Next Article in Journal
Molecular Mechanism of Aflatoxin B1 Synthesis Related AfVerB Regulating the Development, AFB1 Biosyntheis and Virulence of Aspergillus flavus Mainly Through Its CYP Domain
Previous Article in Journal
Clinical Significance and Therapeutic Challenges of Scedosporium spp. and Lomentospora prolificans Isolates in a Single-Center Cohort of Lung Transplant Recipients
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 11
Issue 4
10.3390/jof11040292
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Exploring Fungicide Sensitivity in Soybean Stem Blight Pathogen Diaporthe longicolla, Emphasizing Genetic Variability Impact on Response to SDHI Fungicides Fluopyram and Pydiflumetofen

by
Shanshan Chen
1,†,
Zhanyun Liu
1,†,
Zhengjie Chang
1,
Yuxin Zheng
1,
Xueyang Wang
1,
Ningwei Li
1,
Zhongqiao Huang
1,
Can Zhang
1,* and
Xili Liu
1,2
1
Department of Plant Pathology, China Agricultural University, Beijing 100193, China
2
State Key Laboratory of Crop Stress Biology for Arid Areas, Northwest A&F University, Yangling 712100, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
J. Fungi 2025, 11(4), 292; https://doi.org/10.3390/jof11040292
Submission received: 4 March 2025 / Revised: 29 March 2025 / Accepted: 4 April 2025 / Published: 8 April 2025
Browse Figures
Review Reports Versions Notes

Abstract

:
Diaporthe species are critical plant pathogens that contribute to a disease complex responsible for substantial yield losses in soybean production worldwide. However, reports on the primary Diaporthe species causing soybean stem blight and their sensitivity to various fungicides are scarce in China. In this study, a total of 46 D. longicolla strains were isolated and identified from diseased soybean stems and rots collected from 14 regions of Heilongjiang province in 2021 and 2022. Among the eight fungicides examined, fludioxonil, mefentrifluconazole, tebuconazole, and azoxystrobin demonstrated effective inhibition for D. longicolla, with EC50 values < 0.3 µg/mL. Interestingly, the EC50 values of D. longicolla to two succinate dehydrogenase inhibitors (SDHIs), pydiflumetofen and fluopyram, were 5.47 µg/mL and over 100 µg/mL, respectively. In molecular dynamics simulations, pydiflumetofen exhibited a smaller RMSD, while fluopyram had a higher binding free energy with Sdh proteins compared to pydiflumetofen. This difference may contribute to the higher activity of pydiflumetofen in D. longicolla. Further analysis of the electrostatic potential and structural conformations of the binding pocket revealed that pydiflumetofen formed more hydrophobic interactions with SdhC and SdhD and was positioned closer to the SdhD subunit. A mixture of fludioxonil and mefentrifluconazole at a ratio of 1:5, as well as fludioxonil and pydiflumetofen at a ratio of 1:5, exhibited synergistic effects. These findings demonstrated that several fungicides could be utilized to control Diaporthe stem blight, and the difference in binding affinity to the Sdh subunit impacts sensitivity to fluopyram and pydiflumetofen.

1. Introduction

Soybean [Glycine max (L.) Merr.], which originated in China, is a critical oilseed crop and a valuable source of vegetable protein [1,2]. China is the largest soybean consumer and importer globally, and the Chinese government-proposed soybean revitalization plan and subsidized soybean farmers were enacted in 2019 and 2020 [3]. Total area of soybean planting in China have increased recently, and the largest soybean producing province of China is Heilongjiang, accounting for nearly 5 million hectares of soybeans [4,5]. Frequent disease occurrence is an important factor restricting high and stable soybean yields.
Diaorthe species can produce cankers, diebacks, root rots, fruit rots, leaf spots, blights, decay, and wilts on an array of plant hosts, encompassing soybean and economically important hosts worldwide [6,7]. In soybeans, Diaporthe species are important seed-borne pathogens causing serious seed yield loss [8]. They are responsible for pod and stem blight, attributed to D. longicolla, seed decay caused by D. longicolla, and stem canker attributed to D. aspalathi and D. caulivora, respectively [9,10,11]. Recently, stem blight has become more prevalent in soybeans in China, such as in the Huang-Huai-Hai region, with typically 10 to 30% yield loss being associated with stem blight [12,13]. It is unclear whether Diaporthe species cause soybean stem blight in Heilongjiang province. Moreover, soybean root rot occurs in conjunction with soybean stem blight in the field, with Fusarium species being a major pathogen causing soybean root rot [14,15,16,17].
Currently, chemical fungicides are still the primary measure of controlling soybean disease, dominated by metalaxyl, carbendazim, and fludioxonil. However, based on the Chinese pesticide information network, no chemical fungicides have been registered for controlling soybean stem blight (http://www.chinapesticide.org.cn/) (accessed on 20 May 2024). Due to the frequent occurrence of soybean stem blight, clarification of the sensitivity of different fungicides to D. longicolla is required to select suitable seed treatment fungicides for scientifically controlling soybean diseases. Succinate dehydrogenase inhibitors (SDHIs) have been the fastest-growing fungicides in agriculture over the past fifteen years, with important roles in the chemical control of soybean diseases, and are the third largest class of fungicides in the world after quinone outside inhibitors (QoIs) and demethylation inhibitors (DMIs) [18,19].
SDHIs inhibit the reduction of ubiquinone by binding to the active site of complex II (succinate dehydrogenase B, C, or D subunits), inhibiting ATP production [20]. Prior studies have demonstrated that mechanisms of fungicide binding to subunits influence fungicide sensitivity. Variations in the binding sites of pathogens to fungicides can lead to differences in the sensitivity of one pathogen to the same fungicide mode of action for instance, Amiri reported that the anchored SdhC subunit affects the fitness and sensitivity of Botrytis cinerea to SDHIs [21]. In Chen’s study, significant differences in sensitivity of Fusarium asiaticum causing Fusarium head blight to pydiflumetofen were identified between mutants of the anchored SdhB subunit and the anchored SdhC subunit, with EC50 values of 0.36 and 60.67 µg/mL, respectively. Mirroring Shao’s study, differences in the sensitivity of Fusarium graminearum to pydiflumetofen were also documented [22,23]. The sensitivity and binding modes of Diaporthe species to SDHIs like pydiflumetofen remain unknown.
Therefore, this study was performed to (i) clarify Diaporthe species causing soybean stem blight in Heilongjiang, (ii) evaluate the sensitivity of D. longicolla to seven fungicides, and (iii) examine the mechanism underlying the differences in sensitivity to two SDHI fungicides.

2. Materials and Methods

2.1. Collection of Diaporthe Species Isolates

In 2021 and 2022, a total of 46 Diaporthe isolates were obtained from small pieces of about 0.4 cm2 of the dried stems of 14-week-old mature plants across 14 different regions of the Heilongjiang province in China. The isolates were grown in a dark environment on potato dextrose agar (PDA, 200 g/L potato, 20 g/L dextrose, and 15 g/L agar) plates. The culture temperature was maintained at 25 °C. To observe pycnidia, isolates were inoculated onto autoclaved soybean stems and placed on water agar medium (WA, 15 g/L agar and 1 L autoclaved water), and incubated at 25°C with a 12-h light/dark cycle over a period of 28 days. The Diaporthe isolates were preliminarily identified according to morphological characteristics like colony appearance and color, conidiophores, and pycnidia (under the microscope) [24]. Following single-spore isolation, the mycelia of each isolate were preserved for long-term storage in 5 mL plastic tubes with PDA medium slants. The tubes were sealed with mineral oil and stored at 14 °C.

2.2. DNA Extraction and Identification of Diaporthe Isolates

Based on the culture condition, the colony morphologies were observed on the PDA medium after being cultured for three days. For molecular identification, the DNA of the Diaporthe isolates was extracted using the cetyltrimenthyl ammonium bromide (CTAB) extraction method [25]. The isolated DNA samples were validated through PCR analysis using primers targeting the internal transcribed spacer (ITS), elongation factor (EF1-α) genes, partial beta-tubulin gene (β-tub), and partial calmodulin gene (CAL) (Table S2) [26,27]. The PCR amplification conditions were established as follows: an initial denaturation step at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing temperature varied for the specific primers for 30 s (relative to the primers used), extension at 72 °C for 1 min, and a final extension step at 72 °C for 10 min [28,29,30]. The PCR products were analyzed via 1.5% agarose gel electrophoresis. Subsequently, the PCR products were submitted to Beijing Tsingke Biotech Co., Ltd. (Beijing, China) for DNA sequencing [31,32].
In this study, the ITS, β-tub, EF1-α, and CAL sequences of identified Diaporthe strains were obtained from GenBank and edited using Clustal X 1.83. The character weights were set to be equal during the editing process. Further, a phylogenetic tree of Diaporthe was developed via maximum likelihood using MEGA 7.0 according to these edited sequences.

2.3. Diaporthe Isolates Pathogenicity Testing

Founded on the identification results and Koch’s postulates, we performed pathogenicity tests on etiolated soybean seedlings using representative isolates of the identified Diaporthe species. Soybean seeds of equal size and number were placed 8 cm apart in pots containing moist vermiculite. A moist vermiculite layer was added, and the seeds were placed in cardboard boxes covered with black plastic bags for ten days to encourage etiolation. The etiolated soybean seedlings were placed in a shallow tray lined with three layers of moist paper. A 5-mm diameter plug of mycelium was inoculated into the center of the etiolated soybean seedlings. The tray was covered with a section of cling film to maintain optimum humidity. Following incubation at 25 °C for approximately 8 days, the diameter of the lesions formed was investigated and recorded.

2.4. Fungicides

The sensitivity of eight fungicides to representative Diaporthe isolates was evaluated. The fungicides included tebuconazole (96%; Shandong United Pesticide Industry Co. Ltd., Jinan, China), prothioconazole (98%; Shandong United Pesticide Industry Co. Ltd., Jinan, China), mefentrifluconazole (97%; Badische Anilin-und-Soda-Fabrik SE, Ludwigshafen, Germany), fludioxonil (98%; Shandong United Pesticide Industry Co. Ltd., Jinan, China), azoxystrobin (93%; Syngenta AG, Basel, Switzerland), phenamacril (95%; Jiangsu Pesticide Research Institute Co., Nanjing, China), pydiflumetofen (98%; Bayer AG, Syngenta Crop Protection Ltd., Leverkusen, Switzerland), and fluopyram (96%; Bayer AG, Leverkusen, Germany).

2.5. Sensitivity Assay of Diaporthe Isolates to Eight Fungicides

Sensitivity to fungicides has been typically determined in vitro by estimating the effective concentration required to lower radial mycelial growth by 50% (EC50) in fungicide-amended media relative to unamended media [33,34]. The efficacy of seven fungicides on the mycelial growth of 46 Diaporthe spp. on PDA was examined following the protocol outlined in our previous study, with the concentrations of the eight fungicides listed in Table 1 [35]. The median effective concentration (EC50) was computed using a linear model regression of the relative growth values (as a proportion of the control) against the log-transformed fungicide concentrations. Eight chemical fungicides were dissolved in dimethylsulfoxide (DMSO) to produce stock solutions with a concentration of 105 μg/mL at 4 °C, and the final concentration of DMSO in the medium was 0.1% across all treatments. Mycelial plugs (5 mm in diameter) were removed from the edges of the colonies and transferred to the center of PDA plates with different concentrations of fungicide. Each treatment consisted of three replicates. The diameter of each colony was examined perpendicularly following ten days of incubation at 25 °C in the dark. The experiment was performed in duplicate [36].

2.6. Cloning of SdhA, B, C, and D Genes in D. longicolla

The DNA of D. longicolla was isolated from the mycelia grown on PDA media at 25 °C in the dark for 3 days using the cetyltrimethyl ammonium bromide (CTAB) procedure as outlined in Section 2.2. PCRs utilizing primers listed in Table 2, the reaction mixture was prepared to a final volume of 25 μL, containing 2 μL of fungal template DNA. PCR amplification of SdhA, B, C, and D contained 0.5 μL of each primer, 12.5 μL of 2 × GS Taq PCR Mix, and 9.5 μL of H2O. Amplification conditions were 95 °C for 3 min followed by 34 cycles of 95 °C for 30 s, 61 °C (SdhA), 63 °C (SdhB), 59 °C (SdhC), and 63 °C (SdhD) for 30 s and 72 °C for 1 min (2.5 min for SdhA) with a final DNA extension at 72 °C for 10 min. PCR products were sequenced by Beijing Tsingke Biotech Co., Ltd. (Beijing, China). Nucleotide sequences were assembled and aligned using Bio-Edit software version 7.0.8.1, and amino acid sequences were characterized following sequence analysis.

2.7. Analysis of SdhB and SdhC in D. longicolla

Mitochondrial complex II is normally composed of four subunits: SdhA, SdhB, SdhC, and SdhD subunits. According to previous studies, the major resistance mutation sites are located in the three subunits: SdhB, SdhC, and SdhD. For fluopyram and pydiflumetofen, the primary resistance mutation sites are situated in the SdhB and SdhC subunits. Therefore, this study aimed to clarify the sequence differences of the SdhB and SdhC subunits in seed-rot pathogens relative to other different species and produced a phylogenetic tree using MEGA version 7.0.26 software to illustrate this result.

2.8. Molecular Docking Analysis and Molecular Dynamics (MD) Simulations

Molecular docking was employed to investigate the binding model of target SDHI fungicides to Sdh proteins. The crystal structure of 3aeb, the Sdh protein from Saccharomyces cerevisiae, obtained from the Protein Data Bank, was used as a template for homology modeling. Sequence alignment of the Sdh proteins using DNAMAN revealed over 30% sequence identity with D. longicolla [37,38,39]. The Modeller v 9.19 program was used to perform homology modeling on the protein, in order to obtain a reasonable three-dimensional structural model of the target protein. The three-dimensional (3D) conformations of pydiflumetofen and fluopyram were optimized using an Amber14 force field, which is integrated within YASARA 5.0. The binding mode between the SDHI fungicides and Sdh proteins was studied using molecular docking in YASARA. The docking box size was set to 25 × 25 × 25 Å, with the default built-in ligand exhaustiveness and flexibility methods. All other parameters were kept at their default settings [40]. PyMOL 3.1.4.1 was used for visualization analysis. The optimal conformation was then selected for molecular dynamics simulation.
The Molecular dynamics simulations were conducted using AMBER 24 with the ff19SB force field for proteins, the GAFF2 force field for ligands, and the OPC water model for the ligand-protein complex system [41]. Complex systems were neutralized with Na+/Cl− ions. The simulation workflow included energy minimization using the steepest descent and conjugate-gradient methods, followed by gradual heating from 0 K to 300 K and equilibration for 500 ps. A 100 ns production MD run was then performed. Trajectory analysis, including root mean square deviation (RMSD) and stable conformation extraction, was carried out using CPPTRAJ integrated into Amber 24 [42]. The equilibrated trajectory of each complex was sampled for MM-GBSA calculations using MMPBSA.py script integrated in AMBER 24 [43].

2.9. Synergistic Interaction of Mixed Fungicides

The sensitivity of the fungicide mixtures containing fludioxonil, mefentrifluconazole, and pydiflumetofen against D. longicolla was determined by the mycelial growth rate method as Section 2.5 [44]. The experiment integrated fludioxonil and mefentrifluconazole, fludioxonil, and pydiflumetofen with ratios of 1:0, 0:1, 1:1, 1:5, 5:1, and 10:1. Plugs of 5 mm diameter were obtained from the edge of the colony using a puncher and inoculated onto PDA medium containing various concentrations of the mixed fungicide concentration of mixed fungicide. The theoretical inhibition concentration of each combined fungicide (EC50 values) was determined by measuring the diameter of each colony in two perpendicular directions following five days of incubation at 25 °C in the dark, Values for the co-toxicity coefficient (CTC) were determined based on the EC50 values of each binary mixture using the following formula. [45].
Toxicity   index   TI   of   A = 100
TI B = EC 50     A     EC 50 B × 100
Actual   TI M =   EC 50 ( A ) × EC 50 ( M ) × 100
Theoretical   TI M = TI A × % W   of   A   in   M + TI ( B ) × % W   of   B   in   M
A, B represent the individual fungicides used in this mixture; M indicates the mixture of two fungicides; W is the proportion of the fungicide in the mixture. The co-toxicity coefficient (CTC) is computed as the ratio between Actual TI (M) and Theoretical TI (M). If CTC ≥ 120, synergism is present. If 120 > CTC > 80, the interaction is additive. If CTC < 80, the interaction is antagonistic [46].

2.10. Statistical Analysis

Statistical analysis of the data was conducted using DPS software version 7.05. The data were presented as the mean ± standard error. Significant differences between means were identified using a multi-range least significant difference (LSD) test at a significance level of p = 0.05.

3. Results

3.1. D. longicolla Was Identified from a Diseased Soybean Stem

A total of 46 isolates were isolated from diseased soybeans in the Heilongjiang province of China, and these isolates developed colonies with white, compact aerial mycelium in the front with greenish-black stromata in the back of the colony in the Petri dish (Figure 1A) [47]. The spores of these species are ellipsoid or fusiform, transparent, and usually contain two oil globules (Figure 1B). The phylogenetic tree, developed using ITS, EF1-α, CAL, and β-tub gene sequences, supported the identification of the isolates as D. longicolla, consistent with the morphological results (Figure 1C). Additionally, through the pathogenicity of Diaporthe isolates, the results indicted all the Diaporthe isolates could infect etiolated seedlings of soybean, causing disease symptoms (Figure 1D). Combined with morphological, molecular identification and pathogenicity, all 46 Diaporthe isolates isolated from diseased soybean stems were confirmed to be D. longicolla.

3.2. Determination of EC50 Values of Eight Fungicides and Sensitivity Differentiation in Two SDHIs Against D. longicolla

Among the eight fungicides, except the two SDHIs, pydiflumetofen and fluopyram, fludioxonil, mefentrifluconazole, and azoxystrobin exhibited adequate inhibition of D. longicolla. D. longicolla was most sensitive to fludioxonil with an EC50 of about 0. 01 μg/mL, followed by mefentrifluconazole and azoxystrobin, whose EC50 values were below 1 μg/mL, but phenamacril was the least sensitive with an EC50 of 3.59 μg/mL among the six fungicides (Figure 2). And in this study, the sensitivity of D. longicolla to SDHI pydiflumetofen and SDHI fluopyram was determined, and it was found that pydiflumetofen and fluopyram belong to the SDHI fungicides, with a difference in sensitivity of D. longicolla. The SDHI pydiflumetofen exhibited high inhibitory activity against D. longicolla with mean EC50 values of 5.47 ± 0.63 μg/mL (Figure 2). In contrast, the SDHI fluopyram was insensitive, and its mean EC50 values of almost all isolates exceeded 100 μg/mL.

3.3. Characterization of the D. longicolla Sdh (A, B, C, and D) Genes

The four primer pairs Sdh-F/R produced four fragments, including the full-length Sdh A, B, C, and D genes and some flanking sequences. The SdhA gene was 2244 bp in length, encoding 741 amino acids, the SdhB gene encoded 281 amino acids at 873 bp in length, along with an intron 67 bp in length located at nucleotide position 407. The SdhC and SdhD genes were 552 bp and 576 bp in length, respectively, each encoding 181 acids. However, SdhD has an intron 50 bp in length located at nucleotide position 205.

3.4. Analysis Sdh (B and C) Proteins in D. longicolla

According to the significant sensitivity differences of D. longicolla to the two SDHI fungicides, we investigated and analyzed the domains of their SdhA, SdhB, SdhC, and SdhD protein. The SdhA protein of D.longicolla contains only the PTZ00139 domain (FAD_binding_2 domain), which is the succinate dehydrogenase [ubiquinone] flavoprotein subunit. For the SdhB protein, D. longicolla has only the PLN00129 superfamily domain which is the succinate dehydrogenase [ubiquinone] iron-sulfur subunit, and no transmembrane domain (http://smart.embl-heidelberg.de/) (accessed on 20 May 2024). The SdhC protein of D. longicolla contains only SQR domains, which belong to the succinate:quinone oxidoreductase (SQR) type C subfamily. And SQR catalyzes the oxidation of succinate to fumarate, coupled to the reduction of quinone to quinol, but it has three transmembrane domains. And for the SdhD protein, D.longicolla has the CybS domain, it encodes the small subunit (cybS) of cytochrome b in succinate-ubiquinone oxidoreductase (mitochondrial complex II) (Figure 3A). Additionally, phylogenetic trees demonstrated that the ShbA, SdhB, SdhC and SdhD subunits of D. longicolla were individually grouped in a single cluster, potentially accounting for the obvious difference in fungicide sensitivity of the two SDHIs, pydiflumetofen and fluopyram (Figure 3B).

3.5. Molecular Docking and MD Simulation of Two SDHI Fungicides with D. longicolla Sdh Proteins

Based on the sensitivity results of different species to the two SDHI fungicides, D. longicolla showed significant differences in sensitivity to fluopyram and pydiflumetofen. To explore the underlying mechanism, molecular docking and MD simulation were conducted. Initially, fluopyram and pydiflumetofen were individually docked into the binding pocket of Sdh proteins (Figure S1), and the docked complexes served as the initial conformations for MD simulations.
As shown in Figure 4A, the RMSD trends of fluopyram and pydiflumetofen began to converge after 40 ns. The ligand RMSD of pydiflumetofen stabilized at 2.25 Å approximately, fluctuations within 1 Å. However, fluopyram stabilized at around 2.00 Å, fluctuations within 2 Å, indicated that pydiflumetofen bound more stably to the Sdh proteins than fluopyram. Subsequently, representative protein−ligand conformations and the binding free energy (Figure 4B,C) were analyzed from the final 1 ns of the simulations. The binding free energy (ΔGbind) of fluopyram with Sdh proteins was −23.92 kcal/mol, higher than that of pydiflumetofen with the Sdh proteins (−30.02 kcal/mol). This difference may explain why pydiflumetofen exhibits stronger binding with the Sdh proteins.
Further analysis of the electrostatic potential and structural conformations of the binding pocket revealed that it was predominantly hydrophobic. Both fluopyram and pydiflumetofen formed hydrophobic interactions with surrounding residues. Fluopyram formed hydrophobic bonds with the residues C_His146, C_Gly143, C_Val144, C_Leu175, D_-Val30 and D_Ala26 of Sdh proteins. Pydiflumetofen formed hydrophobic interactions with the residues C_His146, C_His139, C_Trp46 D_-Val30, D_Ala27 and D_Ala26 of the Sdh proteins. Pydifluorofen was positioned closer to the D subunit and formed more hydrophobic interactions, which may contribute to its differing activity compared to fluopyram. However, neither ligand exhibited strong electrostatic interactions, such as hydrogen bonds or π-π stacking. These findings suggested that structural modifications of fluopyram and pydiflumetofen could introduce hydrogen bond donor fragments, enabling hydrogen bonding interactions with the oxygen acceptor atoms of Gly143 and Ala27.

3.6. Synergy of Fludioxonil, Mefentrifluconazole, and Pydiflumetofen Against D. longicolla

Based on the sensitivity results of eight fungicides again D. longicolla, it was found that fludioxonil and mefentrifluconazole had the best inhibitory effect, and SDHI fungicide pydiflumetofen also exhibited good inhibition again D. longicolla. To investigate whether there is a synergistic effect of the three fungicides, fludioxonil and mefentrifluconazole, fludioxonil and pydiflumetofen were mixed as the binary mixture and tested the sensitivities against D. longicolla. It showed that the mixture of fludioxonil and mefentrifluconazole, fludioxonil and pydiflumetofen, showed synergism efficiency only at the ratio of 1:5, and the CTC values were 126.39 and 140.00 respectively (Table 3).

4. Discussion

Soybeans are threatened by many Diaporthe species, causing soybean stem blight that negatively affects yield and quality, and pathogens and dominant species vary by distinct region [48,49,50,51]. Among them, the pathogen D. longicolla was reported causing soybean stem blight [52]. In this study, integrating morphology and molecular identification, we obtained 46 D. longicolla, consistent with the previous study, but the number of isolates of D. longicolla was 25% percent less than those isolated from diseased soybean plants [17]. D. longicolla has a wide range of hosts, which can infect capsicum, tomato, and soybeans [53]. While it was isolated in relatively low levels, it can still infect many plants and can aggravate soybean diseases through synergistic infection with Fusarium species and other pathogens, so the sensitivity and infection mechanisms of D. longicolla bear investigation.
In this study, the fungicides tebuconazole, mefentrifluconazole, and fludioxonil demonstrated adequate inhibition of D. longicolla, while in our previous study, these fungicides demonstrated similar inhibition for Fusarium species. These factors should, therefore, be considered in the field for controlling soybean root rot and soybean stem blight caused by various pathogens, and in practice, the alternate rotation of different mechanism fungicides should also be taken into consideration and could be matched with fungicides that could control oomycetes or inhibit various fungi simultaneously. There is some interest in the sensitivity result for SDHI fluopyram, which showed little or no inhibition of both D. longicolla, while SDHI pydiflumetofen exhibited good inhibition. Therefore, prior to using fungicides with the same mode of action, the differences between pathogens in plant diseases should be carefully considered, and the sensitivity of different D. longicolla to different SDHIs requires further investigation in the future.
To further document the mechanisms underlying the difference in sensitivity between two SDHI fungicides: fluopyram and pydiflumetofen, we firstly investigated the binding interactions of D. longicolla Sdh proteins to SDHIs based on molecular docking [54,55]. The highest-scoring docking was the complex, having one of the top-ranked poses [56]. Molecular docking results revealed that pydiflumetofen exhibits superior binding with the Sdh proteins, and it indicated that the SdhC subunit plays an important role in this inteaciton. In F. pseudograminearum, the recent research also demonstrated that the sensitivity of pydiflumetofen is closely associated with SdhC1 subunit, with point mutations FpSdhC1A83V or FpSdhC1R86K conferring pydiflumetofen resistance [57]. In the study by Chen et al., single amino acid mutations in FaSdhC1 confer pydiflumetofen resistance in F. asiaticum [22]. Combining the docking result and previous study showing that SDHI pydiflumetofen was mainly bound to SdhC protein.
Further molecular dynamics simulations of fluopyram and pydiflumetofen revealed that both bind to the Sdh proteins through hydrophobic interactions. However, fluopyram specifically forms hydrophobic bonds with the C_Gly143, C_Val144, and C_Leu175 residues of the Sdh protein, pydiflumetofen specifically forms hydrophobic bonds with the C_His139, C_Trp46, and D_Ala27 residues of the Sdh proteins, which leads to different binding activities with the Sdh proteins. Additionally, pydiflumetofen could also interact with amino acid residues of the SdhD protein, suggested that the SdhC protein and SdhD proteins synergistically bind with the fungicide, resulting in a stronger binding of pydiflumetofen to the Sdh proteins.
An interesting phenomenon was observed in this study: SDHI pydiflumetofen and fluopyram have different inhibitory effects on D. longicolla. Despite the relatively poor activity of fluopyram, molecular docking and molecular dynamics studies revealed that that SDHI fluopyram also has several binding sites with the SdhC and SdhD proteins This indicated that the molecular docking and molecular dynamics results were only an auxiliary validation and the actual binding sites of pathogens to distinct fungicides still needed to be practiced in vivo or ex vivo experiments and the only by these results, it cannot fully explain the actual sensitivities of SDHI fungicides against D. longicolla [58].
In conclusion, 46 Diaporthe isolates were obtained and identified as D. longicolla, causing soybean stem blight in the Heilongjiang province of China from 2021 and 2022. Fludioxonil, mefentrifluconazole, and tebuconazole exhibited an adequate level of inhibition of D. longicolla, and could be recommended for the control of soybean stem blight in the field. The binding capacity of two SDHIs, pydiflumetofen and fluopyram, to Sdh proteins varied, further elucidating their different inhibitory effects against D. longicolla. However, according to the sensitivity results of mixed fungicides, fludioxonil, mefentrifluconazole and pydiflumetofen against D. longicolla, most combinations exhibited antagonistic effect, while synergistic efficiency was observed only at a ratio of 1:5. Therefore, further practice and exploration of the actual efficacy of mixed fungicides in the field are needed.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof11040292/s1, Table S1: Diaporthe species isolates obtained from soybeans in Heilongjiang, China, in 2021 and 2022; Table S2: The primers used to identify Diaporthe longicalla; Table S3: Collection information of standard strains employed to develop the multigene phylogenetic tree of Diaporthe isolates; Figure S1: Molecular docking of pydiflumetofen and fluopyram into the SdhC subunit of Diaporthe longicolla.

Author Contributions

S.C.: Writing—Original draft preparation, Investigation, Methodology, Software, Conceptualization. Z.L.: Writing—Original draft preparation, Formal analysis, Visualization. Z.C.: Formal analysis, Visualization. Y.Z.: Materials, Methodology. X.W.: Methodology, Software. N.L.: Methodology. Z.H.: Methodology, Formal analysis. C.Z.: Writing—Reviewing and Editing, Funding acquisition, Conceptualization. X.L.: Writing—Reviewing and Editing, Funding acquisition, Conceptualization. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Key Research and Development Programs of China (2023YFD1401000).

Data Availability Statement

Data will be made available on request.

Acknowledgments

Thanks to Dai Tan and Lu Xingxing from Northwest A&F University for their assistance in molecular dynamics.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. de Borja Reis, A.F.; Tamagno, S.; Moro Rosso, L.H.; Ortez, O.A.; Naeve, S.; Ciampitti, I.A. Historical trend on seed amino acid concentration does not follow protein changes in soybeans. Sci. Rep. 2020, 10, 17707. [Google Scholar] [CrossRef]
  2. Ramalingam, J.; Alagarasan, G.; Savitha, P.; Lydia, K.; Pothiraj, G.; Vijayakumar, E.; Sudhagar, R.; Singh, A.; Vedna, K.; Vanniarajan, C. Improved host-plant resistance to Phytophthora rot and Powdery mildew in soybean. Sci. Rep. 2020, 10, 13928. [Google Scholar] [CrossRef]
  3. Yao, H.; Zuo, X.; Zuo, D.; Lin, H.; Huang, X.; Zang, C.F. Study on soybean potential productivity and food security assessment in China under the influence of the COVID-19 outbreak. Georg. Sustain. 2020, 1, 163–171. [Google Scholar] [CrossRef]
  4. Zhao, J.C.; Wang, Y.X.; Zhao, M.Y.; Wang, K.C.; Li, S.; Gao, Z.Z.; Shi, X.Y.; Chu, Q.Q. Prospects for soybean production increase by closing yield gaps in the Northeast Farming Region, China. Field Crops Res. 2023, 293, 108843. [Google Scholar] [CrossRef]
  5. Wang, T.; Ma, Y.; Luo, S. Spatiotemporal evolution and influencing factors of soybean production in Heilongjiang Province, China. Land 2023, 12, 2090. [Google Scholar] [CrossRef]
  6. Uecker, F.A. A World List of Phomopsis Names with Notes on Nomenclature, Morphology and Biology (Mycologia Memoir); J. Cramer: Berlin, Germany, 1988; Volume 13, pp. 1–231. [Google Scholar]
  7. Santos, J.M.; Phillips, A.J.L. Resolving the complex of Diaporthe (Phomopsis) species occurring on Foeniculum vulgare in Portugal. Fungal Divers. 2009, 34, 111–125. [Google Scholar] [CrossRef]
  8. Petrović, K.; Skaltsas, D.; Castlebury, L.A.; Kontz, B.; Allen, T.W.; Chilvers, M.I.; Gregory, N.; Kelly, H.M.; Koehler, A.M.; Kleczewski, N.M.; et al. Diaporthe seed decay of soybean [Glycine max (L.) Merr.] Is endemic in the United States, but new fungi are involved. Plant Dis. 2021, 105, 1621–1629. [Google Scholar] [CrossRef]
  9. Rensburg, J.C.J.V.; Lamprecht, S.C.L.; Groenewald, J.Z.; Lisa, A.; Castlebury, L.A.; Crous, P.W. Characterisation of Phomopsis spp. associated with die-back of rooibos (Aspalathus linearis) in South Africa. Stud. Micol. 2006, 55, 65–74. [Google Scholar] [CrossRef]
  10. Santos, J.M.; Vrandecic, K.; Cosic, J.; Duvnjak, T.; Phillips, A.J.L. Resolving the Diaporthe species occurring on soybean in Croatia. Persoonia 2011, 27, 9–19. [Google Scholar] [CrossRef]
  11. Hosseini, B.; ElHasan, A.; Link, T.; Voegele, R.T. Analysis of thespecies spectrum of the Diaporthe/Phomopsis complex in European soybean seeds. Mycol. Prog. 2020, 19, 455–469. [Google Scholar] [CrossRef]
  12. Abdelmagid, A.; Hafez, M.; Lawley, Y.; Rehal, P.K.; Daayf, F. First report of pod and stem blight and seed decay caused by Diaporthe longicolla on soybean in western Canada. Plant Dis. 2022, 106, 1061. [Google Scholar] [CrossRef]
  13. Zhao, X.; Li, K.; Zheng, S.; Yang, J.; Chen, C.; Zheng, X.B.; Wang, Y.C.; Ye, W.W. Diaporthe diversity and pathogenicity revealed from a broad survey of soybean stem blight in China. Plant Dis. 2022, 106, 2892–2903. [Google Scholar] [CrossRef] [PubMed]
  14. Hartman, G.L.; Huang, Y.H.; Nelson, R.L.; Noel, G.R. Germplasm evaluation of Glycine max for resistance to Fusarium solani, the causal organism of sudden death syndrome. Plant Dis. 1999, 81, 515–518. [Google Scholar] [CrossRef] [PubMed]
  15. Zhao, X.; Zheng, S.; Ye, W.; Zheng, X.; Wang, Y. First report of soybean stem blight caused by Diaporthe phaseolorum in Sichuan province, China. Plant Dis. 2021, 10, 3290. [Google Scholar] [CrossRef]
  16. Mena, E.; Stewart, S.; Montesano, M.; de León, I.P. Current understanding of the Diaporthe/Phomopsis complex causing soybean stem canker: A focus on molecular aspects of the interaction. Plant Pathol. 2024, 73, 31–46. [Google Scholar] [CrossRef]
  17. Wei, L.L.; Chen, B.; Li, J.W.; Zhang, P.C.; Chen, W.C.; Ye, W.W.; Chen, C.J. Resistance mechanism of Phomopsis longicolla to fludioxonil is associated with modifications in PlOS1, PlOS4 and PlOS5. Pest. Biochem. Physiol. 2024, 201, 105862. [Google Scholar] [CrossRef] [PubMed]
  18. Mao, Y.S.; Duan, Y.B.; Zhou, M.G. Research progress of the resistance to succinate dehydrogenase inhibitors. Chin. J. Pest. Sci. 2022, 24, 937–948. [Google Scholar] [CrossRef]
  19. Steinhauer, D.; Salat, M.; Frey, R.; Mosbach, A.; Luksch, T.; Balmer, D.; Hansen, R.; Widdison, S.; Logan, G.; Dietrich, R.A.; et al. A dispensable paralog of succinate dehydrogenase subunit C mediates standing resistance towards a subclass of SDHI fungicides in Zymoseptoria tritici. PLoS Pathog. 2019, 15, e1007780. [Google Scholar] [CrossRef]
  20. Avenot, H.F.; Michailides, T.J. Progress in understanding molecular mechanisms and evolution of resistance to succinate dehydrogenase inhibiting (SDHl) fungicides in phytopathogenic fungi. Crop Prot. 2010, 29, 643–651. [Google Scholar] [CrossRef]
  21. Sun, Y.; Shi, H.; Mao, C.; Wu, J.; Zhang, C. Activity of a SDHI fungicide penflufen and the characterization of natural-resistance in Fusarium fujikuroi. Pestic. Biochem. Physiol. 2021, 179, 104960. [Google Scholar] [CrossRef]
  22. Chen, W.; Wei, L.; Zhao, W.; Wang, B.; Zheng, H.; Zhang, P.; Lou, T.; Duan, Y.; Hou, Y.; Zhou, M.; et al. Resistance risk assessment for a novel succinate dehydrogenase inhibitor pydiflumetofen in Fusarium asiaticum. Pest. Manag. Sci. 2021, 77, 538–547. [Google Scholar] [CrossRef]
  23. Shao, W.; Wang, J.; Wang, H.; Wen, Z.; Liu, C.; Zhang, Y.; Zhao, Y.; Ma, Z. Fusarium graminearum FgSdhC1 point mutation A78V confers resistance to the succinate dehydrogenase inhibitor pydiflumetofen. Pest. Manag. Sci. 2022, 78, 1780–1788. [Google Scholar] [CrossRef] [PubMed]
  24. Udayanga, D.; Castlebury, L.A.; Rossman, A.Y.; Chukeatirote, E.; Hyde, K.D. The Diaporthe sojae species complex: Phylogenetic re-assessment of pathogens associated with soybean, cucurbits and other field crops. Fungal Biol. 2015, 119, 383–407. [Google Scholar] [CrossRef]
  25. Dissanayake, A.J.; Zhu, J.T.; Chen, Y.Y.; Maharachchikumbura, S.S.N.; Hyde, K.D.; Liu, J.K. A re-evaluation of Diaporthe: Refining the boundaries of species and species complexes. Fungal Divers. 2024, 126, 1–125. [Google Scholar] [CrossRef]
  26. Huang, L.; Lümmen, P.; Berry, E.A. Crystallographic investigation of the ubiquinone binding site of respiratory complex II and its inhibitors. Biochim. Biophys. Acta Proteins Proteom. 2021, 1869, 140679. [Google Scholar] [CrossRef]
  27. Duan, Y.B.; Yang, Y.; Wang, J.X.; Liu, C.C.; He, L.L.; Zhou, M.G. Development and application of loop-mediated isothermal amplification for detecting the highly benzimidazole-resistant isolates in Sclerotinia sclerotiorum. Sci. Rep. 2015, 5, 17278. [Google Scholar] [CrossRef]
  28. Kim, W.K.; Mauthe, W.; Hausner, G.; Klassen, G.R. Isolation of high molecular weight DNA and double-stranded RNAs from fungi. Can. J. Bot. 1990, 68, 1898–1902. [Google Scholar] [CrossRef]
  29. Guarnaccia, V.; Groenewald, J.Z.; Woodhall, J.; Armengol, J.; Cinelli, T.; Eichmeier, A.; Ezra, D.; Fontaine, F.; Gramaje, D.; Gutierrez-Aguirregabiria, A.; et al. Diaporthe diversity and pathogenicity revealed from a broad survey of grapevine diseases in Europe. Persoonia 2018, 40, 135–153. [Google Scholar] [CrossRef]
  30. White, T.J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols, a Guide to Methods and Applications; Academic Press: Cambridge, MA, USA, 1990. [Google Scholar]
  31. Carbone, I.; Kohn, L.M. A method for designing primer sets for the speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  32. O’Donnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef]
  33. Han, S.; Chen, J.; Zhao, Y.; Cai, H.; Guo, C. Bacillus subtilis HSY21 can reduce soybean root rot and inhibit the expression of genes related to the pathogenicity of Fusarium oxysporum. Pestic. Biochem. Physiol. 2021, 178, 104916. [Google Scholar] [CrossRef]
  34. Chang, X.; Yan, L.; Naeem, M.; Khaskheli, M.I.; Zhang, H.; Gong, G.; Zhang, M.; Song, C.; Yang, W.; Liu, T.; et al. Maize/Soybean relay strip intercropping reduces the occurrence of Fusarium root rot and changes the diversity of the pathogenic Fusarium species. Pathogens 2020, 9, 211. [Google Scholar] [CrossRef]
  35. Martin, S.B.; Lucas, L.T.; Campbell, C.L. Comparative sensitivity of Rhizoclonia solani and Rhizoclonia-like fungi to selected fungicides in vitro. Phytopathology 1984, 74, 778–781. [Google Scholar] [CrossRef]
  36. Gi, S.G.; Kim, W.Y.; Yang, K.Y. Emergence of multiple Diaporthe species causing kiwifruit rot and occurrence of resistance to a methyl benzimidazole carbamate fungicide in South Korea. Crop Prot. 2022, 158, 106016. [Google Scholar] [CrossRef]
  37. Miao, J.; Dong, X.; Lin, D.; Wang, Q.; Liu, P.; Chen, F.R.; Du, Y.; Liu, X. Activity of the novel fungicide oxathiapiprolin against plant-pathogenic oomycetes. Pest. Manag. Sci. 2016, 72, 1572–1577. [Google Scholar] [CrossRef]
  38. Miao, J.; Liu, X.; Du, X.; Li, G.; Li, C.; Zhao, D.; Liu, X. Sensitivity of Pythium spp. and Phytopythium spp. and tolerance mechanism of Pythium spp. to oxathiapiprolin. Pest. Manag. Sci. 2020, 76, 3975–3981. [Google Scholar] [CrossRef] [PubMed]
  39. Li, Y.W.; Wang, Y.; Li, X.Y.; Fan, H.J.; Gao, X.H.; Peng, Q.; Li, F.; Lu, L.; Miao, J.; Liu, X. Resistant risk and resistance-related point mutation in SdhC1 of pydiflumetofen in Fusarium pseudograminearum. Pest. Manag. 2023, 79, 4197–4207. [Google Scholar] [CrossRef]
  40. Aamir, M.; Singh, V.K.; Dubey, M.K.; Meena, M.; Kashyap, S.P.; Katari, S.K.; Upadhyay, R.S.; Umamaheswari, A.; Singh, S. In silico prediction, characterization, molecular docking, and dynamic studies on fungal SDRs as novel targets for searching potential fungicides against fusarium wilt in tomato. Front. Pharmacol. 2018, 9, 1038. [Google Scholar] [CrossRef]
  41. Tian, C.; Kasavajhala, K.; Belfon, K.; Raguette, L.; Huang, H.; Migues, A.N.; Bickel, J.; Wang, Y.; Pincay, J.; Wu, Q.; et al. ff19SB: Amino-Acid-Specific protein backbone parameters trained against quantum mechanics energy surfaces in solution. J. Chem. Theory Comput. 2020, 16, 528–552. [Google Scholar] [CrossRef]
  42. Roe, D.R.; Cheatham, T.E. Parallelization of CPPTRAJ enables large scale analysis of molecular dynamics trajectory data. J. Comput. Chem. 2018, 39, 2110–2117. [Google Scholar] [CrossRef]
  43. Miller, B.R.; McGee, T.D.; Swails, J.M.; Homeyer, N.; Gohlke, H.; Roitberg, A.E. MMPBSA.py: An efficient program for End-State free energy calculations. J. Chem. Theory Comput. 2012, 8, 3314–3321. [Google Scholar] [CrossRef] [PubMed]
  44. Ramaswamy, A.; Balasubramanian, S.; Rajagopalan, M. Chapter 12—Biomolecular talks—Part 2: Applications and challenges of molecular docking approaches. Methods Mol Biol. 2024, 2780, 203–255. [Google Scholar] [CrossRef]
  45. Ren, J.J.; Wang, W.H.; Li, H.; Hou, P.X.; Ma, Z.Q.; Feng, J.T.; Wu, H. Efficacy of Ginkgo biloba L. and Derris trifoliata binary extract combinations against aphids (Hemiptera: Aphididae). Crop Prot. 2023, 164, 106144. [Google Scholar] [CrossRef]
  46. Sun, Y.P.; Johnson, E.R. Synergistic and antagonistic actions of insecticide-synergist combinations and their mode of action. J. Agric. Food Chem. 1960, 8, 261–266. [Google Scholar] [CrossRef]
  47. Vidić, M.; Petrović, K.; Đorđević, V.; Riccioni, L. Occurrence of Phomopsis longicolla β conidia in naturally infected soybean. J. Phytopathol. 2013, 161, 470–477. [Google Scholar] [CrossRef]
  48. Wrather, J.A.; Anderson, T.R.; Arsyad, D.M.; Tan, Y.; Ploper, L.D.; Porta-Puglia, A.; Ram, H.H.; Yorinori, J.T. Soybean disease loss estimates for the top ten soybean producing countries in 1998. Can. J. Plant Pathol. 2001, 23, 115–121. [Google Scholar] [CrossRef]
  49. Li, B.J.; Chen, Q.H.; Lan, Z.C.; Wang, N.N.; Wang, Y.C.; Weng, Q.Y. Identification and pathogenicity test of the pathogens causing soybean root rot in Fu Jian. Fujian J. Agric. Sci. 2011, 26, 798–803. [Google Scholar] [CrossRef]
  50. Chandra, S.; Choudhary, M.; Bagaria, P.K.; Nataraj, V.; Kumawat, G.; Choudhary, J.R.; Sonah, H.; Gupta, S.; Wani, S.H.; Ratnaparkhe, M.B. Progress and prospectus in genetics and genomics of Phytophthora root and stem rot resistance in soybean (Glycine max L.). Front. Genet. 2022, 13, 939182. [Google Scholar] [CrossRef]
  51. Carroll, G.C. The biology of endophytism in plants with particular reference to woody perennials. In Microbiology of the Phyllosphere; Cambridge University Press: London, UK, 1986. [Google Scholar]
  52. Zhao, X.; Zhang, Z.; Zheng, S.; Ye, W.; Zheng, X.; Wang, Y. Genome sequence resource of Phomopsis longicolla YC2-1, a fungal pathogen causing phomopsis stem blight in soybean. Mol. Plant-Microbe Interact. 2021, 34, 842–844. [Google Scholar] [CrossRef]
  53. Muralli, T.S.; Suryanarayanan, T.S.; Geeta, R. Endophytic Phomopsis species: Host range and implications for diversity estimates. Can. J. Microbiol. 2006, 52, 673–680. [Google Scholar] [CrossRef]
  54. Garcia-Reyne, A.; López-Medrano, F.; Morales, J.M.; García-Esteban, C.; Martín, I.; Eraña, I.; Meije, Y.; Lalueza, A.; Alastruey-Izquierdo, A.; Rodríguez-Tudela, J.L.; et al. Cutaneous infection by Phomopsis longicolla in a renal transplant recipient from Guinea: First report of human infection by this fungus. Transpl. Infect. Dis. 2010, 13, 204–207. [Google Scholar] [CrossRef] [PubMed]
  55. Sanglard, D.; Odds, F.C. Resistance of candida species to antifungal agents molecular mechanisms and clinical consequences. Lancet Infect. Dis. 2002, 2, 73–85. [Google Scholar] [CrossRef] [PubMed]
  56. Kao, W.C.; Hunte, C. Quinone binding sites of cyt bc complexes analysed by X-ray crystallography and cryogenic electron microscopy. Biochem. Soc. Trans. 2022, 50, 877–893. [Google Scholar] [CrossRef] [PubMed]
  57. Jain, A.N. Surflex: Fully automatic flexible molecular docking using a molecular similarity-based search engine. J. Med. Chem. 2003, 46, 499–511. [Google Scholar] [CrossRef]
  58. Tian, Z.; Li, Y.; Wang, X.; Cui, K.; Guo, J.; Wang, M.; Hao, Y.; Zhang, F. Exploring the mechanism of Astragali radix for promoting osteogenic differentiation based on network pharmacology, molecular docking, and experimental validation. Chem. Biol. Drug Des. 2023, 102, 1489–1505. [Google Scholar] [CrossRef]
Jof 11 00292 g001
Figure 1. Identification of Diaporthe longicolla obtained from soybean rots according to morphological and phylogenesis analysis in Heilongjiang, China. (A) Typical colonies of D. longicolla observed after culturing for 3 days on PDA medium; (B) Macroconidia morphology of D. longicolla following incubation for 14 days on WA medium; (C) The ITS, β-tub, EF1-α, and CAL sequences of D. longicolla isolates were obtained from GenBank, and the phylogenetic tree was developed via maximum likelihood using MEGA 7.0 based on these three sequences; (D) Pathogenicity of D. longicolla on etiolated soybean seedlings inoculated in the dark at 25 °C. CK represented the control inoculated with an empty PDA medium of 5 mm diameter, and the lesion diameter was determined after 7 days.
Figure 1. Identification of Diaporthe longicolla obtained from soybean rots according to morphological and phylogenesis analysis in Heilongjiang, China. (A) Typical colonies of D. longicolla observed after culturing for 3 days on PDA medium; (B) Macroconidia morphology of D. longicolla following incubation for 14 days on WA medium; (C) The ITS, β-tub, EF1-α, and CAL sequences of D. longicolla isolates were obtained from GenBank, and the phylogenetic tree was developed via maximum likelihood using MEGA 7.0 based on these three sequences; (D) Pathogenicity of D. longicolla on etiolated soybean seedlings inoculated in the dark at 25 °C. CK represented the control inoculated with an empty PDA medium of 5 mm diameter, and the lesion diameter was determined after 7 days.
Jof 11 00292 g001
Jof 11 00292 g002
Figure 2. Bar chart of sensitivity with Diaporthe longicolla to eight fungicides. Eight fungicides in total, including tebuconazole, prothioconazole, mefentrifluconazole, fludioxonil, phenamacril, azoxystrobin, pydiflumetofen and fluopyram were assessed. Each treatment consisted of three replicates. The diameter of each colony was examined perpendicularly following five days of incubation at 25 °C in the dark. The experiment was performed in duplicate. Each column represents the sensitivity of three strains to a fungicide with three independent biological replicates, with error bars representing three biological replicates of the three strains. Different letters represent significant differences detected by one-way ANOVA (p < 0.05).
Figure 2. Bar chart of sensitivity with Diaporthe longicolla to eight fungicides. Eight fungicides in total, including tebuconazole, prothioconazole, mefentrifluconazole, fludioxonil, phenamacril, azoxystrobin, pydiflumetofen and fluopyram were assessed. Each treatment consisted of three replicates. The diameter of each colony was examined perpendicularly following five days of incubation at 25 °C in the dark. The experiment was performed in duplicate. Each column represents the sensitivity of three strains to a fungicide with three independent biological replicates, with error bars representing three biological replicates of the three strains. Different letters represent significant differences detected by one-way ANOVA (p < 0.05).
Jof 11 00292 g002
Jof 11 00292 g003
Figure 3. Domain structure and phylogenetic tree examination of Diaporthe longicolla SdhA, SdhB, SdhC and SdhD proteins. (A) The structural domains of the SdhA, SdhB, SdhC and SdhD subunits in D. longicolla. The protein domains were mapped using DOG 2.0 software, with different colors representing different domains on the corresponding subunits; (B) The SdhA, SdhB, SdhC and SdhD sequences of D. longicolla isolates were obtained from GenBank, and the phylogenetic tree were developed via maximum likelihood using MEGA 7.0 according to these sequences in D. longicolla. Black triangles represents SdhA protein, black squares represents SdhB protein, black diamonds represents SdhC protein, and black circles represents SdhD protein.
Figure 3. Domain structure and phylogenetic tree examination of Diaporthe longicolla SdhA, SdhB, SdhC and SdhD proteins. (A) The structural domains of the SdhA, SdhB, SdhC and SdhD subunits in D. longicolla. The protein domains were mapped using DOG 2.0 software, with different colors representing different domains on the corresponding subunits; (B) The SdhA, SdhB, SdhC and SdhD sequences of D. longicolla isolates were obtained from GenBank, and the phylogenetic tree were developed via maximum likelihood using MEGA 7.0 according to these sequences in D. longicolla. Black triangles represents SdhA protein, black squares represents SdhB protein, black diamonds represents SdhC protein, and black circles represents SdhD protein.
Jof 11 00292 g003
Jof 11 00292 g004
Figure 4. Molecular dynamics simulation of SDHI fungicides with the Diaporthe longicolla Sdh proteins. (A) The average RMSD of the fluopyram and pydiflumetofen system; (B) Binding mode of fluopyram. Fluopyram formed hydrophobic bonds with the residues in black font, and the binding free energy was −23.92 kcal/mol; (C) Pydiflumetofenformed hydrophobic bonds with the residues in black font, and the binding free energy was −30.02 kcal/mol.
Figure 4. Molecular dynamics simulation of SDHI fungicides with the Diaporthe longicolla Sdh proteins. (A) The average RMSD of the fluopyram and pydiflumetofen system; (B) Binding mode of fluopyram. Fluopyram formed hydrophobic bonds with the residues in black font, and the binding free energy was −23.92 kcal/mol; (C) Pydiflumetofenformed hydrophobic bonds with the residues in black font, and the binding free energy was −30.02 kcal/mol.
Jof 11 00292 g004
Table 1. Fungicides and concentration gradients of eight fungicides acting on Diaporthe longicolla.
Table 1. Fungicides and concentration gradients of eight fungicides acting on Diaporthe longicolla.
FungicideConcentration Gradient (μg/mL)
Tebuconazole0, 0.1, 0.4, 0.8, 1, 2.5
Prothioconazole0, 1,5, 10, 25, 50, 100
Mefentrifluconazole0, 0.005, 0.05, 0.25, 1, 5, 20
Fludioxonil0, 0.01, 0.02, 0.05, 0.1, 0.25, 1
Phenamacril0, 0.05, 0.25, 0.5, 1.25, 2.5, 10
Pydiflumetofen0, 0.2, 0.5, 1, 2.5, 5, 10
Fluopyram0, 1, 10, 20, 50, 100
Azoxystrobin0, 0.01, 0.02, 0.05, 0.1, 0.25, 1
Table 2. Details of primers employed to amplify the Sdh (A, B, C, and D) genes isolates Diaporthe longicolla isolates.
Table 2. Details of primers employed to amplify the Sdh (A, B, C, and D) genes isolates Diaporthe longicolla isolates.
Primer Primer Sequence (5′–3′)Product Length (bp)
SdhA(F)TTATCACGGCTGATGTCGGATCG2000
SdhA(R)CCTTCTGGAAAGACAAGGTGTGCTT
SdhB(F)ATGGCTGCTCTCCGCTCTACCTCCA850
SdhB(R)TACACAGCCATCTCCTTCTTGATCT
SdhC(F)ATGATTACCTCAAGGGCAGG550
SdhC(R)TTACAGCAGGAACGCAACACCCA
SdhD(F)ATGGCATCCACTGCTCGTTCGGCT600
SdhD(R)TCATGCTCGCCAAAGCCTCTT
Table 3. The synergistic effect of fludioxonil and mefentrifluconazole, fludioxonil and pydiflumetofen against against Diaporthe longicalla at different ratios.
Table 3. The synergistic effect of fludioxonil and mefentrifluconazole, fludioxonil and pydiflumetofen against against Diaporthe longicalla at different ratios.
Mixture (A:B)Mixture Ratios (A:B)EC50 (μg/mL)Co-Toxicity IndexInteraction Efficiency
Mefentrifluconazole and fludioxonil1:00.0663--
0:10.0047--
1:10.507017.3131antagonistic
1:50.0044126.3899synergism
5:10.037755.2262antagonistic
Pydiflumetofen and fludioxonil1:06.9921--
0:10.0057--
10:10.42201.4857antagonistic
1:50.0049695.1258synergism
5:10.23792.8747antagonistic
A represents the mixed fungicide mefentrifluconazole or pydiflumetofen, and B represents fludioxonil.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, S.; Liu, Z.; Chang, Z.; Zheng, Y.; Wang, X.; Li, N.; Huang, Z.; Zhang, C.; Liu, X. Exploring Fungicide Sensitivity in Soybean Stem Blight Pathogen Diaporthe longicolla, Emphasizing Genetic Variability Impact on Response to SDHI Fungicides Fluopyram and Pydiflumetofen. J. Fungi 2025, 11, 292. https://doi.org/10.3390/jof11040292

AMA Style

Chen S, Liu Z, Chang Z, Zheng Y, Wang X, Li N, Huang Z, Zhang C, Liu X. Exploring Fungicide Sensitivity in Soybean Stem Blight Pathogen Diaporthe longicolla, Emphasizing Genetic Variability Impact on Response to SDHI Fungicides Fluopyram and Pydiflumetofen. Journal of Fungi. 2025; 11(4):292. https://doi.org/10.3390/jof11040292

Chicago/Turabian Style

Chen, Shanshan, Zhanyun Liu, Zhengjie Chang, Yuxin Zheng, Xueyang Wang, Ningwei Li, Zhongqiao Huang, Can Zhang, and Xili Liu. 2025. "Exploring Fungicide Sensitivity in Soybean Stem Blight Pathogen Diaporthe longicolla, Emphasizing Genetic Variability Impact on Response to SDHI Fungicides Fluopyram and Pydiflumetofen" Journal of Fungi 11, no. 4: 292. https://doi.org/10.3390/jof11040292

APA Style

Chen, S., Liu, Z., Chang, Z., Zheng, Y., Wang, X., Li, N., Huang, Z., Zhang, C., & Liu, X. (2025). Exploring Fungicide Sensitivity in Soybean Stem Blight Pathogen Diaporthe longicolla, Emphasizing Genetic Variability Impact on Response to SDHI Fungicides Fluopyram and Pydiflumetofen. Journal of Fungi, 11(4), 292. https://doi.org/10.3390/jof11040292

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop