temperature, and the control group was sprayed with sterile water. Wounded and inoculated potatoes were stored at 22 °C, and the diameters of the dry rot lesions were determined using the criss-cross method after 16 d.

2.4. The Rate of Superoxide Anion (O2·−) Production and Hydrogen Peroxide (H2O2) Content Assay

The H2O2 content was determined using an H2O2 assay kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China) following the manufacturer’s instructions. The H2O2 content was expressed based on the fresh weight as μmol g−1.
The production of O2·− was determined by inhibition and using the superoxide anion assay kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), following the manufacturer’s instructions. The production rate of O2·− was expressed based on the fresh weight as μmol g−1 min−1.

2.5. Detection of SA Content and Activities of Isochorismate Synthase (ICS) and PAL

The salicylic acid content was determined following the method of Pál et al. [34], with slight modifications. Frozen samples (0.1 g) were weighed and crushed with liquid nitrogen. A total of 20 mL of 90% methanol was added, vortexed for 1 min, and then centrifuged at 12,000× g for 30 min to collect the supernatant. The supernatant was collected by centrifugation at 12,000× g for 30 min after vortexing for 1 min. The supernatant was combined, dried with a rotary evaporator, and dissolved in 15 mL of 5% trichloroacetic acid. Then, it was extracted by adding 40 mL of a mixture of ethyl acetate and cyclohexane (1:1, v/v). The extraction was repeated once and the organic phases were combined, transferred to a rotary evaporator, dried, fixed with 10 mL (0.2 M, pH 5.5) sodium acetate, and stored at 4 °C after filtration through a 0.45 μm filter membrane. It was determined by high-performance liquid chromatography. The chromatographic parameters were as follows: column: Waters HSS T3 (50 × 2.1 mm, 1.8 μm); mobile phases: A: methanol; B: sodium acetate (6:4, v/v; pH 5.5); detection wavelength: 320 nm; flow rate: 0.8 mL min−1; column temperature: 30 °C; injection volume: 20 μL.
The ICS assay was performed according to the method of Poulsen et al. [35], with slight modifications. Frozen samples were completely crushed under liquid nitrogen, mixed with the ICS enzyme extract (0.1 M Tris-HCl at pH 7.5, 10% glycerol, 1 mM DTT, 0.2 mM PMSF, 1 mM EDTA), and centrifuged at 13,000× g for 20 min at −4 °C. The supernatant was taken as 125 μL, and the same volume of the reaction solution was added and mixed well (0.1 mM pH 7.5 Tris-HCl, 1 mM chorismate, 10 mM MgCl2). This was kept at 30 °C for 1 h and the reaction was completed with the reaction solution. At the end of the reaction, 62.5 μL of termination solution (methanol:sec-butanol [1:1, v/v]) was added to the sample tube. In the control tube, the enzyme solution was replaced by the termination solution and kept at 30 °C for 1 h. Finally, 100 μL of the reaction mixture was mixed with 1.4 mL of NaH2PO4 buffer (pH 7.0), and the fluorescence detector (FLD) values were determined using a HITACHI F-2700 fluorescence spectrophotometer (the excitation wavelength was 302 nm and the emission wavelength was 412 nm). The mixture was boiled for 15 min and cooled to room temperature. The FLD value was measured again, and the difference between the FLD values before and after heating was used to calculate the ICS enzyme activity.
PAL activity was measured by a PAL test kit from Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), following the instructions of the test kit. PAL activity was expressed based on the fresh weight as U g−1.

2.6. Detection of JA Content and Activities of Allene Oxide Cyclase (AOC), Allene Oxide Synthase (AOS), and 13-Lipoxygenase (LOX)

The jasmonic acid content was determined using the method of Li et al. [36], with slight modifications. Frozen samples (0.1 g) were crushed with liquid nitrogen. The supernatant was then centrifuged at 13,000× g for 10 min at 4 °C for 10 min. The supernatant was purified through a C-18 column and stored in a refrigerator at 4 °C for the determination of jasmonic acid using high-performance liquid chromatography (HPLC). The separation was performed on a Waters HSS T3 column (50 × 2.1 mm, 1.8 μm) with the mobile phases A: ultrapure water (containing 0.1% acetic acid) and B: acetonitrile (containing 0.1% acetic acid), and a gradient elution (0–15 min, 15%→35% A; 15–40 min, 35%→80% A) at a flow rate of 0.3 mL/min and a column temperature of 40 °C. The injection volume was 2 μL. The jasmonic acid content was expressed based on the fresh weight as mg g−1.
AOC activity was determined using an AOC ELISA kit (Camilo Bioengineering Co., Ltd., Nanjing, China), following the instructions of the test kit. AOC activity was expressed based on the fresh weight as U g−1.
AOS activity was determined using an AOS ELISA kit (Camilo Bioengineering Co., Ltd., Nanjing, China), following the instructions of the test kit. AOS activity was expressed based on the fresh weight as U g−1.
LOX activity was measured using a LOX Assay Kit test kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), following the instructions of the test kit. PAL activity was expressed based on the fresh weight as U g−1.

2.7. Detection of Calmodulin (CaM) Content and Ca2+-ATPase Activity

CaM content was determined using a CaM ELISA kit (Shanghai Sailing Biological Institute, Shanghai, China), following the instructions of the test kit. CaM content was expressed based on the fresh weight as ng g−1.
Ca2+-ATPase activity was measured using a Ca2+-ATPase test kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), following the instructions of the test kit. Ca2+-ATPase activity was expressed based on the protein level as μmol Pi mg−1 port h−1.

2.8. Detection of SOD, CAT, PPO, Chitinase (CHI), and β-1,3-Glucanase (Glu) Activities

SOD activity was determined using a SOD test kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), following the instructions of the test kit. SOD activity was expressed based on the fresh weight as U g−1.
CAT activity was determined using a CAT test kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), following the instructions of the test kit. CAT activity was expressed based on the fresh weight as U g−1.
PPO activity was determined using a PPO test kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), following the instructions of the test kit. PPO activity was expressed based on the fresh weight as U g−1.
CHI activity was determined using a CHI test kit (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China), following the instructions of the test kit. CHI activity was expressed based on the fresh weight as U g−1.
β-1,3-glucanase activity was determined using a β-1,3-glucanase test kit (Beijing Solaibao Technology Co., Ltd., Beijing, China), following the instructions of the test kit. β-1,3-glucanase activity was expressed based on the fresh weight as U g−1.
The Coomassie Brilliant Blue method was used to quantify the protein content [33].

2.9. Gene Expression Analysis Using Quantitative Real-Time PCR (qRT-PCR)

Total RNA was isolated from ground tissues using the cetyltrimethylammonium bromide (CTAB) method and extracted using a Takara RNA extraction kit (Takara Biotechnology, Shiga, Japan). First-strand cDNA was synthesized using a first-strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China).
The corresponding F. sulphureum nucleotide sequences were obtained from the GENBANK database and used to design gene-specific primer pairs by employing Primer 5.0 software (Table 1). qRT-PCR was performed to measure the expression levels of F. sulphureum genes. The SYBR Green PCR Premix Ex Taq ™ (Takara Biomedicals, Shiga, Japan), cDNA, forward and reverse primers, and ROX reference dye II were added to an ABI 7000 instrument (Applied Biosystems, Foster City, CA, USA) for the reaction. The operation was as follows: at 95 °C for 10 s, at 95 °C for 5 s with 40 cycles, and at 60 °C for 40 s. The F. sulphureum actin gene (StActin, X55751.1) was the internal reference. Relative quantifications were then calculated using the 2−∆∆CT method, and the CT values from the F. sulphureum actin gene were used to normalize all qRT-PCR reactions.

2.10. Statistical Analysis

Each treatment included three biological replicate samples, and the SPSS11.0 software package (SPSS Inc., Chicago, IL, USA) was used to analyze the data. Data were subjected to one-way analysis of variance (ANOVA) and Duncan’s post hoc test, where significance was set at a p-value < 0.05. The resulting data are presented using the mean ± standard deviation.

3. Results

3.1. Effect of the Elicitor on Spore Germination and the Lesion Diameters of Dry Rot Disease of Potato Tubers In Vivo

All concentrations of elicitor treatments did not significantly inhibit F. sulphureum spore germination compared to the control (p < 0.05) (Figure 1A). The potato tuber inoculation result showed that the 20 μg mL−1 and 40 μg mL−1 elicitor treatments did not significantly inhibit or promote the mycelial growth of F. sulphureum, and 60 μg mL−1 and 80 μg mL−1 elicitor treatments significantly inhibited the growth at the late stage (p < 0.05). On the 7th day, 60 μg mL−1 and 80 μg mL−1 elicitor treatments significantly inhibited the growth of F. sulphureum mycelia in the group, which decreased by 39.78% and 13.98%, respectively, compared with the control group at day 7 (Figure 1B).

3.2. Effect of the Elicitor on the Generation of O2·− and the Content of H2O2

As shown in Figure 2A, the content of H2O2 in all groups increased in the early stages. The H2O2 content in the elicitor group peaked at 2 h and 8 h, which were 23.3% and 19.1% higher than the control, respectively. Afterward, the content of H2O2 decreased, which was lower than that of the control group at 48 h. The H2O2 content of the control group reached a maximum at 72 h, which was 1.6 times that of the elicitor group. The production of O2·− of the elicitor group increased significantly compared to the control group in the first 24 h of storage. The O2·− production of the elicitor group peaked at 8 h, which was 2.27 times that of the control group (Figure 2B). The elicitor-treated and control groups both showed peaks at 8 and 48 h, respectively, which then declined. H2O2 accumulation in tubers was observed using DAB staining. As can be seen from the figure, compared to 0 h, 2 h after exciton treatment, a large amount of H2O2 had accumulated in the potato tubers of the treatment group compared to the control group (Figure 2C–E).

3.3. Effect of the Elicitor on SA Synthesis

As shown in Figure 3, elicitor treatment significantly induced the synthesis and accumulation of SA in the potatoes (p < 0.05). The SA content gradually increased, reaching a peak at 8 h, and then gradually decreased, with the SA content in the elicitor-treated group being 33.3% higher than that of the control group at 8 h (Figure 3A). ICS and PAL enzyme activities were activated by elicitor treatment and were significantly higher than those of the control group (p < 0.05) from 2 h−72 h. ICS enzyme activity peaked at 8 h and 48 h (Figure 3B). PAL activity peaked at 24 h, when it was 74.8% higher than that of the control group (p < 0.05) (Figure 3C).

3.4. Effect of the Elicitor on the Expression of Key Genes Related to the SA Signaling Pathway

As shown in Figure 4, the qRT-PCR results indicated that the expression levels of StICS and StPAL, the key genes for salicylic acid synthesis, were significantly upregulated in the elicitor-treated group from 8 h onwards, and the expression levels of StICS and StPAL peaked at 48 h and 24 h, at which time they were 2.88 times and 2.10 times of those in the control group, respectively (Figure 4A,B). Enhanced disease susceptibility 1 (StEDS1) (Figure 4C) and phytoalexin decient 4 (StPAD4) (Figure 4D), which are located upstream of the signaling pathway that promotes salicylic acid synthesis, were significantly upregulated at the early stages of elicitor treatment, and their expression levels were maintained at high levels from 8h to 72 h after elicitor treatment. In the salicylic acid signaling pathway, the expression levels of the salicylic acid receptor regulator, non-expressor of pathogenesis-related genes 1 (StNPR1) (Figure 4E), the transcription factor TGACG motif-binding factor (StTGA) (Figure 4F), and the conserved heptapeptide motif WRKYGQK 1 (StWRKY1) (Figure 4G) were upregulated at 8 h after elicitor treatment. The expression levels of StNPR1 peaked at the end of the treatment period (48 h and 72 h), when they were 3.20 times and 2.37 times higher than that of the control group, respectively. StTGA expression levels were significantly upregulated (p < 0.05) at 8 h and 12 h, when they were 16.8 times and 6.61 times higher than those of the control group, respectively, and then began to gradually decline. At 48 h, StWRKYl (Figure 4G) expression was 1.40 times higher than that of the control group. The expression levels of pathogenesis-related 1 (StPR1) and StPR2 (Figure 4G,H), which are important disease-course-related genes in the salicylic acid signaling pathway, were gradually increased by elicitor treatment at 8 h, and remained at a high expression level for 48 h.

3.5. Effect of the Elicitor on JA

As shown in Figure 5, elicitor treatment significantly induced the synthesis and accumulation of JA in potatoes (p < 0.05). The JA content increased gradually, reaching a peak at 12 h when the JA content of the elicitor-treated group was 60.1% higher than that of the control group (Figure 5A). The activities of the key enzymes for JA synthesis, AOC, AOS, and LOX, were activated by elicitor treatment and were significantly higher than those of the control group at the late stages of treatment (p < 0.05) (Figure 5B–D). AOS activity peaked at 8 h and 48 h, when AOS activity was 27.2% and 44.3% higher than that of the control group, respectively (Figure 5C). LOX activity peaked at 24 h, when LOX activity was 55.8% higher than that of the control group (Figure 5D).

3.6. Effect of the Elicitor on the Expression of Key Genes Related to the JA Signaling Pathway

As shown in Figure 4, the qRT-PCR results indicated that the expression levels of the key enzymes of jasmonic acid synthesis, the StAOS and StLOX genes, were significantly upregulated in the elicitor-treated group from 8 h (Figure 6B,C), and the expression level of the StAOC gene was significantly upregulated in the elicitor-treated group from 12 h (Figure 6A). At 24 h, the expression levels of StAOS, StLOX, and StAOC in the elicitor-treated group were 6.33 times, 5.50 times, and 5.31 times higher than those of the control group at 24 h, respectively. The expression levels of StOPR3, the key gene for JA synthesis, and the key regulator of the pathway, jasmonate ZIM-domain 1 (StJAZ1), gradually increased from 12 h and peaked at 72 h (Figure 6F,H). The expression levels of the JA pathway regulator Stcoronatin insensitive 1 (COI1) and the transcription factor myelocytomatosis 2 (StMYC2) tended to increase and then decrease, peaking at 12 h, at which time the expression levels of StCOI1 and StMYC2 in the elicitor-treated group were 1.28 times and 1.67 times higher than those in the control group, respectively (Figure 6G,I). In addition, the JA pathway-mediated defense gene plant defensin 1.2 (StPDF1.2) was significantly upregulated by the elicitor, and its expression level remained high from 2 h to 72 h.

3.7. Effect of the Elicitor on the Calcium Signaling Pathway

The elicitor treatments induced CaM accumulation in potato tubers throughout the whole storage period. The CaM content reached a peak at 12 h and 48 h, respectively, when the activity was 1.07 times and 1.23 times higher than in the control group (Figure 7A). The Ca2+-ATPase activity of the elicitor group increased and peaked at 8 h, when it was 2.67 times higher than in the control group (Figure 7B). The qRT-PCR results showed that the expression level of StCa2+-ATPase in the elicitor group significantly increased at 2 h and 8 h after treatment, when it was 7.84 times and 19.1 times that of the control group, respectively (Figure 7C).

3.8. Effect of the Elicitor on the Activities of Defense-Related Enzymes

As shown in Figure 8A, the SOD activity of the elicitor group increased and peaked at 12 h, when it was 1.81 times that of the control group. The change in the CAT activity of the elicitor groups was increased in the early stages and then decreased (Figure 8B). The CAT activities of the elicitor group reached their maximum at 4 h, when they were 1.61 times those of the control group. Compared to the control group, PPO activities increased in the elicitor group (Figure 8C). The PPO activities peaked at 24 h in the elicitor-treated group before declining and being maintained at a stable active level (Figure 8C). As shown, the elicitor treatment induced an increase in CHI activity, which reached its maximum at 24 h, when it was 1.10 times higher than that of the control group during the same period (Figure 8D). Elicitor treatment resulted in an increase in β-1,3-glucanase activity at later stages, which was 31.9% higher than the controls at the end of treatment (Figure 8E).

3.9. Effect of the Elicitor on the Gene Expression Levels of Defense-Related Genes

The expression levels of StSOD (Figure 9A) and StCAT (Figure 9B) in the elicitor-treated group increased. The expression levels of StSOD in the elicitor groups reached their maximum at 12 h, when they were 2.22 times that of the control group. StCAT reached its highest levels at 4 h, when it was 2.18 times that of the control group. The expression levels of StPPO and StCHI in the elicitor group significantly increased and peaked at 24 h after treatment, when they were 3.07 times and 2.04 times that of the control group, respectively (Figure 9C,D). StGlu was significantly upregulated (p < 0.05) in the later stages of elicitor treatment, with peak expression levels at 24 h, and remained highly expressed from 24 h to 48 h (Figure 9E).

4. Discussion

There have been a large number of studies on whether elicitors could effectively stimulate plant autoimmunity and improve their disease resistance. The use of elicitors to induce disease resistance for the protection of plants has been reported in various horticultural products [37]. At the same time, fungal elicitors would not cause the generation of pathogen resistance as a result of acting on the plant. Hence, some speculated that fungal elicitor products have great potential for bacteriostasis [5]. This study indicated that the elicitor-treated group exhibited significant inhibition effects in potato tubers in vivo and in PDA plate culture media compared to the control group (Figure 1A,B). In tobacco leaves, elicitors from Alternaria tenuissima improved resistance to the tobacco mosaic virus (TMV) [10]. Similar effects of fungal elicitors on postharvest products have been reported in apples [38], pears [39], and cucumbers [40], among others.
Fungal infections could induce the massive production and accumulation of ROS in plants, which was also considered one of the earliest responses of host plants to pathogen invasion. Early ROS production could induce multiple resistance responses in the host, such as cell wall thickening, a hypersensitive response (HR), activation of resistance genes, and accumulation of resistant substances [20]. According to the results of this study, treatment with fungal inducer 80 could induce the rapid accumulation of O2·− and H2O2 in potato tubers during the early stages (Figure 2). It has also been reported that elicitors from B. cinerea improved disease resistance in Arabidopsis thaliana by accelerating ROS accumulation in the early stages [41]. In addition, oxidative burst and nitric dioxide (NO) accumulation have been observed in moss plants [42] and cotton [43], which supported the conclusion that fungal elicitors could induce a rapid increase in H2O2 and NO production, leading to enhanced resistance against pathogens.
In response to pathogen invasion, plants can precisely adjust their metabolites to defend against pathogen infection and maintain normal physiological states [44]. As defensive secondary metabolites, plant hormones are extensively involved in plant immune responses to pathogenic bacteria, among which the defensive regulatory roles of SA and JA have been well-studied [45]. ICS and PAL are key enzymes in the SA biosynthesis pathway, regulating SA production through distinct synthetic routes [46]. EDS1 and PAD4, located upstream of the SA signaling pathway, amplify SA signals via SA-associated feedback loops to promote SA production [47]. Accumulated SA activates the expression of the downstream receptor regulatory factor NPR1 and facilitates its binding with TGA transcription factors to trigger the expression of pathogenesis-related proteins [48]. Additionally, SA accumulation induces WRKY1 expression, promoting the transcriptional binding of WRKY1 with PR1 and PR2 to enhance plant disease resistance [49].
Pathogenesis-related proteins (PRs) are a class of proteins induced and expressed in plants upon pathogen infection. The plant PR protein family consists of 17 members, with most PRs exhibiting antifungal activity [50]. PR1 not only possesses antimicrobial activity but also induces stress resistance in plants, being recognized as a marker of plant disease resistance and systemic acquired resistance [50]. PR2 belongs to the β-1,3-glucanase family and degrades β-1,3-glucans in fungal cell walls, thereby inhibiting fungal growth and spread [51]. Studies have shown that the salicylic acid signaling pathway induces the expression of PR2, aiding plants in establishing long-term immunity against pathogens and playing a crucial role in plant acquired resistance. This study reveals that elicitors extracted from T. roseum upregulate the activity and gene expression of key SA biosynthesis enzymes (ICS and PAL) and trigger the expression of upstream SA signaling genes EDS1 and PAD4 in the early stages, promoting SA production. SA accumulation further enhances the expression of regulatory factors NPR1, TGA, and WRKY1, subsequently leading to the high-level expression of PR1 and PR2 genes. These findings are consistent with previous results where the elicitor AsES, derived from Acremonium strictum, upregulated the expression and content of SA pathway genes in Arabidopsis, induced high-level expression of ArPR1, and promoted systemic resistance of Arabidopsis against Botrytis cinerea [52].
JA synthesis can be accelerated under biotic and abiotic stress conditions. Its biosynthesis starts with α-linolenic acid (LeA), which is converted to 13-hydroperoxylinolenic acid (13-HPOTE) by LOX. 13-HPOTE is catalyzed by AOS and AOC to produce 12-oxo-phytodienoic acid (OPDA), which is then converted to JA by the action of OPDA reductase (OPR3) to produce JA [53]. JAZ and COI1 are important regulators in the jasmonate pathway. The transcription factor MYC2 is a key regulator in the JA signaling pathway [53]. In strawberry fruit, exogenous methyl jasmonate (JA donor) treatment initiated a defense response mediated by the upregulation of different defense-related genes and was accompanied by the upregulation of MYC2 and JAZ1 [54]. PDF1.2 encodes a plant defensin, which is induced by JA, ethylene, fungal infections, and ROS [52]. It has been shown that JA and ethylene synergistically induce the expression of defense-related genes in a wide range of plants [52]. The present study showed that the elicitor induced and increased the SA content and the activities of LOX, AOS, and AOC in potato tubers (Figure 5). The underlying mechanism is to upregulate the expression of genes related to JA synthesis at the transcriptional level (Figure 6). In addition, the expression of key regulatory genes of the JA pathway, OPR3, COI1, JAZ1, MYC2, and PDF1.2, was upregulated accordingly, which may play a positive role in enhancing resistance in potatoes [55]). Hanan et al. (2020) also found that fungal elicitors activated the expression of LOX, AOS, and AOC, promoted JA accumulation, and enhanced resistance to Myzus persicae in tomato plants [56]. Another study found that an elicitor from Lecanicillium lecanii induced upregulation of LOX, AOS, AOC, and PR1 expression and promoted JA accumulation in tomato plants, thereby increasing the resistance of tomatoes to Myzus persicae [57]. It has been shown that elicitors from Acremonium strictum induced the upregulation of PDF1.2, AOS, and PR1, thereby enhancing disease resistance to Boytrytis cinerae in Arabidopsis, which is consistent with our results [52]. These results support the notion that elicitor-enhanced pathogen resistance in potato tubers may be due to early SA accumulation and the activation of related defense genes.
Early signaling molecules, including Ca2+, NO, and ROS, were induced by elicitors in plants, and these signal molecules interact with downstream signals to activate plant defense responses [58]. Ca2+ is crucial for transmembrane transport and signal transduction, and CaM may act as a receptor or a messenger in this process [27]. This study indicated that the elicitor accelerated CaM accumulation and increased the activities of Ca2+-ATPase and NADPH oxidases (NOX), resulting in a higher intracellular ROS level in the early stages and improved disease resistance in potato tubers. In particular, Ca2+ may be involved in upstream signaling pathways induced by the elicitor. Research on rice demonstrated that Ca2+ stimulated defense responses against blast fungus infections, while the blockade of Ca2+ signaling (treatment with a Ca2+ inhibitor) reduced this effect [59]. Able et al. [60] have come up with similar results. It has been found that disease resistance was positively associated with Ca2+ content in tobacco. These findings support our speculations.
Although ROS are essential for enhancing disease resistance in plants, the excessive accumulation of ROS can be detrimental to plant cells, leading to lipid peroxidation and damage to membrane lipids and proteins. The plant antioxidant system consists of antioxidant enzymes such as SOD, CAT, and PPO, which are responsible for scavenging excess ROS and protecting plants from oxidative damage [17]. In the present study, we showed that the fungal elicitor increased the activities of SOD, CAT, and PPO in potato tubers (Figure 8A–C). The underlying mechanism involved upregulating the expression of genes related to oxidation–reduction reactions at the transcriptional level (Figure 9). Gao et al. [61] found that an endophytic fungal elicitor could activate SOD and CAT, thereby improving the plant’s defense response. Another study revealed that an elicitor from Trichoderma harzianum increased SOD, CAT, and PPO activity and regulated antioxidant activity in tomato plants, conferring resistance to Fusarium wilt disease [19]. These results further support the opinion that elicitor-enhanced pathogen resistance in potato tubers is probably due to early ROS burst induction and the activation of antioxidant defense.
The above results suggest that fungal elicitor treatments improved disease resistance in potato tubers and reduced the impact of disease development by inducing ROS accumulation and activating SA, JA, and Ca2+ signaling pathways. Furthermore, it is reasonable to speculate that SA, JA, and CaM accumulation may be associated with ROS production and that these signaling molecules are involved in defense responses and mediate inducer-induced host resistance at an early stage. In addition, whether Ca2+ signaling is involved in SA, JA, or ethylene-interacting signaling pathways requires further investigation.

5. Conclusions

In conclusion, the present study demonstrated that a fungal elicitor from T. roseum can induce systemic resistance against F. sulphureum in potato tubers. The growth of F. sulphureum was inhibited by increasing SA and JA content and improving ROS levels. In addition, the fungal elicitor induced the activities and gene expression levels of ICS, PAL, AOC, AOS, LOX, and Ca2+-ATPase, and maintained high levels of SA and JA in potato tubers. Upregulation of resistance genes (SOD, CAT, PPO, CHI, Glu, PR1, PR2, and PDF1.2) may also play a positive role in potato defenses against F. sulphureum. The above results indicate that SA, JA, and CaM signaling pathways were activated, which might have contributed to the enhanced resistance against F. sulphureum in potato tubers. However, considering that disease resistance is likely to be modulated by multiple pathways, further studies should be performed to explore other potential factors and their underlying mechanisms.

Author Contributions

D.W.: conceptualization, data curation, formal analysis, writing—original draft preparation, revision and editing. R.L.: writing—original draft preparation. H.Z.: writing—review and editing. Z.P.: Resources, Visualization. X.Y.: Validation, Writing—review and editing. X.R.: writing—review and editing, Resources. Q.K.: writing—review and editing, supervision, funding acquisition, resources. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by National Natural Science Foundation of China (32402199), the Shaanxi Postdoctoral Fund (2023BSHEDZZ205), China Postdoctoral Science Foundation Funded Project (2023M742190).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Tiwari, R.K.; Kumar, R.; Sharma, S.; Sagar, V.; Aggarwal, R.; Naga, K.C.; Lal, M.K.; Chourasia, K.N.; Kumar, D.; Kumar, M. Potato Dry Rot Disease: Current Status, Pathogenomics and Management. 3 Biotech 2020, 10, 503. [Google Scholar] [CrossRef] [PubMed]
  2. Li, L.; Xue, H.; Bi, Y.; Zhang, R.; Kouasseu, C.J.; Liu, Q.; Nan, M.; Pu, L.; Prusky, D. Ozone Treatment Inhibits Dry Rot Development and Diacetoxyscirpenol Accumulation in Inoculated Potato Tuber by Influencing Growth of Fusarium sulphureum and Ergosterol Biosynthesis. Postharvest Biol. Technol. 2022, 185, 111796. [Google Scholar] [CrossRef]
  3. Xue, H.-L.; Bi, Y.; Tang, Y.-M.; Zhao, Y.; Wang, Y. Effect of Cultivars, Fusarium Strains and Storage Temperature on Trichothecenes Production in Inoculated Potato Tubers. Food Chem. 2014, 151, 236–242. [Google Scholar] [CrossRef] [PubMed]
  4. Li, Y.; Ma, Y.; Zhang, T.; Bi, Y.; Wang, Y.; Prusky, D. Exogenous Polyamines Enhance Resistance to Alternaria alternata by Modulating Redox Homeostasis in Apricot Fruit. Food Chem. 2019, 301, 125303. [Google Scholar] [CrossRef]
  5. De Britto, S.; Jogaiah, S. Priming with Fungal Elicitor Elicits Early Signaling Defense against Leaf Spot of Broccoli Underlying Cellular, Biochemical and Gene Expression. Microbiol. Res. 2022, 263, 127143. [Google Scholar] [CrossRef]
  6. Guarnizo, N.; Álvarez, A.; Oliveros, D.; Barbosa, O.; Joli, J.E.; Bermúdez-Cardona, M.B.; Murillo-Arango, W. Elicitor Activity of Curdlan and Its Potential Application in Protection of Hass Avocado Plants against Phytophthora cinnamomi Rands. Horticulturae 2022, 8, 646. [Google Scholar] [CrossRef]
  7. Zhang, Z.-H.; Jin, J.-H.; Sheng, G.-L.; Xing, Y.-P.; Liu, W.; Zhou, X.; Liu, Y.-Q.; Chen, X.-R. A Small Cysteine-Rich Phytotoxic Protein of Phytophthora capsici Functions as Both Plant Defense Elicitor and Virulence Factor. Mol. Plant Microbe Interact. 2021, 34, 891–903. [Google Scholar] [CrossRef]
  8. He, J.; Li, R.; Xu, C.; Chen, X.; Yao, J.; Li, Z.; Cheng, Y. Enhancing Fruit Resistance against Fungal Pathogens Using a Pathogen-Associated Molecular Pattern PdEIX. J. Agric. Food Chem. 2025, 73, 135–146. [Google Scholar] [CrossRef]
  9. Chen, M.; Zeng, H.; Qiu, D.; Guo, L.; Yang, X.; Shi, H.; Zhou, T.; Zhao, J. Purification and Characterization of a Novel Hypersensitive Response-Inducing Elicitor from Magnaporthe oryzae That Triggers Defense Response in Rice. PLoS ONE 2012, 7, e37654. [Google Scholar] [CrossRef]
  10. Kulye, M.; Liu, H.; Zhang, Y.; Zeng, H.; Yang, X.; Qiu, D. Hrip1, a Novel Protein Elicitor from Necrotrophic Fungus, Alternaria tenuissima, Elicits Cell Death, Expression of Defence-related Genes and Systemic Acquired Resistance in Tobacco. Plant Cell Environ. 2012, 35, 2104–2120. [Google Scholar] [CrossRef]
  11. González, M.; Brito, N.; González, C. The Botrytis cinerea Elicitor Protein BcIEB1 Interacts with the Tobacco PR5-family Protein Osmotin and Protects the Fungus against Its Antifungal Activity. New Phytol. 2017, 215, 397–410. [Google Scholar] [CrossRef]
  12. Jones, J.D.G.; Dangl, J.L. The Plant Immune System. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef] [PubMed]
  13. Yuan, M.; Jiang, Z.; Bi, G.; Nomura, K.; Liu, M.; Wang, Y.; Cai, B.; Zhou, J.-M.; He, S.Y.; Xin, X.-F. Pattern-Recognition Receptors Are Required for NLR-Mediated Plant Immunity. Nature 2021, 592, 105–109. [Google Scholar] [CrossRef]
  14. Yuan, M.; Ngou, B.P.M.; Ding, P.; Xin, X.-F. PTI-ETI Crosstalk: An Integrative View of Plant Immunity. Curr. Opin. Plant Biol. 2021, 62, 102030. [Google Scholar] [CrossRef]
  15. Bigeard, J.; Colcombet, J.; Hirt, H. Signaling Mechanisms in Pattern-Triggered Immunity (PTI). Mol. Plant 2015, 8, 521–539. [Google Scholar] [CrossRef] [PubMed]
  16. El-Shetehy, M.; Wang, C.; Shine, M.B.; Yu, K.; Kachroo, A.; Kachroo, P. Nitric Oxide and Reactive Oxygen Species Are Required for Systemic Acquired Resistance in Plants. Plant Signal. Behav. 2015, 10, e998544. [Google Scholar] [CrossRef]
  17. Wang, D.; Li, W.; Li, D.; Li, L.; Luo, Z. Effect of High Carbon Dioxide Treatment on Reactive Oxygen Species Accumulation and Antioxidant Capacity in Fresh-Cut Pear Fruit during Storage. Sci. Hortic. 2021, 281, 109925. [Google Scholar] [CrossRef]
  18. Pascale, A.; Vinale, F.; Manganiello, G.; Nigro, M.; Lanzuise, S.; Ruocco, M.; Marra, R.; Lombardi, N.; Woo, S.L.; Lorito, M. Trichoderma and Its Secondary Metabolites Improve Yield and Quality of Grapes. Crop Prot. 2017, 92, 176–181. [Google Scholar] [CrossRef]
  19. Zehra, A.; Meena, M.; Dubey, M.K.; Aamir, M.; Upadhyay, R.S. Synergistic Effects of Plant Defense Elicitors and Trichoderma harzianum on Enhanced Induction of Antioxidant Defense System in Tomato against Fusarium Wilt Disease. Bot. Stud. 2017, 58, 44. [Google Scholar] [CrossRef]
  20. Suleman, M.; Ma, M.; Ge, G.; Hua, D.; Li, H. The Role of Alternative Oxidase in Plant Hypersensitive Response. Plant Biol. J. 2021, 23, 415–419. [Google Scholar] [CrossRef]
  21. Zhang, P.; Jackson, E.; Li, X.; Zhang, Y. Salicylic Acid and Jasmonic Acid in Plant Immunity. Hortic. Res. 2025, 12, uhaf082. [Google Scholar] [CrossRef]
  22. Zhang, L.; Yang, S.; Xu, J.; Liu, T.; Yang, D.; Wu, Z.; Shao, M. Application of Exogenous Salicylic Acid on Improving High Temperature Resistance of Nannochloropsis oceanica. Aquacult. Int. 2020, 28, 2235–2246. [Google Scholar] [CrossRef]
  23. Tang, S.; Zhao, Y.; Ran, X.; Guo, H.; Yin, T.; Shen, Y.; Liu, W.; Ding, Y. Exogenous Application of Methyl Jasmonate at the Booting Stage Improves Rice’s Heat Tolerance by Enhancing Antioxidant and Photosynthetic Activities. Agronomy 2022, 12, 1573. [Google Scholar] [CrossRef]
  24. Wang, W.; Wang, X.; Huang, M.; Cai, J.; Zhou, Q.; Dai, T.; Jiang, D. Alleviation of Field Low-Temperature Stress in Winter Wheat by Exogenous Application of Salicylic Acid. J. Plant Growth Regul. 2021, 40, 811–823. [Google Scholar] [CrossRef]
  25. Chen, M.; Guo, H.; Chen, S.; Li, T.; Li, M.; Rashid, A.; Xu, C.; Wang, K. Methyl Jasmonate Promotes Phospholipid Remodeling and Jasmonic Acid Signaling to Alleviate Chilling Injury in Peach Fruit. J. Agric. Food Chem. 2019, 67, 9958–9966. [Google Scholar] [CrossRef]
  26. Li, S.; Xiao, L.; Chen, M.; Cao, Q.; Luo, Z.; Kang, N.; Jia, M.; Chen, J.; Xiang, M. The Involvement of the Phenylpropanoid and Jasmonate Pathways in Methyl Jasmonate-Induced Soft Rot Resistance in Kiwifruit (Actinidia chinensis). Front. Plant Sci. 2022, 13, 1097733. [Google Scholar] [CrossRef]
  27. Guo, S.; Zhang, Y.; Li, M.; Zeng, P.; Zhang, Q.; Li, X.; Xu, Q.; Li, T.; Wang, X.; Kang, Z.; et al. TaBln1, a Member of the Blufensin Family, Negatively Regulates Wheat Resistance to Stripe Rust by Reducing Ca2+ Influx. Plant Physiol. 2022, 189, 1380–1396. [Google Scholar] [CrossRef]
  28. Song, P.; Wang, Y.; Hou, Y.; Mao, X.; Liu, Z.; Wei, M.; Yu, J.; Wang, B.; Qian, Y.; Yan, L.; et al. Crucial Role of Ca2+/CN Signalling Pathway in the Antifungal Activity of disenecioyl-cis-khellactone against Botrytis cinerea. Pest. Manag. Sci. 2022, 78, 4649–4659. [Google Scholar] [CrossRef]
  29. Yu, H.; Du, X. Differential Regulation of Calmodulin, Phenylalanine Ammonia-Lyase, and Salicylic Acid in Response to Botrytis cinerea Infection in Tomato with Different Ca2+ Concentrations. J. Plant Nutr. 2018, 41, 1104–1118. [Google Scholar] [CrossRef]
  30. Sun, X.; Pan, B.; Wang, Y.; Xu, W.; Zhang, S. Exogenous Calcium Improved Resistance to Botryosphaeria dothidea by Increasing Autophagy Activity and Salicylic Acid Level in Pear. Mol. Plant-Microbe Interact. 2020, 33, 1150–1160. [Google Scholar] [CrossRef]
  31. Bi, Y.; Tian, S.P.; Guo, Y.R.; Ge, Y.H.; Qin, G.Z. Sodium Silicate Reduces Postharvest Decay on Hami Melons: Induced Resistance and Fungistatic Effects. Plant Dis. 2006, 90, 279–283. [Google Scholar] [CrossRef] [PubMed]
  32. Yu, X.; Bi, Y.; Yan, L.; Liu, X.; Wang, Y.; Shen, K.; Li, Y. Activation of Phenylpropanoid Pathway and PR of Potato Tuber against Fusarium sulphureum by Fungal Elicitor from Trichothecium roseum. World J. Microbiol. Biotechnol. 2016, 32, 142. [Google Scholar] [CrossRef] [PubMed]
  33. Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  34. Pál, M.; Szalai, G.; Lantos, E.; Nagyéri, G.; Janda, T. Comparative Study of Salicylic Acid Contents in Young Wheat and Rice Plants and Their Anticancer Activities in HepG2 and Caco-2 Cells. Biol. Futur. 2020, 71, 265–271. [Google Scholar] [CrossRef]
  35. Poulsen, C.; Van Der Heijden, R.; Verpoorte, R. Assay of Isochorismate Synthase from Plant Cell Cultures by High-Performance Liquid Chromatography. Phytochemistry 1991, 30, 2873–2876. [Google Scholar] [CrossRef]
  36. Li, S.; Ma, R.; Xu, J.; Shen, Z.; Yu, M. Effect of Melatonin Treatment on Improving Jasmonates Content and Cell Wall Stability Involved in Enhanced Chilling Tolerance of Peach Fruit during Cold Storage. Postharvest Biol. Technol. 2024, 213, 112957. [Google Scholar] [CrossRef]
  37. Liu, W.; Zeng, H.; Liu, Z.; Yang, X.; Guo, L.; Qiu, D. Mutational Analysis of the Verticillium dahliae Protein Elicitor PevD1 Identifies Distinctive Regions Responsible for Hypersensitive Response and Systemic Acquired Resistance in Tobacco. Microbiol. Res. 2014, 169, 476–482. [Google Scholar] [CrossRef]
  38. El Ghaouth, A.; Wilson, C.L.; Wisniewski, M. Control of Postharvest Decay of Apple Fruit with Candida saitoana and Induction of Defense Responses. Phytopathology 2003, 93, 344–348. [Google Scholar] [CrossRef]
  39. Tian, S.; Wan, Y.; Qin, G.; Xu, Y. Induction of Defense Responses against Alternaria Rot by Different Elicitors in Harvested Pear Fruit. Appl. Microbiol. Biotechnol. 2006, 70, 729–734. [Google Scholar] [CrossRef]
  40. Muslim, A.; Hyakumachi, M.; Kageyama, K.; Suwandi, S. Indonesia Induction of Systemic Resistance in Cucumber by Hypovirulent Binucleate Rhizoctonia Against Anthracnose Caused by Colletotrichum orbiculare. Trop. Life Sci. Res. 2019, 30, 109–122. [Google Scholar] [CrossRef]
  41. Zhang, Y.; Yang, X.; Zeng, H.; Guo, L.; Yuan, J.; Qiu, D. Fungal Elicitor Protein PebC1 from Botrytis cinerea Improves Disease Resistance in Arabidopsis thaliana. Biotechnol. Lett. 2014, 36, 1069–1078. [Google Scholar] [CrossRef] [PubMed]
  42. Lehtonen, M.T.; Akita, M.; Frank, W.; Reski, R.; Valkonen, J.P.T. Involvement of a Class III Peroxidase and the Mitochondrial Protein TSPO in Oxidative Burst Upon Treatment of Moss Plants with a Fungal Elicitor. Mol. Plant Microbe Interact. 2012, 25, 363–371. [Google Scholar] [CrossRef] [PubMed]
  43. Bu, B.; Qiu, D.; Zeng, H.; Guo, L.; Yuan, J.; Yang, X. A Fungal Protein Elicitor PevD1 Induces Verticillium Wilt Resistance in Cotton. Plant Cell Rep. 2014, 33, 461–470. [Google Scholar] [CrossRef] [PubMed]
  44. Kanwar, P.; Jha, G. Alterations in Plant Sugar Metabolism: Signatory of Pathogen Attack. Planta 2019, 249, 305–318. [Google Scholar] [CrossRef]
  45. Cai, J.; Jiang, Y.; Ritchie, E.S.; Macho, A.P.; Yu, F.; Wu, D. Manipulation of Plant Metabolism by Pathogen Effectors: More than Just Food. FEMS Microbiol. Rev. 2023, 47, fuad007. [Google Scholar] [CrossRef]
  46. Shine, M.B.; Yang, J.; El-Habbak, M.; Nagyabhyru, P.; Fu, D.; Navarre, D.; Ghabrial, S.; Kachroo, P.; Kachroo, A. Cooperative Functioning between Phenylalanine Ammonia Lyase and Isochorismate Synthase Activities Contributes to Salicylic Acid Biosynthesis in Soybean. New Phytol. 2016, 212, 627–636. [Google Scholar] [CrossRef]
  47. Cui, H.; Gobbato, E.; Kracher, B.; Qiu, J.; Bautor, J.; Parker, J.E. A Core Function of EDS1 with PAD4 Is to Protect the Salicylic Acid Defense Sector in Arabidopsis Immunity. New Phytol. 2017, 213, 1802–1817. [Google Scholar] [CrossRef]
  48. Fan, W.; Dong, X. In Vivo Interaction between NPR1 and Transcription Factor TGA2 Leads to Salicylic Acid–Mediated Gene Activation in Arabidopsis. Plant Cell 2002, 14, 1377–1389. [Google Scholar] [CrossRef]
  49. Fang, X.; Meng, X.; Zhang, J.; Xia, M.; Cao, S.; Tang, X.; Fan, T. AtWRKY1 Negatively Regulates the Response of Arabidopsis thaliana to Pst. DC3000. Plant Physiol. Biochem. 2021, 166, 799–806. [Google Scholar] [CrossRef]
  50. Han, Z.; Xiong, D.; Schneiter, R.; Tian, C. The Function of Plant PR1 and Other Members of the CAP Protein Superfamily in Plant–Pathogen Interactions. Mol. Plant Pathol. 2023, 24, 651–668. [Google Scholar] [CrossRef]
  51. Bueno, T.V.; Fontes, P.P.; Abe, V.Y.; Utiyama, A.S.; Senra, R.L.; Oliveira, L.S.; Brombini Dos Santos, A.; Ferreira, E.G.C.; Darben, L.M.; De Oliveira, A.B.; et al. A Phakopsora pachyrhizi Effector Suppresses PAMP-Triggered Immunity and Interacts with a Soybean Glucan Endo-1,3-β-Glucosidase to Promote Virulence. Mol. Plant-Microbe Interact. 2022, 35, 779–790. [Google Scholar] [CrossRef] [PubMed]
  52. Hael-Conrad, V.; Abou-Mansour, E.; Díaz-Ricci, J.-C.; Métraux, J.-P.; Serrano, M. The Novel Elicitor AsES Triggers a Defense Response against Botrytis cinerea in Arabidopsis thaliana. Plant Sci. 2015, 241, 120–127. [Google Scholar] [CrossRef]
  53. Sohn, S.-I.; Pandian, S.; Rakkammal, K.; Largia, M.J.V.; Thamilarasan, S.K.; Balaji, S.; Zoclanclounon, Y.A.B.; Shilpha, J.; Ramesh, M. Jasmonates in Plant Growth and Development and Elicitation of Secondary Metabolites: An Updated Overview. Front. Plant Sci. 2022, 13, 942789. [Google Scholar] [CrossRef]
  54. Valenzuela-Riffo, F.; Zúñiga, P.E.; Morales-Quintana, L.; Lolas, M.; Cáceres, M.; Figueroa, C.R. Priming of Defense Systems and Upregulation of MYC2 and JAZ1 Genes after Botrytis Cinerea Inoculation in Methyl Jasmonate-Treated Strawberry Fruits. Plants 2020, 9, 447. [Google Scholar] [CrossRef] [PubMed]
  55. Macioszek, V.K.; Jęcz, T.; Ciereszko, I.; Kononowicz, A.K. Jasmonic Acid as a Mediator in Plant Response to Necrotrophic Fungi. Cells 2023, 12, 1027. [Google Scholar] [CrossRef]
  56. Hanan, A.; Basit, A.; Nazir, T.; Majeed, M.Z.; Qiu, D. Anti-Insect Activity of a Partially Purified Protein Derived from the Entomopathogenic Fungus Lecanicillium lecanii (Zimmermann) and Its Putative Role in a Tomato Defense Mechanism against Green Peach Aphid. J. Invertebr. Pathol. 2020, 170, 107282. [Google Scholar] [CrossRef] [PubMed]
  57. Javed, K.; Qiu, D. Protein Elicitor PeBL1 of Brevibacillus laterosporus Enhances Resistance Against Myzus persicae in Tomato. Pathogens 2020, 9, 57. [Google Scholar] [CrossRef]
  58. Marcec, M.J.; Gilroy, S.; Poovaiah, B.W.; Tanaka, K. Mutual Interplay of Ca2+ and ROS Signaling in Plant Immune Response. Plant Sci. 2019, 283, 343–354. [Google Scholar] [CrossRef]
  59. Kuta, D.D.; Gaivaronskaya, L.M. Ca2+ and Reactive Oxygen Species Are Involved in the Defense Responses of Rice Callus Culture to Rice Blast Disease. Afr. J. Biotechnol. 2004, 3, 76–81. [Google Scholar] [CrossRef]
  60. Able, A.J.; Sutherland, M.W.; Guest, D.I. Production of Reactive Oxygen Species during Non-Specific Elicitation, Non-Host Resistance and Field Resistance Expression in Cultured Tobacco Cells. Funct. Plant Biol. 2003, 30, 91. [Google Scholar] [CrossRef]
  61. Gao, F.K.; Yong, Y.H.; Dai, C.C. Effects of endophytic fungal elicitor on two kinds of terpenoids production and physiological indexes in Euphorbia pekinensis suspension cells. J. Med. Plants Res. 2011, 5, 4418–4425. [Google Scholar]
Jof 11 00467 g001
Figure 1. Effects of different concentrations of inducers on the dry rot spot diameters of potato tubers with in vivo spore germination (0–6 h), and the in vitro mycelial growth (0–7 d) of F. sulphureum; (A) spore germination; (B) mycelial growth; values are expressed as mean ± SD. Different letters indicate significant differences (p < 0.05).
Figure 1. Effects of different concentrations of inducers on the dry rot spot diameters of potato tubers with in vivo spore germination (0–6 h), and the in vitro mycelial growth (0–7 d) of F. sulphureum; (A) spore germination; (B) mycelial growth; values are expressed as mean ± SD. Different letters indicate significant differences (p < 0.05).
Jof 11 00467 g001
Jof 11 00467 g002
Figure 2. Effect of the elicitor on H2O2 content (A), the production rate of O2·− (B), and H2O2 DAB staining observations at 0 h (C), after 2 h of treatment in the control group (D), and after 2 h of treatment in the elicitor-treated group (E) of potato tubers. Scale bars: 50 μm (C–E). Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Figure 2. Effect of the elicitor on H2O2 content (A), the production rate of O2·− (B), and H2O2 DAB staining observations at 0 h (C), after 2 h of treatment in the control group (D), and after 2 h of treatment in the elicitor-treated group (E) of potato tubers. Scale bars: 50 μm (C–E). Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Jof 11 00467 g002
Jof 11 00467 g003
Figure 3. Effect of the elicitor on SA content (A) and the activities of ICS (B) and PAL (C) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Figure 3. Effect of the elicitor on SA content (A) and the activities of ICS (B) and PAL (C) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Jof 11 00467 g003
Jof 11 00467 g004
Figure 4. Effect of the elicitor on gene expression levels of StICS (A), StPAL (B), StEDS 1 (C), StPAD4 (D), StNPR1 (E), StTGA (F), StPR1 (G), StPR2 (H), and StWRKY1 (I) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Figure 4. Effect of the elicitor on gene expression levels of StICS (A), StPAL (B), StEDS 1 (C), StPAD4 (D), StNPR1 (E), StTGA (F), StPR1 (G), StPR2 (H), and StWRKY1 (I) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Jof 11 00467 g004
Jof 11 00467 g005
Figure 5. Effect of the elicitor on JA content (A) and the activities of AOC (B), AOS (C), and LOX (D) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Figure 5. Effect of the elicitor on JA content (A) and the activities of AOC (B), AOS (C), and LOX (D) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Jof 11 00467 g005
Jof 11 00467 g006
Figure 6. Effect of the elicitor on gene expression levels of StAOC (A), StAOS (B), StLOX (C), StACS (D), StACO (E), StOPR3 (F), StCOI1 (G), StJAZ1 (H), StMYC2 (I), and StPFD1.2 (J) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Figure 6. Effect of the elicitor on gene expression levels of StAOC (A), StAOS (B), StLOX (C), StACS (D), StACO (E), StOPR3 (F), StCOI1 (G), StJAZ1 (H), StMYC2 (I), and StPFD1.2 (J) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Jof 11 00467 g006
Jof 11 00467 g007
Figure 7. Effect of the elicitor on CaM content (A), Ca2+-ATPase activity (B), and the expression level of StCa2+-ATPase (C) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Figure 7. Effect of the elicitor on CaM content (A), Ca2+-ATPase activity (B), and the expression level of StCa2+-ATPase (C) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Jof 11 00467 g007
Jof 11 00467 g008
Figure 8. Effect of elicitor on activities of SOD (A), CAT (B), PPO (C), CHI (D) and Glu (E) of potato tuber. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Figure 8. Effect of elicitor on activities of SOD (A), CAT (B), PPO (C), CHI (D) and Glu (E) of potato tuber. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Jof 11 00467 g008
Jof 11 00467 g009
Figure 9. Effect of the elicitor on gene expression levels of StSOD (A), StCAT (B), StPPO (C), StCHI (D), and StGluGlu (E) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Figure 9. Effect of the elicitor on gene expression levels of StSOD (A), StCAT (B), StPPO (C), StCHI (D), and StGluGlu (E) in potato tubers. Values are presented as means ± SD. Asterisks (*) indicate significant differences in the figure (p < 0.05).
Jof 11 00467 g009
Table 1. Primer sequences used for real-time quantitative PCR (qRT-PCR).
Table 1. Primer sequences used for real-time quantitative PCR (qRT-PCR).
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
ActinCTGGGCAGAAGGAAAAGAGGAATACTACGCAGGCTCATCAAAC
ICSTGCTCGCTCTCGTCTTCACCTCATCTCTTGAATCGCCTTGGCATCC
PALGGTCACTGCCTCGGGTGATCCTGCCAGTGAGCAAACCA
EDS1CTTCTGCACTGGGAATAGGATTCGGAACTCAGTTGAGAGG
PAD4TTGCATTACCTTTGGCTCTCCATGATGGGGAAAAGAACAG
NPR1GCACTTGAATCGGCTTAGGGGCTTCTTCAGTTGACGCTCT
PR1GGCATCCCGAGCACAAAATCTGCACCGGAATCAAGT
PR2GTGAAGCTGGTTTGGGAAATGTTGCCAATCAACGTCATGTCTAC
TGAGGAGTATGGTCAGTGGGTGGAGCTCAAAGTAGTGGTTCAGGCAA
WRKY1GAAGAATAAAGCCGGGTTCTTGGCTTACACGATTTGATCACCTCATCC
AOCCCCGATCTGCCATCTGAGTTGCCCCATCCTCACAAGCTT
AOSTTGAAACCCTAGATAAGGAAATGGCAAGCCCCCAACGCCGACTTATCAA
LOXTGGGTGGCTTCTGCTCTTTTTGGAACTGGGCTGTGA
OPR3TGATTTCCCCGACTTCAGCTCATGAGATGCACGACCAACA
JAZ1TTCATCATCGTCATCGTCGTGGGGTTTTGTTTGTTGGCTA
COI1TTGGAGGAGTTTGGTGGTGGGAGGGAAAACTAGTGCGGCAT
MYC2AAGAACAAGCGTAGAGCGTCGTCCACCGCATCATCACCTCCACTTC
PFD1.2TCTTTTGCCTCGTCCTTGTTTTGTGACCCCATGGTTTGTA
Ca2+-ATPaseCACTATGTTGCCAGCGGACTGCGCCACCTCAGTTCCAGCGATTC
SODCTCCTGAAGATGAGGTGCGTGAACCACAATAGAAGGGCAGAA
CATAGTCGGAGGAGCAAATCACAGGCAGAGCCACAACAGCATCCC
PPOTTGCCAATCAACGTCATGTCTACTGAACCGGGGTATGAGGGAT
CHIATTGGAAACGGATATGCTCCATCCTTACCTGAACGCCTGTCA
GluTCTTTTCCGCCTTCCTCTGAACTTCGTTGGGGTTGTCTTT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, D.; Liu, R.; Zhang, H.; Pei, Z.; Yu, X.; Ren, X.; Kong, Q. Elicitor from Trichothecium roseum Activates the Disease Resistance of Salicylic Acid, Jasmonic Acid, and Ca2+-Dependent Pathways in Potato Tubers. J. Fungi 2025, 11, 467. https://doi.org/10.3390/jof11070467

AMA Style

Wang D, Liu R, Zhang H, Pei Z, Yu X, Ren X, Kong Q. Elicitor from Trichothecium roseum Activates the Disease Resistance of Salicylic Acid, Jasmonic Acid, and Ca2+-Dependent Pathways in Potato Tubers. Journal of Fungi. 2025; 11(7):467. https://doi.org/10.3390/jof11070467

Chicago/Turabian Style

Wang, Di, Rong Liu, Haijue Zhang, Zhifei Pei, Xiaoyan Yu, Xueyan Ren, and Qingjun Kong. 2025. "Elicitor from Trichothecium roseum Activates the Disease Resistance of Salicylic Acid, Jasmonic Acid, and Ca2+-Dependent Pathways in Potato Tubers" Journal of Fungi 11, no. 7: 467. https://doi.org/10.3390/jof11070467

APA Style

Wang, D., Liu, R., Zhang, H., Pei, Z., Yu, X., Ren, X., & Kong, Q. (2025). Elicitor from Trichothecium roseum Activates the Disease Resistance of Salicylic Acid, Jasmonic Acid, and Ca2+-Dependent Pathways in Potato Tubers. Journal of Fungi, 11(7), 467. https://doi.org/10.3390/jof11070467

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop