Diversity of Alternaria Section Nimbya in Iran, with the Description of Eight New Species

Ahmadpour, Abdollah; Ghosta, Youbert; Alavi, Zahra; Alavi, Fatemeh; Poursafar, Alireza; Rampelotto, Pabulo Henrique

doi:10.3390/jof11030225

Open AccessArticle

Diversity of Alternaria Section Nimbya in Iran, with the Description of Eight New Species

by

Abdollah Ahmadpour

^1,*

,

Youbert Ghosta

^2,*

,

Zahra Alavi

²

,

Fatemeh Alavi

²

,

Alireza Poursafar

³

and

Pabulo Henrique Rampelotto

⁴

¹

Higher Education Center of Shahid Bakeri, Urmia University, Miyandoab 59781-59111, Iran

²

Department of Plant Protection, Faculty of Agriculture, Urmia University, Urmia 57561-51818, Iran

³

Department of Plant Pathology, North Dakota State University, Fargo, ND 58102, USA

⁴

Bioinformatics and Biostatistics Core Facility, Institute of Basic Health Sciences, Federal University of Rio Grande do Sul, Porto Alegre 91501-970, Brazil

^*

Authors to whom correspondence should be addressed.

J. Fungi 2025, 11(3), 225; https://doi.org/10.3390/jof11030225

Submission received: 27 February 2025 / Revised: 10 March 2025 / Accepted: 12 March 2025 / Published: 15 March 2025

(This article belongs to the Collection Fungal Biodiversity and Ecology)

Download

Browse Figures

Review Reports Versions Notes

Abstract

:

Alternaria includes endophytes, saprophytes, and pathogens affecting both plants and animals, with a global distribution across various hosts and substrates. It is categorized into 29 sections, each defined by a type species and six monophyletic lineages. The Alternaria section Nimbya comprises 10 species primarily associated with the families Juncaceae and Cyperaceae, functioning as either saprophytes or plant pathogens. In this study, 189 fungal strains were collected from multiple locations across six provinces in Iran. The isolates were initially classified based on morphological characteristics and ISSR-PCR molecular marker banding patterns. Multi-gene phylogenetic analyses of 38 selected strains, using ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1 gene sequences, combined with morphological data, led to the identification of 13 species, including eight new species, namely Alternaria caricifolia, A. cyperi, A. juncigena, A. junci-inflexi, A. persica, A. schoenoplecti, A. salkadehensis, and A. urmiana. In addition, this work identified new host associations (matrix nova) for three previously known species: A. caricicola on Cyperus sp., A. cypericola on Eleocharis sp., and A. junci-acuti on Carex sp. The study provides detailed morphological descriptions and illustrations of all identified species, discusses their habitats, distribution, and phylogenetic relationships within section Nimbya, and presents a key for species identification within this section in Iran. Furthermore, these findings highlight the significance of studying fungal biodiversity in Iran and contribute to a better understanding of species distribution and host range within the Alternaria section Nimbya.

Keywords:

Alternaria; ISSR marker; multi-gene phylogeny; new taxa; species diversity; taxonomy

1. Introduction

The genus Nimbya E.G. Simmons was introduced with N. scirpicola (Fuckel) E.G. Simmons as the type species to accommodate fungi with a morphology similar to the genera Alternaria Nees, Sporidesmium Link, and Drechslera S. Ito. However, the most distinct and useful diagnostic character for differentiating Nimbya from these genera is the internal compartmentation of conidia into well-defined, usually angular lumina, surrounded by an abundant distoseptum matrix [1]. The conidial lumina are interconnected by narrow channels through the transverse distosepta, with transverse eusepta inserted at maturity. Sexual morphs of Nimbya spp. were classified under the genus Macrospora Fuckel [1,2]. After the initial description of five Nimbya species, the number of described species, or those transferred to Nimbya from other genera based on morphological characteristics, gradually increased. By 2005, the number of Nimbya had reached 17 species [3,4,5,6,7,8,9]. Various species of Nimbya have been recorded on plants from the families Amaranthaceae, Asteraceae, Caryophyllaceae, Cyperaceae, Euphorbiaceae, Fabaceae, Juncaceae, and Solanaceae [1,9]. Based on conidium morphology, a close relationship between Nimbya and Alternaria was proposed [2,4].

With the advent of genome sequencing and phylogenetic analyses, these methods became valuable tools for identifying species boundaries and phylogenetic relationships. In the first phylogenetic study of Nimbya, the relationships among N. caricis and N. scirpicola, along with species of Embellisa, Alternaria, Ulocladium, and Stemphylium, were examined using the internal transcribed spacer region of rDNA (ITS–rDNA), the mitochondrial small-subunit (mt SSU), and glyceraldehydes-3-phosphate dehydrogenase (GAPDH) gene sequences [10]. The results revealed that the studied species in Alternaria, Embellisia, Nimbya, and Ulocladium formed a large monophyletic clade, with Stemphylium as a sister clade. Moreover, Ulocladium and Embellisia were found to be polyphyletic, suggesting that using only morphological characteristics to differentiate these genera could be misleading, as the key characters used are homoplastic [10]. Similar results from GAPDH and Alternaria major allergen (Alt a 1) genes sequences, also indicated close relationships between Nimbya spp., Alternaria spp. in the infectoria species group, and some Embellisia spp. [11]. A more comprehensive phylogenetic study using a larger set of isolates examined the relationships of Nimbya and Embellisia with other closely related genera, based on ITS–rDNA, Alt a 1, and GAPDH sequences [12]. The study revealed the polyphyletic nature of both Embellisia and Nimbya, dividing species within each genus into four and two clades, respectively. Nimbya group I included four species (N. caricis, N. scirpicola, N. scirpinfestans, and N. scirpivora), while group II contained three species (N. alternantherae, N. celosiae, and N. perpunctulata). Morphological and ecological comparisons among these species indicated that group I species had short-beaked conidia and were associated with the Juncaceae and Cyperaceae plant families, while the group II species, with long-beaked conidia, originated from plants in the family Amarantaceae, suggesting independent evolutionary origins. Three species from group II were transferred to Alternaria, and a new species group, Alternanthera species group, was established to accommodate them [12]. This species group concept was an early attempt at a classification scheme for identifying Alternaria species based on two morphological characteristics: three-dimensional sporulation pattern and conidium morphology, with each species group typified by a representative species [4,13]. In a subsequent study using five phylogenetically informative loci—GAPDH, Alt a 1, Actin (ACT), Plasma membrane ATPase (ATPase), and Calmodulin (CAL)—eight well-supported asexual lineages of Alternaria were identified and grouped into species groups (both previously known and newly identified) [14]. These eight species groups were elevated to the taxonomic rank of “section”, a rank that had previously been used by Neergaard [15] and Joly [16] to classify Alternaria species.

In a landmark study aimed at delineating the phylogenetic lineages and establishing a robust taxonomy within Alternaria and allied genera, six genomic regions (18S nrDNA (SSU), 28SnrDNA (LSU), ITS–rDNA, GAPDH, RPB2, and TEF1) were sequenced [17]. This study recognized 24 internal clades and six monotypic lineages under the Alternaria clade. The 24 clades were called sections (each typified by a type species), thirteen generic names, Allewia, Brachycladium, Chalastospora, Chmelia, Crivellia, Embellisia, Lewia, Nimbya, Sinomyces, Tretispora, Ulocladium, Undifilum, and Ybotromyces were put as synonymy with Alternaria and generic circumscription of Alternaria was amended. In addition, species previously classified as Nimbya proper (Nimbya group I) [12], were reclassified under Alternaria and placed in section Nimbya. A re-examination of morphological characteristics of species formerly identified as Nimbya spp., without phylogenetic analysis, to determine their affiliation with any Alternaria section, resulted in the inclusion of A. heteroschemos and A. juncicola in the Nimbya section [18]. More recently, four new species—A. caricicola, A. cypericola, A. heyranica, and A. junci-acuti—were described in the Nimbya section, based on combined morphological features and multi-gene phylogeny, and the number of species in this section was raised to 10 [19,20].

The plant order Poales is one of the most diverse and ecologically significant groups of angiosperms, encompassing 14 families and over 24,300 species. Members of the Poales families are found worldwide and are notable for their species richness, ecological adaptations, and diverse life forms. They have significantly influenced the evolution of mammals, including hominids, and form the foundation of much of the human diet [21,22]. Among these, the Cyperaceae family, commonly known as sedges, ranks as one of the three largest monocot families and one of the 10 largest plant families overall, with 5687 distributed globally [23]. Cyperaceae plants play crucial roles in various habitats, from wetlands to deserts, dominating wetland vegetation, contributing to nutrient cycling, and providing habitats for numerous species. Additionally, members of this family are used for medicinal purposes, to treat multiple diseases and ailments, as important sources of essential oils, and as a source of food and animal feed [24,25]. However, some Cyperaceae species are invasive weeds, posing threats to the natural ecosystems and agricultural and forest productivity [26]. The family Juncaceae, also known as the rush family, comprises around 500 species of monocotyledonous flowering plants. These plants are integral to aquatic and wetland ecosystems, offering habitats for fauna, helping slow water flow, preventing soil erosion, and improving water quality. Historically, certain Juncaceae species have been used for crafting materials such as baskets and chair bottoms, as well as in traditional herbal medicines due to their bioactive compounds, including phenanthrenes and phenanthrenes-like molecules [27,28].

Both Cyperaceae and Juncaceae plants serve as hosts for a wide variety of fungi, including members of the Alternaria section Nimbya. Some of these fungi are parasitic, causing substantial damage to their host plants, while others function as saprophytes, aiding in decomposition and nutrient cycling. Previous studies on Alternaria species associated with these plant families have already shown a significant level of species diversity [19,20]. In this study, a larger set of fungal isolates were collected from various regions across six provinces in Iran. Through a combination of morphological examination and multi-gene phylogenetic analysis, thirteen species were identified, eight of which are new to science. This paper provides detailed descriptions and illustrations of these species, as well as an analysis of their phylogenetic and host relationships within the section.

2. Materials and Methods

2.1. Fungal Isolates

Plant samples, including leaves and culms from the families Cyperaceae and Juncaceae, exhibiting discolored lesions and blight symptoms, were collected from various wetland areas across six provinces in Iran (Ardebil, East Azarbaijan, Golestan, Guilan, Mazandaran, and West Azarbaijan) during 2019–2021 (Figure 1). The samples were properly labeled, kept cold, and transported to the laboratory. Fungal isolation and purification were followed using the method described by Ahmadpour et al. [20]. Fungal isolates were kept in potato carrot agar (PCA, 20 g potato, 20 g carrot, 20 g agar, and 1000 mL of distilled water) slants at 4 °C for short-term preservation and on sterile filter paper segments at −20 °C for long-term preservation. Pure cultures of all identified isolates were deposited in the fungal culture collections of the Iranian Research Institute of Plant Protection (IRAN) and Urmia University (FCCUU).

2.2. Morphological Observations

Morphological observations were made from the fungal strains growing on potato carrot agar (PCA) medium, incubated at 23–25 °C under Cool White fluorescent light with 8/16 h light/dark cycle for 5–7 days without humidity control [1,2]. Strains showing reduced sporulation under these conditions were transferred to synthetic nutrient-poor agar medium (SNA) [29] containing a small piece of autoclaved filter paper to promote sporulation [17]. Slide mounts were prepared using lactophenol or lactophenol cotton blue, and micro-morphological features of hyphae, as well as asexual and sexual structures (when induced) were examined using an Olympus AX70 compound microscope (Olympus Optical CO., LTD, Tokyo, Japan). Measurements were taken for 30–50 structures, including hyphae, conidiophores, conidia, ascomata, asci, and ascospores, and microphotographs were captured from the slide mounts. Colony morphology was also characterized from cultures grown on Potato Dextrose Agar (PDA, Merck, Darmstadt, Germany), PCA, and V-8A (175 mL of commercial V8 vegetable juice, 3 g CaCO₃, 20 g Agar, and 1000 mL of distilled water) media after incubation in the dark at 25 °C for 7 days. Colony color was determined using Rayner’s color charts [30]. To induce ascomata formation, 2% water agar plates containing a 6 cm autoclaved host plant culm segment were inoculated and incubated at three temperatures (15, 18, and 23 °C) for 30–60 days [8]. Taxonomic novelties were deposited in MycoBank [31].

2.3. DNA Extraction and PCR Amplification

DNA was extracted from the mycelial mass of each isolate, which was obtained from 10-day-old PDA plates, using a standard sodium dodecyl sulfate (SDS) lysis buffer. The extraction process involved chloroform extraction followed by isopropanol precipitation [19]. Polymorphic banding patterns were generated for all isolates using inter simple sequence repeat (ISSR)-PCR with the ISSR5 ((GA)5YC) primer for preliminary screening. Each PCR reaction contained 0.4 μM of the primer, 4 μL ready master mix (Taq DNA polymerase 2X Master Mix Red, 2 mM MgCl₂, Ampliqon Company, Odense, Denmark), and approximately 10 ng of template DNA in a total volume of 10 μL. The thermal cycling conditions included an initial denaturation step at 95 °C for 5 min, followed by 35 cycles of 95 °C for 45 s, 41 °C for 60 s, and 72 °C for 90 s, with a final extension step at 72 °C for 10 min. Amplicons were visualized on a 1% agarose gel. Isolates with identical banding patterns were classified as closely related taxa [20]. To analyze phylogenetic relationships, 38 isolates were chosen based on ISSR banding pattern and morphological characteristics for multi-gene sequencing. Target regions included the internal transcribed spacer (ITS–rDNA), parts of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), RNA polymerase II largest subunit (RPB2), translation elongation factor 1-alpha (TEF1) and Alternaria major allergen (Alt a 1) genes, using primers listed in Table 1. PCR conditions and reaction mixtures were consistent with Ahmadpour et al. [20]. The resulting amplicons were visualized on a 1.5% agarose gel stained with GelRedTM (Biotium, Hayward, CA, USA) and viewed under UV light. Amplicon sizes were determined using a HyperLadderTM I molecular marker (Bioline, Memphis, TN, USA). The amplified products were then purified and sequenced using the same primer sets by Macrogen Corp. (Seoul, Republic of Korea).

2.4. Sequence Alignment and Phylogenetic Analyses

DNA sequences generated for the new strains were examined and trimmed using MEGA 6.0 [38], and then exported as FASTA files for subsequent analyses. Published and verified DNA sequences of various loci for the type or representative Alternaria strains were obtained from the GenBank database and incorporated into the phylogenetic analyses (Table 2) [12,17,19,20,39,40,41,42,43]. Multiple sequence alignments for each locus were created using the MAFFT version 7 online tool (https://mafft.cbrc.jp/alignment/server/; accessed on 20 February 2025) [44], with further manual adjustments and trimming conducted in MEGA 6.0 when needed. A five-gene concatenated dataset (ITS–rDNA + GAPDH + TEF1 + RPB2 + Alt a 1) was generated using Mesquite v. 3.61 [45]. Two separate multi-locus phylogenetic analyses were performed: one focusing on Alternaria species within section Nimbya using a concatenated five-gene dataset, and a broader analysis including DNA sequences from 29 Alternaria sections and six monotypic lineages. Bayesian inference (BI) analysis was conducted using MrBayes v. 3.2.7 [46] with the Markov Chain Monte Carlo (MCMC) method, utilizing four chains, 1M generations, and a heated chain temperature of 0.1. Trees were saved every 1000 generations, with a burn-in of 25%, and posterior probabilities (PP) calculated from the remaining trees. The run was considered complete when the average standard deviation of split frequencies dropped below 0.01. MrModeltest 2.3 [47] and the Akaike Information Criterion (AIC) were used to identify the best-fit evolutionary models for BI (Table 3). Maximum-likelihood analyses were performed with the RAxML-HPC BlackBox v. 8.2.12 [48] on the CIPRES Science Gateway version 3.3 (accessible at https://www.phylo.org/) [49], using the GTRGAMMA + I substitution model. Maximum Parsimony (MP) analysis was carried out in PAUP v. 4.0b10 [50], using a heuristic search with 1000 random sequence additions and tree-bisection-reconnection (TBR) branch swapping, treating gaps as missing data. Bootstrap support values were calculated from 1000 replicates, and descriptive tree statistics [Tree Length (TL), Consistency Index (CI), Retention Index (RI), and Homoplasy Index (HI)] were determined from MP analysis. Outgroup taxa included sequences of Alternaria chlamydospora (CBS 491.72), A. phragmospora (CBS 274.70) from section Phragmosporae, and Stemphylium botryosum (CBS 714.68) and S. vesicarium (CBS 191.86) for small- and large-scale analyses, respectively. The resulting phylogenetic trees were visualized in FigTree v. 1.4.4 [51] and refined using Adobe Illustrator^® CC 2021. The newly generated sequences were submitted to GenBank (Table 2) and the concatenated alignments were deposited in TreeBASE (https://www.treebase.org) under the Submission ID 26865.

2.5. Genealogical Concordance Phylogenetic Species Recognition Analysis

The Genealogical Concordance Phylogenetic Species Recognition (GCPSR) was employed to identify significant recombinant events [52]. Five-locus concatenated dataset (including ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1) was used to determine the recombination level within phylogenetically closely related species. The data were analyzed using SplitsTree 5 software, applying the pairwise homoplasy index (PHI or Φw) test [53,54]. Results from the PHI test, with a value less than 0.05 (Φw < 0.05), indicate a significant presence of recombination within the dataset. To visualize the relationships between new taxa and their closely related species, split graphs were constructed and visualized using both the LogDet transformation and split decomposition options.

3. Results

3.1. Phylogenetic Analyses

A summary of phylogenetic information and substitution models for each dataset is provided in Table 3. The topologies of individual gene trees were consistent, with no conflicts observed in species delimitation. In the large-scale phylogenetic tree, combined analyses using BI and ML/MP methods revealed that our isolates grouped with strong support (ML/MP/BI = 99/74/1.0) within the Alternaria section Nimbya, distributed in 13 lineages (Figure 2). The multi-locus datasets for large-scale analyses included a total of 2299 characters (1257 constant sites, 1042 variable sites, 106 parsimony-uninformative sites, and 936 parsimony-informative sites), including gaps (462 for ITS, 524 for GAPDH, 187 for TEF1, 690 for RPB2, and 436 for Alt a 1) (Table 3). For the small-scale analyses, which focused exclusively on Alternaria species within section Nimbya, a total of 2307 characters from 55 strains were used (1610 constant sites, 697 variable sites, 52 parsimony-uninformative sites, and 645 parsimony-informative sites), including gaps (469 for ITS, 514 for GAPDH, 177 for TEF1, 716 for RPB2, and 431 for Alt a 1) (Table 3). In the Alternaria section Nimbya phylogenetic tree, our isolates formed 13 distinct lineages with high support values, indicating the presence of 13 species; five have been previously described and eight are newly identified (Figure 2 and Figure 3).

3.2. Taxonomy

A total of 189 fungal isolates were obtained from Cyperaceae and Juncaceae plants. All isolates were examined based on morphology, and ISSR-PCR molecular marker banding patterns, and 38 representative isolates were selected from different plant hosts for phylogenetic analyses (Supplementary Figure S1). Based on phylogenetic analyses and morphological characteristics, the studied isolates were assigned to 13 species in the Alternaria section Nimbya, including eight new species (A. caricifolia, A. cyperi, A. juncigena, A. junci-inflexi, A. persica, A. schoenoplecti, A. salkadehensis, and A. urmiana). Detailed morphological descriptions and illustrations of these eight new species are provided, and their phylogenetic relationships with other species in the Alternaria section Nimbya are discussed below. The new host matrices for three previously known species are introduced (A. caricicola on Cyperus sp., A. cypericola on Eleocharis sp., and A. junci-acuti on Carex sp.), and a key to the recognized species in the Alternaria section Nimbya from Iran is provided.

3.2.1. Alternaria caricifolia A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 4 and Figure 5)

MycoBank No. MB 857570

Etymology. Named after the host, Carex sp. from which this fungus was isolated.

Typification. Iran, West Azarbaijan province, Mahabad County, isolated from the leaves and culms of Carex sp. (Cyperaceae, Poales) with circular to fusiform lesions, light brown to gray at center, brown to dark brown at margins, 10 July 2020, A. Ahmadpour (holotype IRAN 18109F, ex-type culture IRAN 4261C = FCCUU 1401).

Description. Sexual morph on PCA medium: Ascomata pseudothecial, ovoid to subglobose, dark brown to black, relatively thick-walled with flattened base, scattered or rarely aggregated, 120–240 × 90–220 μm (

\bar{x}

= 180 × 170 μm, n = 30), formed on the surface of or embedded in culture medium. Pseudoparaphyses hyphoid, septate, 50–100 × 2–3 μm. Asci bitunicate, cylindrical to clavate, straight or slightly curved, with round apex, short pedicel, 57–80 × 15–20 μm (

\bar{x}

= 66 × 7 μm, n = 50), 8-spored, biseriate. Ascospores fusiform to ellipsoidal, hyaline to pale brown, smooth, 2–4 transverse septa, 1–2 longitudinal septa and rarely with one oblique septum, conspicuously constricted at transverse septa, 17–25 × 5–10 μm (

\bar{x}

= 21 × 7 μm, n = 50). Asexual morph on PCA medium: Hyphae branched, septate, smooth, light brown, 2–4 μm wide. Conidiophores macronematous, solitary, erect, simple, straight to slightly curved, septate, light brown to brown, with a single apical conidiogenous locus, or rarely 1–3 geniculate with 1–3 conidiogenous loci, 25–50 × 4–5 μm (

\bar{x}

= 35 × 4.5 μm, n = 50). Conidia mostly solitary or occasionally in chains of two conidia, straight or slightly curved, obclavate to ellipsoid, conidial bodies (35–)50–87(–100) × 5–9 μm (

\bar{x}

= 63 × 7 μm, n = 50), light brown to brown, surface smooth, (3–)6–8(–11) transverse distosepta, 1–2 eusepta, slightly constricted near eusepta, without longitudinal or oblique septum. The cell lumina are distinctly delimited and rectangular, rounded, hexagonal, or encompass the entire cell volume. True beaks are absent, but with an apical cell extension, septate, unbranched, hyaline to light brown, 12–45 × 2–3 μm, occasionally swollen at the apex. Chlamydospores not observed.

Culture characteristics. Colony on PCA flat, entire, floccose, white to rosy buff at center and hazel at margins, 58 mm diam after 7 days at 25 °C. Colony on PDA flat, entire, floccose, rosy buff, 50 mm diam. Colony on V-8A flat, entire, floccose, white to rosy buff, 56 mm diam. Sporulation abundant on PCA, and V-8A media, from the erect conidiophores that arise directly from the surface or the aerial hyphae. Sexual morphs were abundantly formed on PCA and V-8A after 30 days at 25 °C under fluorescent light with an 8/16 h light/dark cycle.

Additional specimen examined. Iran, West Azarbaijan province, Mahabad County, isolated from leaves and culms of Carex sp. (Cyperaceae, Poales), 10 July 2020, A. Ahmadpour (culture FCCUU 1402).

Notes. Based on the results of phylogenetic analyses (Figure 2 and Figure 3), two studied isolates of A. caricifolia clustered well in a separate lineage with 100% ML/MP bootstrap, and 1.0 BI posterior probabilities values, with a sister relationship to a clade consisting of A. cyperi, A. salkadehensis, and A. schoenoplecti. The PHI analysis confirms that A. caricifolia has no significant genetic recombination with closely related species (Φw = > 0.05, Figure 6). A comparison of nucleotide differences in ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1 indicates that A. caricifolia type strain (IRAN 4261C) differs from A. cyperi type strain (IRAN 4223C) by 21/456 bp (4.60%) in ITS–rDNA, 31/495 bp (6.26%, with five gaps (1%)) in GAPDH, 17/170 bp (10%, with four gaps (2%)) in TEF1, 36/746 bp (4.82%) in RPB2 and 57/426 bp (13.38%, with two gaps (0%)) in Alt a 1, from A. salkadehensis type strain (IRAN 4225C) by 23/457 bp (5.03%, with one gap (0%)) in ITS–rDNA, 22/451 bp (4.87%, with three gaps (0%)) in GAPDH, 12/170 bp (7.05%, with four gaps (2%)) in TEF1, 37/748 bp (4.94%) in RPB2 and 53/429 bp (12.35%, with two gaps (2%)) in Alt a 1 and from A. schoenoplecti type strain (IRAN 4263C) by 20/456 bp (4.38%) in ITS–rDNA, 31/495 bp (6.26%, with five gaps (1%)) in GAPDH, 10/170 bp (5.88%, with four gaps (2%)) in TEF1, 34/748 bp (4.54%) in RPB2 and 53/426 bp (12.44%, with two gaps (0%)) in Alt a 1. Alternaria caricifolia can be differentiated of A. cyperi, A. salkadehensis and A. schoenoplecti by its shorter conidiophores (25–50 μm vs. 40–110 μm, (85–)150–300 μm, 40–90 μm, respectively, narrower conidia (5–9 μm vs. 10–12 μm, 10–13 μm, and 12–15(–18) μm, respectively) and presence of sexual morph.

Figure 4. Sexual morph of Alternaria caricifolia (IRAN 4261C). (a–e) Ascomata formed on PCA medium after 30 days ((b) = 4×, (c) = 10×); (f–j) Asci; (k) Ascospores; (l) Germinated ascospore. Scale bars: (d,e) = 100 μm; (f–l) = 20 μm.

Figure 5. Asexual morph of Alternaria caricifolia (IRAN 4261C). (a,b) Symptoms on the leaves and culms of Carex sp.; (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f) Sporulation pattern on PCA (40×); (g–l) Conidiophores and conidia. Scale bars: (g–l) = 20 μm.

Figure 6. The split diagram showing the results of the pairwise homoplasy index (PHI) test of Alternaria caricifolia with its most closely related species (Φw = 0.1625). PHI test results (Φw) < 0.05 indicate significant recombination within the dataset. The new taxa are shown in bold blue.

3.2.2. Alternaria cyperi A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 7)

MycoBank No. MB 857571

Etymology. Named after the host, Cyperus sp. from which this fungus was isolated.

Typification. Iran, East Azarbaijan province, Bonab County, isolated from leaves and culms of Cyperus sp. (Cyperaceae, Poales) with brown to black lesions and blight, 30 October 2019, A. Ahmadpour (holotype IRAN 18096F, ex-type culture IRAN 4223C = FCCUU 1396).

Description. Asexual morph on PCA medium: Hyphae branched, septate, smooth, light brown, 2–4 μm wide. Conidiophores macronematous, solitary, erect, simple, straight to slightly curved, unbranched, septate, light brown to brown, with a single apical conidiogenous locus, or 1–3 geniculate with 1–3 conidiogenous loci, 40–110 × 4–6 μm (

\bar{x}

= 70 × 5 μm, n = 50). Conidia mostly in branched chains of 2–4 conidia or occasionally solitary, straight or slightly curved, obclavate to ellipsoid, apically tapered, conidial bodies (55–)60–90(–100) × 10–12 μm (

\bar{x}

= 80 × 11 μm, n = 50), light brown to brown, surface smooth, (5–)6–9(–12) transverse distosepta, 1–5 eusepta, slightly constricted near eusepta, without longitudinal or oblique septa. True beaks are absent, but with an apical cell extension (secondary conidiophore), up to 15 µm long and 2–4 µm wide, with 1–4 geniculation and 1–4 conidiogenous loci. The cell lumina are distinctly delimited and rectangular, rounded, hexagonal, or encompass the entire cell volume. Chlamydospores and sexual morph were not observed.

Culture characteristics. Colony on PCA flat, entire, floccose, fawn with salmon aerial mycelia, 59 mm diam after 7 days at 25 °C. Colony on PDA flat, entire, floccose, white to rosy buff at center and olivaceous buff at margins, 50 mm diam. Colony on V-8A flat, entire, floccose, white at center and fulvus at margins, 25 mm diam. Sporulation is moderate to scarce on PCA, and V-8A media, from the erect conidiophores that arise directly from the surface or aerial hyphae.

Additional specimen examined. Iran, East Azarbaijan province, Bonab County, isolated from the leaves and culms of Cyperus sp. (Cyperaceae, Poales), 30 October 2019, A. Ahmadpour (culture FCCUU 1397).

Notes. Alternaria cyperi is phylogenetically closely related to A. schoenoplecti and A. salkadehensis (Figure 2 and Figure 3). The PHI analysis confirms that A. cyperi shows no significant genetic recombination with closely related species (Φw = > 0.05, Figure 6). A comparison of nucleotide differences in ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1 indicates that A. cyperi type strain (IRAN 4223C) differs from A. salkadehensis type strain (IRAN 4225C) by 2/458 bp (0.43%, with one gap (0%)) in ITS–rDNA, 12/495 bp (2.42%) in GAPDH, 5/165 bp (3.03%) in TEF1, 22/746 bp (2.94%) in RPB2 and 43/425 bp (10.11%) in Alt a 1 and from A. schoenoplecti type strain (IRAN 4263C) by 2/457 bp (0.43%) in ITS–rDNA, 8/495 bp (1.61%) in GAPDH, 2/165 bp (1.21%) in TEF1, 14/746 bp (1.87%) in RPB2 and 10/425 bp (2.35%) in Alt a 1. Alternaria cyperi differs from A. salkadehensis based on shorter conidiophores (40–110 μm vs. (85–)150–300 μm) and shorter apical cell extension (up to 15 μm vs. up to 45 μm). Alternaria schoenoplecti morphologically differs from A. cyperi by having solitary and C-shaped conidia with strongly constricted at the septa.

Figure 7. Alternaria cyperi (IRAN 4223C). (a,b) Symptoms on the leaves and culms of Cyperus sp.; (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f) Sporulation pattern on PCA (40×); (g–n) Conidiophores and conidia. Scale bars: (g–n) = 20 μm.

3.2.3. Alternaria juncigena A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 8)

MycoBank No. MB 857572

Etymology. Named after the host, Juncus sp. from which this fungus was isolated.

Typification. Iran, West Azarbaijan province, Khoy County, Salkadeh Village, isolated from the culms of Juncus sp. (Juncaceae, Poales), with light to dark brown irregular lesions, 25 September 2020, A. Ahmadpour (holotype IRAN 18211F, ex-type culture IRAN 4779C = FCCUU 1408).

Description. Asexual morph on PCA medium: Hyphae branched, septate, smooth, light brown, 2–4 μm wide. Conidiophores macronematous, solitary, erect, simple, septate, brown, 1–3 geniculate, with 1–3 conidiogenous loci, 40–85 × 5–6 μm (

\bar{x}

= 57 × 5.5 μm, n = 50). Conidia solitary or in chains of 2–3 conidia, straight or slightly curved, obclavate to ellipsoid, conidial bodies (40–)55–90(–110) × 10–14(–16) μm (

\bar{x}

= 70 × 12 μm, n = 50), light brown to brown, surface smooth, (5–)8–12(–15) transverse distosepta, 1–3 eusepta, slightly constricted near eusepta, with 1–3 longitudinal and 0–2 oblique septa. True beaks are absent but with apical cell extension, up to 50 µm in length and 2–3 µm wide, occasionally swollen at apex, rarely with 1–3 geniculate and 1–3 conidiogenous loci. The cell lumina are distinctly delimited and rectangular, rounded, hexagonal, or encompass the entire cell volume. Chlamydospores and sexual morph were not observed.

Culture characteristics. Colony on PCA flat, entire, velvety, pale vinaceous to vinaceous buff, with sparse aerial mycelia, 50 mm diam after 7 days at 25 °C. Colony on PDA flat, entire, floccose, white at center, and rosy buff at margins, 60 mm diam. Colony on V-8A flat, entire, floccose, white to pale violaceous, 68 mm diam. Sporulation moderate to scarce on PCA, and V-8A media, from the erect conidiophores that arise directly from the surface or the aerial hyphae.

Additional specimens examined. Iran, West Azarbaijan province, Khoy County, Salkadeh Village, isolated from the culms of Juncus sp., 25 September 2020, A. Ahmadpour (cultures FCCUU 1409, FCCUU 1410, FCCUU 1411, FCCUU 1412).

Notes. Phylogenetically, Alternaria juncigena forms a distinct lineage with high support values (ML/MP/BI= 97/88/0.99) (Figure 2), and is closely related to A. junci-inflexi and A. persica. A comparison of nucleotide differences in ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1 indicates that A. juncigena type strain (IRAN 4779C) differs from A. junci-inflexi type strain (IRAN 4227C) by 2/449 bp (0.44%) in ITS–rDNA, 6/490 bp (1.22%) in GAPDH, 2/169 bp (1.18%) in TEF1, 10/690 bp (1.44%) in RPB2 and 8/428 bp (1.86%) in Alt a 1, and from A. persica type strain (IRAN 4262C) by 3/450 bp (0.66%, with one gap (0%)) in ITS–rDNA, 10/490 bp (2.04%) in GAPDH, 5/170 bp (2.94%, with one gap (0%)) in TEF1, 11/748 bp (1.47%) in RPB2 and 2/428 bp (0.46%) in Alt a 1. The PHI analysis confirms that A. juncigena has no significant genetic recombination with closely related species (Φw = > 0.05, Figure 9). Alternaria juncigena differs from A. junci-inflexi and A. persica by having shorter conidiophores (40–85 μm vs. (55–)100–175(–212) μm, 45–110 μm, respectively), smooth surface, longer and wider conidia ((40–)55–90(–110) × 10–16 μm vs. smooth to verrucose surface, ((21–)45–65(–80) × (8–)9–12 μm in A. junci-inflexi and smooth to verrucose surface, (40–)55–85 × 8–11 μm in A. persica) and longer apical cell extension (up to 50 μm vs. up to 15 μm in A. junci-inflexi).

Figure 8. Alternaria juncigena (IRAN 4779C). (a,b) Symptoms on Juncus sp.; (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f–h) Sporulation pattern on PCA (f = 40×, g,h = 20×); (i–n) Conidiophores and conidia. Scale bars: (i–n) = 20 μm.

Figure 9. The split diagram showing the results of the pairwise homoplasy index (PHI) test of Alternaria juncigena with its most closely related species (Φw = 0.2303). PHI test results (Φw) < 0.05 indicate significant recombination within the dataset. The new taxa are shown in bold blue.

3.2.4. Alternaria junci-inflexi A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 10)

MycoBank No. MB 857573

Etymology. Named after the host, Juncus inflexus, from which the fungus was isolated.

Typification. Iran, West Azarbaijan province, Khoy County, Salkadeh Village, isolated from the culms of Juncus inflexus (Juncaceae, Poales) with light brown to dark brown irregular lesions, 25 Sept. 2020, A. Ahmadpour (holotype IRAN 18099F, ex-type culture IRAN 4227C = FCCUU 1413).

Description. Asexual morph on PCA: Hyphae branched, septate, light brown, smooth, 2–4 μm wide. Conidiophores macronematous, solitary, straight or slightly curved, simple, unbranched, septate, light brown to brown, mostly with a single apical conidiogenous locus, or 1–5 geniculate with 1–5 conidiogenous loci, (55–)100–175(–212) × 4–5 μm (

\bar{x}

= 135 × 4.5 μm, n = 50). Conidia mostly solitary, occasionally in chains of 2(–4) conidia, straight or slightly curved, mostly obclavate to narrowly ellipsoid or ovoid, conidial bodies (21–)45–65(–80) × (8–)9–12 μm (

\bar{x}

= 51 × 10.5 μm, n = 50), light brown to brown, smooth to verrucose, 2–9 (mostly 3–7) transverse distosepta, 1–3 transverse eusepta, with 1–3 longitudinal and 0–1 oblique distosepta, and slightly constricted at eusepta. True beaks are absent but with apical cell extension, light brown to brown, unbranched, 5–15 × 2–4 μm, occasionally without apical extension. The cell lumina are distinctly delimited and rectangular, rounded, hexagonal, or encompass the entire cell volume. Chlamydospores and sexual morph were not observed. Chlamydospores and sexual morph were not observed.

Culture characteristics. Colony on PCA flat, entire, velvety, fawn with off-white aerial mycelia, reaching 65 mm diam after 7 days at 25 °C. Colony on PDA flat, entire, felty, rosy buff with white aerial mycelia, 60 mm diam. Colony on V-8A flat, entire, felty, fawn with off-white aerial mycelia, 59 mm diam. Sporulation is abundant on PCA and V-8A media, from the erect conidiophores that arise directly from the surface or the aerial hyphae.

Additional specimens examined. Iran, West Azarbaijan province, Khoy County, Salkadeh Village, isolated from culms of Juncus inflexus, 25 Sept. 2020, A. Ahmadpour (culture FCCUU 1414).—Iran, East Azarbaijan province, Maraghe County, isolated from culms of Juncus inflexus, 20 Sept. 2019, A. Ahmadpour (culture FCCUU 1415).

Notes. Alternaria junci-inflexi is phylogenetically (Figure 2 and Figure 3) closely related to A. juncigena and A. persica, but can be distinguished by its shorter conidia ((21–)45–65(–80) μm vs. (40–)55–90(–110) μm in A. juncigena and (40–)55–85 μm in A. persica), fewer transverse distosepta (2–9 vs. (5–)8–12(–15) in A. juncigena and (4–)7–12(–15) in A. persica) and shorter apical cell extension (5–15 μm vs. up to 50 μm in A. juncigena and A. persica). The PHI analysis confirms that A. junci-inflexi has no significant genetic recombination with closely related species (Φw = > 0.05, Figure 9). A comparison of nucleotide differences in ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1 indicates that A. junci-inflexi type strain (IRAN 4227C) differs from A. juncigena type strain (IRAN 4779C) by 2/449 bp (0.44%) in ITS–rDNA, 6/490 bp (1.22%) in GAPDH, 2/169 bp (1.18%) in TEF1, 10/690 bp (1.44%) in RPB2 and 8/428 bp (1.86%) in Alt a 1, and from A. persica type strain (IRAN 4262C) by 3/450 bp (0.66%, with one gap (0%)) in ITS–rDNA, 9/490 bp (1.83%) in GAPDH, 7/170 bp (4.11%, with one gap (0%)) in TEF1, 12/690 bp (1.73%) in RPB2 and 1/428 bp (0.23%) in Alt a 1.

Figure 10. Alternaria junci-inflexi (IRAN 4227C). (a,b) Symptoms on culms of Juncus inflexus; (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f–j) Sporulation pattern on PCA (40×); (k–q) Conidiophores and conidia. Scale bars: (k–q) = 20 μm.

3.2.5. Alternaria persica A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 11)

MycoBank No. MB 857574

Etymology. The name refers to the old name of Iran, Persia, where the fungus was collected.

Typification. Iran, West Azarbaijan province, Khoy County, Salkadeh Village, isolated from the culms of Juncus sp. (Juncaceae, Poales), with irregular brown lesions and blight, 25 September 2020, A. Ahmadpour (holotype IRAN 18110F, ex-type culture IRAN 4262C = FCCUU 1417).

Description. Asexual morph on PCA medium: Hyphae branched, septate, smooth, light brown, 2–4 μm wide. Conidiophores macronematous, solitary, erect, simple, septate, brown, 1–4 geniculate, with 1–4 conidiogenous loci, 45–110 × 4–5 μm (

\bar{x}

= 88 × 4.5 μm, n = 50). Conidia solitary or in chains of 2–3 conidia, straight or slightly curved, obclavate, ellipsoid to ovoid, surface smooth to verrucose, conidial bodies (40–)55–85 × 8–11 μm (

\bar{x}

= 65 × 9.5 μm, n = 50), light brown to brown, (4–)7–12(–15) transverse distosepta, 1–3 eusepta, slightly constricted near eusepta, with 0–3 longitudinal and 0–2 oblique septa. True beaks are absent but with apical cell extension, light brown to brown, septate, unbranched, 10–50 × 2–3 μm, occasionally swollen at the apex. The cell lumina are distinctly delimited and rectangular, rounded, hexagonal, or encompass the entire cell volume. Chlamydospores and sexual morph were not observed.

Culture characteristics. Colony on PCA flat, entire, floccose, vinaceous buff with off-white aerial mycelium, 60 mm diam after 7 days at 25 °C. Colony on PDA flat, entire, floccose, rosy buff, 64 mm diam. Colony on V-8A flat, entire, floccose, vinaceous buff with white aerial mycelium, 61 mm diam. Sporulation moderate to scarce on PCA, and V-8A media, from the erect conidiophores that arise directly from the surface or the aerial hyphae.

Additional specimens examined. Iran, West Azarbaijan province, Khoy County, Salkadeh Village, isolated from culms of Juncus sp., 25 September 2020, A. Ahmadpour (cultures IRAN 4229C = FCCUU 1416, FCCUU 1417).

Notes. Phylogenetically, A. persica isolates formed a monophyletic lineage with high support values (ML/MP/BI = 100/100/1.0) and is closely related to A. junci-inflexi and A. juncigena (Figure 2 and Figure 3). However, it can be distinguished from A. junci-inflexi based on the larger conidia ((40–)55–85 × 8–11 μm vs. (21–)45–65(–80) × (8–)9–12 in A. juci-inflexi), more transverse distosepta ((4–)7–12(–15) vs. 2–9 in A. junci-inflexi) and longer apical cell extension (10–50 μm vs. 5–15 μm in A. junci-inflexi) and from A. juncigena by having longer conidiophores (45–110 μm vs. 40–85 μm in A. juncigena) and smooth to verrucose surface and narrower conidia (8–11 μm vs. smooth surface, 10–16 μm in A. juncigena). Comparisons involving the nucleotide differences and PHI analysis (Φw = > 0.05, Figure 9) in these species are listed in the A. juncigena and A. junci-inflexi notes section.

Figure 11. Alternaria persica (IRAN 4262C). (a,b) Symptoms on Juncus sp.; (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f–h) Sporulation pattern on PCA (40×); (i–p) Conidiophores and conidia. Scale bars: (i–p) = 20 μm.

3.2.6. Alternaria salkadehensis A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 12)

MycoBank No. MB 857575

Etymology. Named after the location, Salkadeh Village, Khoy County, from where the type was collected.

Typification. Iran, West Azarbaijan province, Khoy, Salkadeh Village, from the leaves and culms of Cyperus sp. (Cyperaceae, Poales) with light brown to brown irregular lesions and blight, 10 Jul. 2019, A. Ahmadpour (holotype IRAN 18098F, ex-type culture IRAN 4225C = FCCUU 1400).

Description. Asexual morph on PCA medium: Hyphae branched, septate, smooth, light brown, 2–4 μm wide. Conidiophores macronematous, solitary, erect, simple, septate, brown, 1–5 geniculate, with 1–5 conidiogenous loci, (85–)150–300 × 5–6 μm (

\bar{x}

= 200 × 5.5 μm, n = 50). Conidia mostly chains of 2–4 conidia, occasionally solitary, straight or slightly curved, obclavate, ellipsoid to ovoid, conidial bodies (35–)55–90(–100) × 10–13 μm (

\bar{x}

= 70 × 11 μm, n = 50), light brown to brown, surface smooth, (4–)5–9(–13) transverse distosepta, 1–3 eusepta, slightly constricted near eusepta, without longitudinal or oblique septa. True beaks are absent, but with apical cell extension (secondary conidiophores), up to 45 µm long and 2–4 µm wide, with 3–4(–6) geniculate and 3–4(–6) conidiogenous loci, each bearing one conidium. The cell lumina are distinctly delimited and rectangular, rounded, hexagonal, or encompass the entire cell volume. Chlamydospores and sexual morph were not observed.

Culture characteristics. Colony on PCA flat, entire, velvety, hazel, with sparse aerial mycelium, 63 mm diam after 7 days at 25 °C. Colony on PDA flat, entire, floccose, rose buff with white aerial mycelium, 55 mm diam. Colony on V-8A flat, entire, velvety, dark brick at the center and ochreous at the margin, with sparse off-white aerial mycelium, 63 mm diam. Sporulation is abundant on PCA and V-8A media, from the erect conidiophores that arise directly from the surface or aerial hyphae.

Additional specimens examined. Iran, West Azarbaijan province, Khoy County, Salkadeh Village, from the leaves and culms of Cyperus sp. (Cyperaceae, Poales), 10 July 2019, A. Ahmadpour (culture FCCUU 1399).—ibid. on leaves and culms of Carex sp. (Cyperaceae, Poales), 10 July 2019, A. Ahmadpour (culture IRAN 4226C = FCCUU 1398).

Notes. Alternaria salkadehensis is phylogenetically closely related to A. cyperi and A. schoenoplecti (ML/MP/BI= 100/100/1.0) (Figure 2 and Figure 3), but it can be differentiated from A. cyperi by its longer conidiophores (85–)150–300 μm vs. 40–110 μm) and longer apical cell extension (up to 45 μm vs. up to 15 μm). Alternaria schoenoplecti morphologically differs from A. salkadehensis by having solitary and straight or curved conidia (C shape) vs. catenate, straight or slightly curved conidia. The PHI analysis confirms that A. salkadehensis has no significant genetic recombination with closely related species (Φw = > 0.05, Figure 6). A comparison of nucleotide differences in ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1 indicates that A. salkadehensis type strain (IRAN 4225C) differs from A. cyperi type strain (IRAN 4223C) by 2/458 bp (0.43%, with one gap (0%)) in ITS–rDNA, 12/495 bp (2.42%) in GAPDH, 5/165 bp (3.03%) in TEF1, 22/746 bp (2.94%) in RPB2 and 43/425 bp (10.11%) in Alt a 1 and from A. schoenoplecti type strain (IRAN 4263C) by 4/458 bp (0.87%, with one gap (0%)) in ITS–rDNA, 12/495 bp (2.42%) in GAPDH, 4/167 bp (2.39%) in TEF1, 23/748 bp (3.07%) in RPB2 and 39/428 bp (9.11%) in Alt a 1.

Figure 12. Alternaria salkadehensis (IRAN 4225C). (a,b) Symptoms on the leaves and culms of Cyperus sp.; (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f,g) Sporulation pattern on PCA (20×); (h–n) Conidiophores and conidia. Scale bars: (h–n) = 20 μm.

3.2.7. Alternaria schoenoplecti A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 13)

MycoBank No. MB 857576

Etymology. Named after the host, Schoenoplectus sp. from which the fungus was isolated.

Typification. Iran, West Azarbaijan province, Miyandoab County, from the culms of Schoenoplectus sp. (Cyperaceae, Poales), with brown to dark brown, ovoid to fusiform lesions, 10 June 2019, A. Ahmadpour (holotype IRAN 18111F, ex-type culture IRAN 4263C = FCCUU 1393).

Description. Asexual morph on PCA medium: Hyphae branched, septate, smooth, light brown, 2–4 μm wide. Conidiophores macronematous, solitary, erect, simple, straight to slightly curved, septate, light brown to brown, with a single apical conidiogenous locus, 40–90 × 5–7 μm (

\bar{x}

= 66 × 6 μm, n = 50). Conidia mostly solitary, rarely in chains of two conidia, straight or curved, obclavate to narrowly ellipsoid, conidial bodies (40–)50–70(–88) × 12–15(–18) μm (

\bar{x}

= 63 × 14 μm, n = 50), light brown to brown, smooth, (3–)4–8(–11) transverse distosepta, 1–3 eusepta, rarely with 1–2 longitudinal or oblique distosepta. Mature conidia are strongly constricted at most of their transverse septa, and in some conidia, the median cells are markedly swollen. True beaks are absent, but with an apical cell extension up to 22 μm long and 3–5 μm wide, occasionally swollen at the apex. The cell lumina are distinctly delimited and rectangular, rounded, hexagonal, or encompass the entire cell volume. Chlamydospores and sexual morph were not observed.

Culture characteristics. Colony on PCA flat, entire, velvety, sepia to cinnamon, with sparse aerial hyphae, 49 mm diam. after 7 days at 25 °C. Colony on PDA flat, entire, floccose, dark brick to cinnamon, 55 mm diam. Colony on V-8A flat, entire, velvety, sepia with white aerial mycelia, 30 mm diam. Sporulation is scarce on PCA, V-8A, or SNA media, from the erect conidiophores that arise directly from the surface or aerial hyphae.

Additional specimens examined. Iran, West Azarbaijan province, Miyandoab County, from culms of Schoenoplectus sp., 10 June 2019, A. Ahmadpour (cultures FCCUU 1394, FCCUU 1395).

Notes. Alternaria schoenoplecti is phylogenetically closely related to A. cyperi and A. salkadehensis (Figure 2 and Figure 3). Comparisons of nucleotide differences and PHI analysis (Φw = > 0.05, Figure 6) in these species are listed in the A. cyperi and A. salkadehensis notes section. Moreover, A. schoenoplecti differs from A. cyperi and A. salkadehensis morphologically in having solitary and straight or curved conidia (C shape) vs. catenate, straight or slightly curved conidia.

Figure 13. Alternaria schoenoplecti (IRAN 4263C). (a,b) Symptoms on culms of Schoenoplectus sp.; (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f–h) Sporulation pattern on PCA (f = 10×, g = 20×, h = 40×); (i–n) Conidiophores and conidia. Scale bars: (i–n) = 20 μm.

3.2.8. Alternaria urmiana A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 14)

MycoBank No. MB 857577

Etymology. The name refers to the Urmia County, where the holotype was collected.

Typification. Iran, West Azarbaijan province, Urmia County, isolated from the culms of Juncus acutus (Juncaceae, Poales) with brown lesions and blight symptoms, 20 September 2019, Y. Ghosta (holotype IRAN 18097F, ex-type culture IRAN 4224C = FCCUU 1405).

Description. Asexual morph on PCA: Hyphae branched, septate, light brown, smooth, 2–4 μm wide. Conidiophores macronematous, solitary, straight or slightly curved, simple, unbranched, septate, light brown to brown, mostly with a single apical conidiogenous locus, or 1–4 geniculate with 1–4 conidiogenous loci, (75–)100–150(–225) × 4–5 μm (

\bar{x}

= 136 × 4.5 μm, n = 50). Conidia mostly solitary, rarely in chains of two conidia, straight or slightly curved, mostly obclavate, ellipsoid to ovoid, conidial bodies (35–)40–51(–55) × 12–15 μm (

\bar{x}

= 46 × 13 μm, n = 50), light brown to brown, smooth to verrucose, 3–8 (mostly 3–6) transverse distosepta, 1–2 transverse eusepta, with 1–3 longitudinal and 0–2 oblique distosepta. Conidium body slightly constricted at eusepta, mostly without apical cell extension, occasionally with apical cell extension, light brown to brown, 4–10 × 2–4 μm. The cell lumina are distinctly delimited and rectangular, rounded, hexagonal, or encompass the entire cell volume. Chlamydospores and sexual morph were not observed.

Culture characteristics. Colony on PCA flat, entire, velvety, rosy buff with sparse, off-white aerial mycelium, reaching 51 mm diam. after 7 days at 25 °C. Colony on PDA flat, entire, floccose, dark birk to sepia at the center and white at the margin, with sparse aerial mycelium, 50 mm diam. Colony on V-8A flat, entire, floccose, white at center, fawn at margins, 25 mm diam. Sporulation abundant on PCA, and V-8A media, from the erect conidiophores that arise directly from the surface or the aerial hyphae.

Additional specimens examined. Iran, West Azarbaijan province, Urmia County, isolated from culms of Juncus acutus, 20 September 2019, Y. Ghosta (cultures FCCUU 1406, FCCUU 1407).—Iran, West Azarbaijan, Khoy County, Salkadeh Village, isolated from culms of Juncus inflexus, 25 September 2020, A. Ahmadpour (cultures IRAN 4228C, FCCUU 1404).

Notes. Phylogenetically, Alternaria urmiana clusters in a distinct subclade compared to all other species in Alternaria section Nimbya, with 100% ML/MP bootstrap, and 1.0 BI posterior probability values, with a sister relationship to a clade consisting A. junci-acuti (Figure 2 and Figure 3). A comparison of nucleotide differences in ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1 indicates that A. urmiana type strain (IRAN 4224C) differs from A. junci-acuti type strain (IRAN 3512C) by 25/433 bp (5.77%, with three gaps (0%)) in ITS–rDNA, 30/490 bp (6.12%, with five gaps (1%)) in GAPDH, 17/157 bp (10.82%, with two gaps (1%)) in TEF1, 78/746 bp (10.45%) in RPB2 and 61/428 bp (14.25%, with two gaps (0%)) in Alt a 1. Morphologically, A. urmiana is similar to A. junci-inflexi but can be distinguished by its smaller and wider conidia ((35–)40–51(–55) × 12–15 μm vs. (21–)45–65(–80) × (8–)9–12 μm) with shorter apical cell extension (up to 10 μm vs. up to 15 μm).

Figure 14. Alternaria urmiana (IRAN 4224C). (a,b) Symptoms on culms of Juncus acutus; (c–e) Colony on PDA (c), PCA (d), and V-8A (e) after 7 days; (f–j) Sporulation pattern on PCA (f = 10×, g–j = 40×); (k–q) Conidiophores and conidia. Scale bars: (k–q) = 20 μm.

3.2.9. Alternaria caricicola Ahmadpour, Phytotaxa 405(2): 69. 2019 [19]

Description and Illustration. See Ahmadpour [19] and Ahmadpour et al. [20].

Habitat and Distribution. On culms of Carex sp. [19,20] and Cyperus sp. (Cyperaceae, Poales) (this study), Iran.

Materials examined. Iran, West Azarbaijan province, Mahabad County, on infected leaves and culms of Cyperus sp. (Cyperaceae, Poales), 10 July 2020, A. Ahmadpour (cultures FCCUU 1384, FCCUU 1385).—Iran, East Azarbaijan province, Bonab County, isolated from the leaves and culms of Cyperus sp., 30 October 2019, A. Ahmadpour (culture FCCUU 1386).

Notes. Alternaria caricicola was originally reported from the culms of Carex sp. with gray to brown lesions in West Azarbaijan province, Iran [19]. In this study, three isolates from Cyperus sp. (FCCUU 1384, FCCUU 1385, and FCCUU 1386) were identified as A. caricicola in a well-supported clade with ML/MP/BI = 100/100/1.0 (Figure 2 and Figure 3), so Cyperus spp. is reported as matrix nova for this species. Our isolates (FCCUU 1384, FCCUU 1385, and FCCUU 1386) had 100% sequence homology with A. caricicola type strain (IRAN 3418C), according to the gene regions (ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1 genes). Alternaria caricicola is morphologically similar to A. cypericola, A. heteroschemos, A. juncicola, and A. scirpicola [1,9,19,20], but it can be differentiated from A. scirpicola and A. heteroschemos by the longer and narrower conidia (87.5–205 × 10–15 µm vs. 75–100 × 18–22 μm in A. heteroschemos and 100–120 × 15–20 μm in A. scirpicola) and more distosepta (8–15 vs. 6–9 in A. heteroschemos and 9–11 in A. scirpicola). Alternaria juncicola has shorter conidiophores (60–130 μm), more distosepta (up to 17 vs. up to 14), and eusepta (3–8 vs. 1–4) in A. caricicola [1,9,19,20]. Alternaria caricicola can be differentiated from A. cypericola based on longer conidia (87.5–205 µm vs. 87.5–155 µm in A. cypericola) and more transverse distosepta (7–14 vs. 6–12 in A. cypericola) [19,20].

3.2.10. Alternaria cypericola Ahmadpour, Poursafar and Ghosta, Mycologia 113: 1078. 2021 [20]

Description and Illustration. Ahmadpour et al. [20].

Habitat and Distribution. On infected leaves and culms of Cyperus sp. (Cyperaceae) [20], Cyperus sp. and Eleocharis sp. (Cyperaceae, Poales) (this study), Iran.

Materials examined. Iran, West Azarbaijan province, Khoy County, Salkadeh Village, from the leaves and culms of Cyperus sp. (Cyperaceae, Poales), 10 Aug. 2020, A. Ahmadpour (culture FCCUU 1387).—ibid. on the culms of Eleocharis sp. (Cyperaceae, Poales), 10 Aug. 2020, A. Ahmadpour (culture FCCUU 1388).

Notes. Alternaria cypericola was first reported from infected leaves and culms of Cyperus sp. (Cyperaceae) with light brown to brown lesions in Iran [20]. In this study, two isolates (FCCUU 1387 and FCCUU 1388) obtained from the leaves and culms of Cyperus sp. and Eleocharis sp. were identified as A. cypericola; thus, Eleocharis sp. is reported here as matrix nova for this species. Our isolates (FCCUU 1387 and FCCUU 1388) exhibited 100% sequence homology with the A. cypericola type strain (IRAN 3423C) in the ITS–rDNA, RPB2, and Alt a 1 genes. This species is phylogenetically closely related to, but distinct from A. scirpicola, A. scirpinfestans, and A. scirpivora (Figure 2 and Figure 3). Alternaria cypericola differs from A. scirpicola on the basis of longer and narrower conidia (87.5–155 × 10–15 μm vs. 100–120 × 15–20 μm in A. scirpicola) [1,9]. Also, it differs from A. scirpinfestans and A. scirpivora based on longer and wider conidia (90–130 × 6–8 μm in A. scirpinfestans and 90–120 × 7–12 μm in A. scirpivora) and more transverse distosepta (6–12 vs. 3–8 in A. scirpinfestans and 4–9 in A. scirpivora) [8,9].

3.2.11. Alternaria heyranica Ahmadpour, Poursafar and Ghosta, Mycologia 113: 1078. 2021 [20]

Description and Illustration. Ahmadpour et al. [20].

Material examined. Iran, Guilan province, Astara, Heyran Village, on infected leaves of Carex sp. (Cyperaceae, Poales), 10 October 2020, A. Ahmadpour (FCCUU 1421).

Habitat and Distribution. On infected leaves of Carex sp. from Iran ([9], this study).

Notes. Alternaria heyranica was first described on infected leaves of Carex sp. in Guilan province, Iran. In the phylogenetic tree, one studied isolate (FCCUU 1421) clustered with the ex-type of A. heyranica (IRAN 3516C) with 1.0 BI posterior probabilities and 100% ML/MP bootstrap values (Figure 1 and Figure 2). The isolate FCCUU 1421 had 100% sequence homology with A. heyranica type strain (IRAN 3516C), according to the gene regions (ITS–rDNA, GAPDH, TEF1, RPB2, and Alt a 1 genes). Alternaria heyranica is most closely related to A. caricis strain CBS 480.90, but is distinguished by having longer filiform true beaks (50–175 μm length), smaller conidia (50–75 × 10–12 μm vs. 65–95 × 10–16 μm in A. caricis) and formation of hyphal swelling [1,20].

3.2.12. Alternaria junci-acuti Ahmadpour, Poursafar and Ghosta, Mycologia 113: 1080. 2021 [20]

Description and Illustration. See Ahmadpour et al. [20].

Materials examined. Iran, West Azarbaijan province, Khoy County, on infected leaves and culms of Carex sp. (Cyperaceae, Poales), 20 October 2019, A. Ahmadpour (cultures FCCUU 1390, FCCUU 1392).—Iran, West Azarbaijan province, Miyandoab County, from the leaves and culms of Carex sp., 30 October 2019, A. Ahmadpour (culture FCCUU 1391).—Iran, Golestan province, Gorgarn County, from the leaves and culms of Carex sp., 10 July 2020, A. Ahmadpour (culture FCCUU 1389).

Habitat and Distribution. On infected leaves and culms of Juncus acutus [20] and Carex sp. (this study) from Iran.

Notes. Alternaria junci-acuti was first identified on symptomatic culms of Juncus acutus in West Azarbaijan province, Urmia County, Iran [20]. In this study, four isolates of this species were recovered from the leaves and culms of Carex sp., leading to the identification of Carex sp. as a new host (matrix nova) for A. Junci-acuti. Additionally, this study confirmed the presence of this species in various geographic regions across Iran, thereby expanding its known distribution range. Our isolates (FCCUU 1389, FCCUU 1390, FCCUU 1391, and FCCUU 1392) exhibited 99–100% sequence homology with the A. junci-acuti type strain (IRAN 3512C) based on the gene regions (ITS–rDNA, GAPDH, RPB2, and Alt a 1 genes). Alternaria junci-acuti is phylogenetically related to A. urmiana and forms a well-supported clade (ML/MP/BI= 100/100/1.0) (Figure 2 and Figure 3). It is morphologically similar to A. heyranica due to the formation of a long filiform true beak, but it can be distinguished based on the longer and narrower conidia in A. junci-acuti (50–87.5 × 7–9 μm) vs. A. heyranica (50–75 × 10–12 μm), and more transverse distosepta in conidia of A. junci-acuti (up to 14 vs. up to 9 in A. heyranica) [20]. Also, A. junci-acuti is readily distinguished from A. caricis concerning having a long filiform true beak, narrower conidia (10–16 μm in A. caricis), and more distosepta (up to 10 in A. caricis) [1,9].

3.2.13. Alternaria scirpivora (E.G. Simmons and D.A. Johnson) Woudenb. and Crous, Stud. Mycol. 75: 198. 2013 [17]

Basionym. Nimbya scirpivora E.G. Simmons and D.A. Johnson, Mycotaxon 84: 424. 2002 [8].

Synonym. Macrospora scirpivora E.G. Simmons and D.A. Johnson, Mycotaxon 84: 422. 2002 [8].

Description and Illustration. See Johnson et al. [8], Ahmadpour et al. [20], and Alavi et al. [55].

Habitat and Distribution. On infected culms of Scirpus acutus and S. validus (Cyperaceae) in the USA and on S. acutus in Iran [8,9,20,55,56].

Materials examined. Iran, Ardebil province, Hir County, Abbas Abad Village, on infected culms of Scirpus acutus (Cyperaceae), 10 July 2020, A. Ahmadpour (culture FCCUU 1419).—Iran, Mazandaran province, Larim County, on infected culms of S. acutus, 10 October 2021, A. Ahmadpour (culture FCCUU 1420).

Notes. This species was originally described from culm lesions of S. acutus in the Pacific Northwest and Minnesota, USA [8]. In Iran, it has been reported from several locations in West Azarbaijan province [20,55], and this study further extends its known range to include Ardebil and Mazandaran provinces, broadening its geographic distribution. Our isolates (FCCUU 1419 and FCCUU 1420) had 99–100% sequence homology with A. scirpivora type strain (EGS 50-021), according to the gene regions (ITS–rDNA, GAPDH, and Alt a 1 genes). Alternaria scirpivora is phylogenetically related to A. scirpicola and A. scirpinfestans (Figure 2 and Figure 3), but is distinguished concerning the sporulation pattern, size of conidia, and the number of transverse pseudosepta [8,20]. According to the phylogenetic tree, the two studied isolates were clustered well with A. scirpivora in a distinct subclade with 1.0 BI posterior probabilities and 100% ML/MP bootstrap values (Figure 2 and Figure 3). Alternaria scirpivora and A. scirpinfestans are pathogens of Scirpus spp. (S. acutus and S. validus) [8,20,55].

A key to recognized species in the Alternaria section Nimbya from Iran

1 Conidia with true beaks ………………………………………………………………………………………………………… 2
1′ Conidia without true beaks, but with apical cell extension ………………………………………………………………… 5
2 Beak long, more than 100 µm, chlamydospores present ……………………….……….…………………………………… 3
2′ Beak short, less than 100 µm, chlamydospores absent …………….………………………………………………………… 4
3 Chlamydospores bulbous, hyaline to light brown …………………….….….………………………….………… A. heyranica
3′ Chlamydospores not bulbous, brown to dark brown ……………………….………………………………….. A. junci-acuti
4 Conidia 87.5–205 × 10–15 μm, 7–14 distosepta ……………………….……………………………………………. A. caricicola
4′ Conidia 87.5–155 × 10–15 μm, 6–12 distosepta ……………….………………………….……….………………. A. cypericola
5 Conidia strongly curved, C shaped, on Schoenoplectus ………….……….……………….…………………… A. schoenoplecti
5′ Conidia straight or slightly curved, not C shape………………………………….………………………………………….. 6
6 Secondary conidiophores long with 2–5 geniculations ………………………………….…………………………………… 7
6′ Secondary conidiophores short, without geniculations ………………….…………………………………………………. 8
7 Primary conidiophores long, up to 300 µm, longer apical cell extension (up to 45 μm) ……………………………………………………………………….………………………………………… A. salkadehensis
7′ Primary conidiophores short, up to 110 µm, shorter apical cell extension (up to 15 μm) ……………………………………………………………….………………………………………………………… A. cyperi
8 Conidia mostly solitary, rarely in chains of 2 conidia ………………………………………………………………………… 9
8′ Conidia solitary or mostly in chains of 2–4(–8) conidia ………………….…….…………………………………………… 10
9 Conidium body short and wide (35–55 × 12–15 µm), conidial surface smooth or verrucose, without ascomata ………………………………………………………………………………………….……………………… A. urmiana
9′ Conidium body long and narrow (35–100 × 5–9 µm), conidial surface smooth, without longisepta and with ascomata ……………………………………………………………………………………….…………….………… A. caricifolia
9″ Conidium body moderate size (21–80 × 8–12 µm), conidial surface smooth or verrucose, with 1–3 longisepta, without ascomata ……………………………………………….…….……………………………………………………… A. junci-inflexi
10 Conidia mostly in chains of 2–8, conidium body small (20–60 × 5–8 µm) ……………………………………. A. scirpivora
10′ Conidia mostly in chains of 2–3, conidium body medium (55–85 × 8–11 µm), conidial surface smooth or verrucose ………………………………………………………………….……………….……….…………….……… A. persica
10″ Conidia mostly in chains of 2–4, conidium body large (40–110 × 10–16 µm), conidial surface smooth ……………………………………………………………………….………………………………………… A. junicigena

4. Discussion

This study recovered 189 fungal isolates with conidial characteristics typical of Alternaria section Nimbya from plant species in the families Cyperaceae and Juncaceae. The plant samples exhibiting blight, leaf, and culm lesions were collected from wetlands across six provinces in Iran (Table 4). The ISSR marker banding pattern effectively grouped the isolates into distinct categories, and a comparison of their morphological characteristics also aligned with the ISSR results. This finding supports our previous study, which demonstrated that ISSR markers can be used to group the isolates, with different banding patterns indicating distinct species [20]. Since evaluating morphological characteristics for a large number of isolates can be time-consuming and requires standardized and controlled cultural conditions (e.g., temperature, light, and growth medium), the ISSR marker offers a more efficient method, reducing the time required for analysis while providing clear species differentiation.

Species in the Alternaria section Nimbya belong to one of the seven Alternaria sections with reported sexual forms [8,17,57,58]. Lucas and Webster [59] successfully obtained the ascomata of A. scirpicola (≡Macrospora scirpicola) in mono-ascospore and mono-conidia cultures on sterilized Cyperus stems. Johnson et al. [8] also induced ascomata formation in A. scirpinfestans and A. scirpivora by inoculating autoclave-sterilized culm sections of host plants on 2% water agar/PCA, with ascomata maturing within three to four weeks. Notably, A. scirpivora exhibited faster maturation than A. scirpinfestans, confirming its homothallic nature. Despite attempts to induce ascomata formation in the isolates studied in this work, it was only observed in A. caricifolia, suggesting its homothallic nature. Although Alternaria has traditionally been considered an asexual genus, several species possess functional mating type genes (MAT loci) that resemble those of heterothallic fungi [60,61,62,63,64,65]. Fungi use various reproductive strategies (e.g., sexual, asexual, and parasexual) each with distinct benefits. Sexual reproduction enhances genetic diversity, promotes adaptation, eliminates harmful mutations, selects beneficial ones, and produces durable, resistant spores capable of long-term survival in unfavorable conditions. In most ascomycetes, sexual spores are dispersed by wind, facilitating gene flow over long distances [64,66]. Given the critical role of reproductive mode in shaping population genetics, evolution, and fungal pathogen management, future research should explore the distribution and function of mating-type genes in Alternaria section Nimbya isolates.

With molecular biology and technology advancements, new methods have become widely adopted in fungal taxonomy and systematics. Based on molecular biology, the phylogenetic species identification approach addresses some limitations of morphological species identification, offering a more scientific means of understanding fungal phylogenetic relationships. It also provides a reliable foundation and technical methodologies for rapid molecular detection and strain identification [65,67,68]. Recent studies indicate that the Alternaria section Nimbya comprises numerous species, including cryptic ones that can be distinguished through phylogenetic analysis [20]. In this study, a combination of morphological characteristics, phylogenetic analyses, and Pairwise Homoplasy Index (PHI) tests was used to identify new species within the Nimbya section. Phylogenetic analysis based on a five-gene dataset strongly confirmed the distinctiveness of the identified species, supported by robust monophyletic statistical values. In addition, the PHI test supported the results of morphological characteristics and phylogenetic analyses. The findings of this study highlight the high diversity of Alternaria species within the Nimbya section, associated with the plants in the families of Cyperaceae and Juncaceae (Table 4). Further studies in other regions could determine the exact diversity of Alternaria species in the section Nimbya from these plants, the geographical distribution status of the species, and a better understanding of the host relationships.

Cyperaceae and Juncaceae are two well-established families within the order Poales, playing major roles in ecological, economic, and ethnobotanical contexts. These families are particularly dominant in wetland ecosystems [25,69], where they provide essential food and habitat for numerous animal and fungal species with specialized interrelationships. The decline of each plant species within these families could disrupt the associated biota and other dependent organisms [70]. Among the key threats to their growth, reproduction, and survival are fungal pathogens. Understanding the diversity of fungi linked to these plants and their host specificity is essential for effective conservation efforts. Conversely, members of the Cyperaceae family have also been recognized as invasive weeds, posing significant challenges to natural ecosystems, agriculture, and forestry [26,71,72]. Weeds compete for vital resources such as water, nutrients, and sunlight, ultimately reducing both the quantity and quality of agricultural products. While chemical herbicides are widely used for weed control, their extensive application has led to issues like environmental pollution, negative impacts on human and animal health, harm to cultivated plants, and the development of herbicide-resistant weed populations. As a result, sustainable and effective weed management alternatives have become a major research focus in recent years. One promising approach is the use of plant-pathogenic fungi as biocontrol agents. Among these, more than ten species of Alternaria have been identified as potential candidates for biological weed control [73,74,75,76]. Given the specific host association between species in the Alternaria section Nimbya and Cyperaceae plants, further studies are needed to identify the most suitable and effective fungal species for biocontrol applications.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof11030225/s1, Figure S1: Banding patterns of different isolates of Alternaria section Nimbya species using ISSR-PCR with ISSR5 ((GA)₅YC) primer. M: 1kb marker.

Author Contributions

A.A., Y.G. and A.P. designed and performed sampling, fungal isolation, experiments, writing and editing. A.A., Z.A. and F.A. took photography. A.A., F.A. and P.H.R. carried out phylogenetic analyses. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by Iran National Science Foundation (INSF) (Grant No. 99033118), the Iranian Mycological Society (IMS), and the Research Deputy of Urmia University.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article and Supplementary Materials. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

Simmons, E.G. Macrospora Fuckel (Pleosporales) and related anamorphs. Sydowia 1989, 41, 314–329. [Google Scholar]
Simmons, E.G. Alternaria an Identification Manual; CBS Fungal Biodiversity Centre: Utrecht, The Netherlands, 2007. [Google Scholar]
Simmons, E.G. Alternaria themes and variations (112–144). Mycotaxon 1995, 55, 55–163. [Google Scholar]
Simmons, E.G. Alternaria themes and variations (151–223). Mycotaxon 1997, 65, 1–91. [Google Scholar]
Simmons, E.G. Alternaria themes and variations (244–286) species on Solanaceae. Mycotaxon 2000, 75, 1–115. [Google Scholar]
Simmons, E.G. Novel dematiaceous hyphomycetes. Stud. Mycol. 2004, 50, 109–118. [Google Scholar]
Chen, W.Q.; Lin, X.F.; Zhang, T.Y. A new species of Nimbya. Mycosystema 1997, 16, 106–108. [Google Scholar]
Johnson, D.A.; Simmons, E.G.; Miller, J.S.; Stewart, E.L. Taxonomy and pathology of Macrospora/Nimbya on some North American bulrushes (Scirpus spp.). Mycotaxon 2002, 84, 413–428. [Google Scholar]
Zhao, G.Z.; Zhang, T.Y. Notes on dictyosporous hyphomycetes from China VII. The genus Nimbya. Fungal Divers. 2005, 19, 201–215. [Google Scholar]
Pryor, B.M.; Bigelow, D.M. Molecular characterization of Embellisia and Nimbya species and their relationship to Alternaria, Ulocladium and Stemphylium. Mycologia 2003, 95, 1141–1154. [Google Scholar] [CrossRef]
Wang, Y.; Geng, Y.; Ma, J.; Wang, Q.; Zhang, X.G. Sinomyces: A new genus of anamorphic Pleosporaceae. Fungal Biol. 2011, 115, 188–195. [Google Scholar] [CrossRef]
Lawrence, D.P.; Park, M.S.; Pryor, B.M. Nimbya and Embellisia revisited, with nov. comb For Alternaria celosiae and A. perpunctulata. Mycol. Prog. 2012, 11, 799–815. [Google Scholar] [CrossRef]
Simmons, E.G. Alternaria taxonomy: Current status, viewpoint, challenge. In Alternaria Biology, Plant Diseases and Metabolites; Chelkowski, J., Visconti, A., Eds.; Elsevier Science Publishers: Amsterdam, The Netherlands, 1992; pp. 1–35. [Google Scholar]
Lawrence, D.P.; Gannibal, P.B.; Peever, T.L.; Pryor, B.M. The sections of Alternaria: Formalizing species-groups concepts. Mycologia 2013, 105, 530–546. [Google Scholar] [CrossRef] [PubMed]
Neergaard, P. Danish Species of Alternaria and Stemphylium; Oxford University Press: London, UK, 1945. [Google Scholar]
Joly, P. Le Genre Alternaria. Encyclopédie Mycologique XXXIII; P. Lechevalier: Paris, France, 1964. [Google Scholar]
Woudenberg, J.H.C.; Groenewald, J.Z.; Binder, M.; Crous, P.W. Alternaria redefined. Stud. Mycol. 2013, 75, 171–212. [Google Scholar] [CrossRef] [PubMed]
Gannibal, P.B. Distribution of Alternaria species among sections. 4. Species formerly assigned to genus Nimbya. Mycotaxon 2018, 133, 37–43. [Google Scholar] [CrossRef]
Ahmadpour, A. Alternaria caricicola, a new species of Alternaria in the section Nimbya from Iran. Phytotaxa 2019, 405, 65–73. [Google Scholar] [CrossRef]
Ahmadpour, A.; Ghosta, Y.; Poursafar, A. Novel species of Alternaria section Nimbya from Iran as revealed by morphological and molecular data. Mycologia 2021, 113, 1073–1088. [Google Scholar] [CrossRef]
Bouchenak-Khelladi, Y.; Muaysa, A.M.; Linder, H.P. A revised evolutionary history of Poales: Origins and diversification. Bot. J. Linn. Soc. 2014, 175, 4–16. [Google Scholar] [CrossRef]
Elliott, T.L.; Spalink, D.; Larridon, I.; Zuntini, A.R.; Escudero, M.; Hackel, J.; Barrett, R.L.; Martín-Bravo, S.; Márquez-Corro, J.I.; Mendoza, C.G.; et al. Global analysis of Poales diversification—Parallel evolution in space and time into open and closed habitats. New Phytol. 2023, 242, 727–743. [Google Scholar] [CrossRef]
Larridon, I. A linear classification of Cyperaceae. Kew Bull. 2022, 77, 309–315. [Google Scholar] [CrossRef]
Mishra, S.; Tripathi, A.; Tripathi, D.K.; Chauhan, D.K. Role of sedges (Cyperaceae) in wetlands, environmental cleaning and as food material: Possibilities and future perspectives. In Plant-Environment Interaction: Responses and Approaches to Mitigate Stress; Azooz, M.M., Ahmad, P., Eds.; John Wiley & Sons, Ltd.: Bognor Regis, UK, 2016; pp. 327–338. [Google Scholar]
Rameshkumar, K.B.; Sruthy, B.; Viji, A.R.; Dhruvan, T. Diversity of Cyperaceae Plants in South India: Phytochemical Perspective; KSCSTE-Jawaharlal Nehru Tropical Botanic Garden and Research Institute: Palode, India, 2022. [Google Scholar]
Bryson, C.T.; Carter, R. The significance of Cyperaceae as weeds. In Sedges: Uses, Diversity, and Systematics of the Cyperaceae; Naczi, R.C.F., Ford, B.A., Eds.; Missouri Botanical Garden Press: St. Louis, MO, USA, 2008; pp. 15–101. [Google Scholar]
Rodrigues, M.J.; Gangadhar, K.N.; Zengin, G.; Mollica, A.; Varela, J.; Barreira, L.; Custódio, L. Juncaceae species as sources of innovative bioactive compounds for the food industry: In vitro antioxidant activity, neuroprotective properties and in silico studies. Food Chem. Toxicol. 2017, 107, 590–596. [Google Scholar] [CrossRef]
Park, S.H.; Kang, J.W.; Park, G.H.; Jo, S.J.; Min, K.W.; Lee, K.S.; Park, H.B. Isolation and identification of antifungal metabolites from Juncus torreyi. Nat. Prod. Sci. 2024, 30, 161–166. [Google Scholar] [CrossRef]
Nirenberg, H.I. Untersuchungen über die morphologische und biologische Differenzierung in der Fusarium-Section Liseola. Mitt. Biol. Bundesanst. Land-Und Forstwirtsch. Berl.-Dahl. 1976, 169, 1–117. [Google Scholar]
Rayner, R.W. A Mycological Colour Chart; Commonwealth Mycological Institute: Kew, UK, 1970. [Google Scholar]
Crous, P.W.; Gams, W.; Stalpers, J.A.; Robert, V.; Stegehuis, G. MycoBank: An online initiative to launch mycology into the 21st century. Stud. Mycol. 2004, 50, 19–22. [Google Scholar]
White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Shinsky, J.J., White, T.J., Eds.; Elsevier: Berlin/Heidelberg, Germany, 1990; pp. 315–322. [Google Scholar]
Berbee, M.L.; Pirseyedi, M.; Hubbard, S. Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 1999, 91, 964–977. [Google Scholar] [CrossRef]
Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
Sung, G.H.; Sung, J.M.; Hywel-Jones, N.L.; Spatafora, J.W. A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 2007, 44, 1204–1223. [Google Scholar] [CrossRef]
Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef]
Hong, S.G.; Cramer, R.A.; Lawrence, C.B.; Pryor, B.M. Alt a 1 allergen homologs from Alternaria and related taxa: Analysis of phylogenetic content and secondary structure. Fungal Genet. Biol. 2005, 42, 119–129. [Google Scholar] [CrossRef]
Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
Woudenberg, J.H.C.; Truter, M.; Groenewald, J.Z.; Crous, P.W. Large–spored Alternaria pathogens in section Porri disentangled. Stud. Mycol. 2014, 79, 1–47. [Google Scholar] [CrossRef]
Woudenberg, J.H.C.; Seidl, M.F.; Groenewald, J.Z.; de Vries, M.; Stielow, J.B.; Thomma, B.P.H.J.; Crous, P.W. Alternaria section Alternaria: Species, formae speciales or pathotypes? Stud. Mycol. 2015, 82, 1–21. [Google Scholar] [CrossRef] [PubMed]
Al Ghafri, A.A.; Maharachchikumbura, S.S.N.; Hyde, K.D.; Al-Saady, N.A.; Al-Sadi, A.M. A new section and a new species of Alternaria from Oman. Phytotaxa 2019, 405, 279–289. [Google Scholar] [CrossRef]
Nishikawa, J.; Nakashima, C. Japanese species of Alternaria and their species boundaries based on host range. Fungal Syst. Evol. 2020, 5, 197–281. [Google Scholar] [CrossRef] [PubMed]
Gannibal, P.B.; Orina, A.S.; Gasich, E.L. A new section for Alternaria helianthiinficiens found on sunflower and new asteraceous hosts in Russia. Mycol. Prog. 2022, 21, 34. [Google Scholar] [CrossRef]
Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 108, 1160–1166. [Google Scholar] [CrossRef]
Maddison, W.P.; Maddison, D.R. Mesquite: A Modular System for Evolutionary Analysis. Version 3.61. 2019. Available online: http://www.mesquiteproject.org (accessed on 20 February 2025).
Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
Nylander, J.A.A. MrModeltest v2.0. Program Distributed by the Author; Evolutionary Biology Centre, Uppsala University: Uppsala, Sweden, 2004. [Google Scholar]
Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
Miller, M.A.; Pfeiffer, W.; Schwartz, T. The CIPRES Science Gateway: Enabling High-Impact Science for Phylogenetics Researchers with Limited Resources. In Proceedings of the 1st Conference of the Extreme Science and Engineering Discovery Environment: Bridging from the Extreme to the Campus and Beyond (ACM), Chicago, IL, USA, 16–20 July 2012. [Google Scholar]
Swofford, D.L. Paup: Phylogenetic Analysis Using Parsimony (and Other Methods) 4.0. B5. Version 4.0b10; Sinauer Associates: Sunderland, MA, USA, 2002. [Google Scholar]
Rambaut, A. FigTree, a Graphical Viewer of Phylogenetic Trees. 2019. Available online: http://tree.bio.ed.ac.uk/software/figtree (accessed on 20 February 2025).
Quaedvlieg, W.; Binder, M.; Groenewald, J.Z.; Summerell, B.A.; Carnegie, A.J.; Burgess, T.I.; Crous, P.W. Introducing the consolidated species concept to resolve species in the Teratosphaeriaceae. Persoonia 2014, 33, 1–40. [Google Scholar] [CrossRef]
Bruen, T.C.; Philippe, H.; Bryant, D. A simple and robust statistical test for detecting the presence of recombination. Genetics 2006, 172, 2665–2681. [Google Scholar] [CrossRef]
Huson, D.H.; Bryant, D. Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 2006, 23, 254–267. [Google Scholar] [CrossRef]
Alavi, Z.; Ahmadpour, A.; Ghosta, Y. Sexual morph of Alternaria scirpivora (Alternaria section Nimbya) from Iran. Mycol. Iran. 2024, 11, 73–81. [Google Scholar]
Farr, D.F.; Rossman, A.Y.; Castlebury, L.A. United States National Fungus Collections Fungus-Host Dataset. Available online: https://fungi.ars.usda.gov/ (accessed on 20 February 2025).
Hashemlou, E.; Ghosta, Y.; Poursafar, A.; Azizi, R. Morphological and molecular identification of Alternaria hedjaroudei sp. nov., a new species in section Panax from Iran. Phytotaxa 2020, 438, 130–140. [Google Scholar] [CrossRef]
Li, J.; Jiang, H.; Jeewon, R.; Hongsanan, S.; Bhat, D.J.; Tang, S.M.; Lumyong, S.; Mortimer, P.E.; Xu, J.C.; Camporesi, E.; et al. Alternaria: Update on species limits, evolution, multi-locus phylogeny, and classification. Stud. Fungi 2023, 7, 23. [Google Scholar] [CrossRef]
Lucas, M.T.; Webster, J. Conidia of Pleospora scirpicola and P. valesiaca. Trans. Br. Mycol. Soc. 1964, 47, 247–256. [Google Scholar] [CrossRef]
Arie, T.; Christiansen, S.K.; Yoder, O.C.; Turgeon, B.G. Efficient cloning of Ascomycete mating type genes by PCR amplification of the conserved MAT HMG Box. Fungal Genet. Biol. 1997, 21, 118–130. [Google Scholar] [CrossRef]
Arie, T.; Kaneko, I.; Yoshida, T.; Noguchi, M.; Nomura, Y.; Yamaguchi, I. Mating-type genes from asexual phytopathogenic ascomycetes Fusarium oxysporum and Alternaria alternata. Mol. Plant Microb. Interact. 2000, 13, 1330–1339. [Google Scholar] [CrossRef]
Berbee, M.L.; Payne, B.P.; Zhang, G.; Roberts, R.G.; Turgeon, B.G. Shared ITS DNA substitutions in isolates of opposite mating type reveal a recombining history for three presumed asexual species in the filamentous ascomycete genus Alternaria. Mycol. Res. 2003, 107, 169–182. [Google Scholar] [CrossRef]
Meng, J.W.; Zhu, W.; He, M.H.; Wu, E.J.; Duan, G.H.; Xie, Y.K.; Jin, Y.J.; Yang, L.N.; Shang, L.P.; Zhan, J. Population genetic analysis reveals cryptic sex in the phytopathogenic fungus Alternaria alternata. Sci. Rep. 2015, 5, 18250. [Google Scholar] [CrossRef]
Stewart, J.E.; Kawabe, M.; Abdo, Z.; Arie, T.; Peever, T.L. Contrasting codon usage patterns and purifying selection at the mating locus in putatively asexual Alternaria fungal species. PLoS ONE 2011, 6, e20083. [Google Scholar] [CrossRef]
Gannibal, P.B.; Gomzhina, M.M. Revision of Alternaria sections Pseudoulocladium and Ulocladioides: Assessment of species boundaries, determination of mating-type loci, and identification of Russian strains. Mycologia 2024, 116, 744–763. [Google Scholar] [CrossRef]
Sun, S.; Heitman, J. From two to one: Unipolar sexual reproduction. Fungal Biol. Rev. 2015, 29, 118–125. [Google Scholar] [CrossRef]
Aung, S.L.L.; Liu, F.Y.; Gou, Y.N.; New, Z.M.; Yu, Z.H.; Deng, J.X. Morphological and phylogenetic analyses reveal two new Alternaria species (Pleosporales, Pleosporaceae) in Alternaria section from Cucurbitaceae plants in China. MycoKeys 2024, 107, 125–139. [Google Scholar] [CrossRef] [PubMed]
He, J.; Li, D.W.; Cui, W.L.; Huang, L. Seven new species of Alternaria (Pleosporales, Pleosporaceae) associated with Chinese fir, based on morphological and molecular evidence. MycoKeys 2024, 101, 1–44. [Google Scholar] [CrossRef] [PubMed]
Simpson, D.A.; Yesson, C.; Culham, A.; Couch, C.A.; Musaya, A.M. Climate change and Cyperaceae. In Climate Change, Ecology and Systematics; Hodkinson, T., Jones, M., Waldren, S., Parnell, J., Eds.; Cambridge University Press: Cambridge, UK, 2011; pp. 439–456. [Google Scholar]
Léveillé-Bourret, É.; Eggertson, Q.; Hambleton, S.; Starr, J.R. Cryptic diversity and significant cophylogenetic signal detected by DNA barcoding the rust fungi (Pucciniaceae) of Cyperaceae-Juncaceae. J. Syst. Evol. 2021, 59, 833–851. [Google Scholar] [CrossRef]
Mannaf, M.N.H.A.; Juraimi, A.S.; Motmainna, M.; Ya, N.N.C.; Su, A.S.M.; Roslim, M.H.M.; Ahmad, A.; Noor, N.M. Detection of sedge weeds infestation in wetland rice cultivation using hyperspectral images and artificial intelligence: A review. Pertanika J. Sci. Technol. 2024, 32, 1317–1334. [Google Scholar] [CrossRef]
Shi, B.; Osunkoya, O.O.; Chadha, A.; Florentine, S.K.; Dhileepan, K. Biology, ecology and management of the invasive navua sedge (Cyperus aromaticus)—A global review. Plants 2021, 10, 1851. [Google Scholar] [CrossRef]
Cai, X.; Gu, M. Bio-herbicides in organic horticulture. Horticulturae 2016, 2, 3. [Google Scholar] [CrossRef]
Feng, L.; Hu, L.; Bo, J.; Ji, M.; Ze, S.; Ding, Y.; Yang, B.; Zhao, N. Identification and biological characteristics of Alternaria gossypina as a promising biocontrol agent for the control of Mikania micrantha. J. Fungi 2024, 10, 691. [Google Scholar] [CrossRef]
Hoagland, R.E.; Boyette, C.D. Effects of the fungal bioherbicide, Alternaria cassia on peroxidase, pectinolytic and proteolytic activities in sicklepod seedlings. J. Fungi 2021, 7, 1032. [Google Scholar] [CrossRef]
Pantović, J.G.; Sečanski, M.; Gordanić, S.; Todosijević, Š.L. Weed biological control with fungi-based bioherbicides. Acta Agric. Serb. 2023, 28, 23–37. [Google Scholar] [CrossRef]

Figure 1. Wetlands sampled in this research. (a) Qezeljeh Dam wetland in Khoy County, West Azarbaijan; (b) Gori Lake (Qurugöl) wetland in Bostanabad County, East Azarbaijan province; (c) Neor Lake in Ardebil County, Ardebil province; (d) Norouzlu Dam wetland in Miyandoab County, West Azarbaijan; (e) Kani Barazan wetland in Mahabad County, West Azarbaijan province.

Figure 2. Large-scale phylogenetic tree inferred using Bayesian Inference (BI) based on a combined dataset of ITS, GAPDH, TEF1, RPB2, and Alt a 1 of Alternaria species. Maximum Likelihood (ML), Maximum Parsimony (MP) bootstrap support (BS) values > 70%, and Bayesian posterior probabilities (PP) > 0.90 are indicated at the nodes. The tree is rooted with Stemphylium botryosum (CBS 714.68) and S. vesicarium (CBS 191.86), and newly identified strains are highlighted in blue. Thickened branches represent the statistical support values of ML/MP/BI analyses equal to 100/100/1.0. The scale bar indicates the number of nucleotide substitutions. The monotypic lineages are indicated by a black asterisk.

Figure 3. Small-scale phylogenetic tree of Alternaria section Nimbya species, derived from Bayesian analysis of the combined ITS, GAPDH, TEF1, RPB2, and Alt a 1 sequence alignment. Maximum likelihood (ML), Maximum Parsimony (MP) bootstrap support values > 70%, and Bayesian posterior probabilities (PP > 0.90) are shown at the nodes. Thickened branches represent the statistical support values of ML/MP/BI equal to 100/100/1.0. Taxonomic novelties are highlighted in bold and blue. The tree is rooted with Alternaria chlamydospora (CBS 491.72) and A. phragmospora (CBS 274.70).

Table 1. Primer sets used for PCR amplifications in this study, with sequences and references.

Loci	Primer Name	Primer Sequence (5′–3′)	Direction	Reference
ITS	ITS1	TCCGTAGGTGAACCTGCGG	Forward	[32]
ITS	ITS4	TCCTCCGCTTATTGATATGC	Reverse	[32]
GAPDH	gpd1	CAACGGCTTCGGTCGCATTG	Forward	[33]
GAPDH	gpd2	GCCAAGCAGTTGGTTGTG	Reverse	[33]
TEF1	EF1-728F	CATCGAGAAGTTCGAGAAGG	Forward	[34]
TEF1	EF1-986R	TACTTGAAGGAACCCTTACC	Reverse	[34]
RPB2	RPB2-5F2	GGGGWGAYCAGAAGAAGGC	Forward	[35]
RPB2	RPB2-7cR	CCCATRGCTTGTYYRCCCAT	Reverse	[36]
Alt a 1	Alt-for	ATGCAGTTCAC CACCATCGC	Forward	[37]
Alt a 1	Alt-rev	ACGAGGGTGAY GTAGGCGTC	Reverse	[37]
ISSR	ISSR5	(GA)₅YC	-	-

Table 2. Lists of Alternaria species and sections used for phylogenetic analyses, with details about host/substrate, country, and GenBank accession numbers. Newly generated sequences are in bold.

Species Name	Section	Collection No.	Country	Host/Substrate	GenBank Accession Numbers
Species Name	Section	Collection No.	Country	Host/Substrate	ITS	GAPDH	TEF1	RPB2	Alt a 1
Alternaria abundans	Chalastospora	CBS 534.83	New Zealand	Fragaria sp.	JN383485	KC584154	KC584707	KC584448	JN383503
A. alternantherae	Althernantherae	CBS 124392	China	Solanum melongena	KC584179	KC584096	KC584633	KC584374	KP123846
A. alternariae	Ulocladium	CBS 126989	USA	Daucus carota	AF229485	AY278815	KC584730	KC584470	AY563316
A. alternata	Alternaria	CBS 916.96	India	Arachis hypogaea	AF347031	AY278808	KC584634	KC584375	AY563301
A. arborescens	Alternaria	CBS 102605	USA	Solanum lycopersicum	AF347033	AY278810	KC584636	KC584377	AY563303
A. argyranthemi	-	CBS 116530	New Zealand	Argyranthemum sp.	KC584181	KC584098	KC584637	KC584378	-
A. arrhenatheri	Pseudoalternaria	LEP 140372	USA	Arrhenatherum elatius	JQ693677	JQ693635	-	-	-
A. aspera	Pseudoulocladium	CBS 115269	Japan	Pistacia vera	KC584242	KC584166	KC584734	KC584474	KF533899
A. bornmuelleri	Undifilum	DAOM 231361	Austria	Securigera varia	FJ357317	FJ357305	KC584751	KC584491	JN383516
A. botryospora	Embellisioides	CBS_478.90	New Zealand	Leptinella dioica	AY278844	AY278831	KC584720	KC584461	AY563324
A. botrytis	Ulocladium	CBS 197.67	USA	Contaminant	KC584243	KC584168	KC584736	KC584476	-
A. brassicae	-	CBS 116528	USA	Brassica oleracea	KC584185	KC584102	KC584641	KC584382	-
A. brassicicola	Brassicicola	CBS 118699	USA	Brassica oleracea	JX499031	KC584103	KC584642	KC584383	-
A. brassicifolii	-	CNU 111118	Korea	Brassica rapa L. subsp. pekinensis	JQ317188	KM821537	-	-	-
A. breviramosa	Chalastospora	CBS 121331	Australia	Triticum sp.	FJ839608	KC584148	KC584700	KC584442	-
A. caricicola	Nimbya	IRAN 3418C	Iran	Carex sp.	MK508871	MK505392	MT187265	MT187279	MT187233
A. caricicola	Nimbya	FCCUU 1371	Iran	Carex sp.	MK508872	MK505393	MT187266	MT187280	MT187234
A. caricicola	Nimbya	FCCUU 1384	Iran	Cyperus sp.	OM349100	OM640668	OM640735	OM640719	OM616893
A. caricicola	Nimbya	FCCUU 1385	Iran	Cyperus sp.	OM349115	OM640669	OM640734	OM640718	OM616894
A. caricicola	Nimbya	FCCUU 1386	Iran	Cyperus sp.	OM349116	OM640670	OM640736	OM640720	OM616895
A. caricifolia	Nimbya	IRAN 4261C	Iran	Cyperus sp.	OM349113	OM640666	OM640748	OM640714	OM616920
A. caricifolia	Nimbya	FCCUU 1402	Iran	Cyperus sp.	OM349114	OM640667	OM640749	OM640715	OM616921
A. caricis	Nimbya	CBS 480.90	USA	Carex hoodii	AY278839	AY278826	KC584726	KC584467	AY563321
A. cetera	Chalastospora	CBS 121340	Australia	Elymus scabrus	JN383482	AY562398	KC584699	KC584441	AY563278
A. chartarum	Pseudoulocladium	CBS 200.67	Canada	Populus sp.	AF229488	KC584172	KC584741	KC584481	AY563319
A. cheiranthi	Cheiranthus	CBS 109384	Italy	Cheiranthus cheiri	AF229457	KC584107	KC584646	KC584387	AY563290
A. chlamydospora	Phragmosporae	CBS 491.72	Egypt	Soil	KC584189	KC584108	KC584647	KC584388	-
A. chlamydosporigena	Embellisia	CBS 341.71	USA	Air	KC584231	KC584156	KC584710	KC584451	-
A. cinerariae	Sonchi	CBS 116495	USA	Ligularia sp.	KC584190	KC584109	KC584648	KC584389	-
A. conjuncta	Infectoriae	CBS 196.86	Switzerland	Pastinaca sativa	FJ266475	AY562401	KC584649	KC584390	AY563281
A. conoidea	Brassicicola	CBS 132.89	Saudi Arabia	Ricinus communis	AF348226	FJ348227	KC584711	KC584452	FJ348228
A. cucurbitae	Ulocladioides	CBS 483.81	New Zealand	Cucumis sativus	FJ266483	AY562418	KC584743	KC584483	AY563315
A. cumini	Eureka	CBS 121329	India	Cuminum cyminum	KC584191	KC584110	KC584650	KC584391	-
A. cyperi	Nimbya	IRAN 4223C	Iran	Cyperus sp.	OM349106	OM640676	OM640745	OM640712	OM616918
A. cyperi	Nimbya	FCCUU 1397	Iran	Cyperus sp.	OM349107	OM640677	OM640746	OM640713	OM616919
A. cypericola	Nimbya	IRAN 3423C	Iran	Cyperus sp.	MT176120	MT187250	MT187262	MT187276	MT187235
A. cypericola	Nimbya	IRAN 3424C	Iran	Cyperus sp.	MT176122	MT187251	MT187263	MT187277	MT187236
A. cypericola	Nimbya	FCCUU 1387	Iran	Cyperus sp.	OM349101	-	-	OM640716	OM616926
A. cypericola	Nimbya	FCCUU 1388	Iran	Eleocharis sp.	OM349102	-	-	OM640717	OM616927
A. cypericola	Nimbya	IRAN 3425C	Iran	Cyperus sp.	MT176121	MT187252	MT187264	MT187278	MT187237
A. daucifolii	Alternata	CBS 118812	USA	Daucus carota	KC584193	KC584112	KC584652	KC584393	KP123905
A. dennisii	-	CBS 476.90	Isle of Man	Senecio jacobaea	JN383488	JN383469	KC584713	KC584454	JN383505
A. dianthicola	Dianthicola	CBS 116491	New Zealand	Dianthus × allwoodii	KC584194	KC584113	KC584653	KC584394	-
A. elegans	Dianthicola	CBS 109159	Burkina Faso	Lycopersicon esculentum	KC584195	KC584114	KC584654	KC584395	-
A. embellisia	Embellisia	CBS 339.71	USA	Allium sativum	KC584230	KC584155	KC584708	KC584449	-
A. ershadii	Pseudoalternaria	IRAN 3275C	Iran	Triticum aestivum	MK829647	MK829645	-	-	-
A. eryngii	Panax	CBS 121339	-	Eryngium sp.	JQ693661	AY562416	KC584656	KC584397	AY563313
A. euphorbiicola	Euphorbiicola	CBS 133874	USA	Euphorbia hyssopifolia	KJ718174	KJ718019	KJ718522	KJ718347	-
A. euphorbiicola	Euphorbiicola	CBS 119410	USA	Euphorbia pulcherrima	KJ718173	KJ718018	KJ718521	KJ718346	-
A. eureka	Eureka	CBS 193.86	Australia	Medicago rugosa	JN383490	JN383471	KC584715	KC584456	JN383507
A. gypsophilae	Gypsophilae	CBS 107.41	Netherlands	Gypsophila elegans	KC584199	KC584118	KC584660	KC584401	KJ718688
A. helianthiinficiens	helianthiinficiens	CBS 208.86	USA	Helianthus annuus	JX101649	KC584120	EU130548	KC584403	-
A. heterospora	Ulocladioides	CBS 123376	China	Lycopersicon esculentum	KC584248	KC584176	KC584748	KC584488	EU855805
A. heyranica	Nimbya	IRAN 3516C	Iran	Carex sp.	MT176114	MT187244	MT187256	MT187270	MT187238
A. heyranica	Nimbya	FCCUU 1421	Iran	Carex sp.	OM535905	OM640671	OM640758	OM640726	OM616930
A. hyacinthi	Embellisioides	CBS 416.71	Netherlands	Hyacinthus orientalis	KC584233	KC584158	KC584716	KC584457	-
A. indefessa	Cheiranthus	CBS 536.83	USA	Soil	KC584234	KC584159	KC584717	KC584458	AY563323
A. infectoria	Infectoriae	CBS 210.86	UK	Triticum aestivum	DQ323697	AY278793	KC584662	KC584404	FJ266502
A. japonica	Japonicae	CBS 118390	USA	Brassica chinensis	KC584201	KC584121	KC584663	KC584405	-
A. junci-acuti	Nimbya	IRAN 3508C	Iran	Juncus acutus	MT176111	MT187241	MT187253	MT187267	MT187230
A. junci-acuti	Nimbya	IRAN 3518C	Iran	Juncus acutus	MT176112	MT187242	MT187254	MT187268	MT187232
A. junci-acuti	Nimbya	IRAN 3512C	Iran	Juncus acutus	MT176113	MT187243	MT187255	MT187269	MT187231
A. junci-acuti	Nimbya	FCCUU 1389	Iran	Carex sp.	OM349091	OM640674	-	OM640704	OM616923
A. junci-acuti	Nimbya	FCCUU 1390	Iran	Carex sp.	OM349092	OM640672	-	OM640702	OM616922
A. junci-acuti	Nimbya	FCCUU 1391	Iran	Carex sp.	OM349093	OM640675	-	OM640705	OM616924
A. junci-acuti	Nimbya	FCCUU 1392	Iran	Carex sp.	OM349090	OM640673	-	OM640703	OM616925
A. juncigena	Nimbya	IRAN 4779C	Iran	Juncus sp.	OM349085	OM640661	OM640740	OM640697	OM616904
A. juncigena	Nimbya	FCCUU 1409	Iran	Juncus sp.	OM349086	OM640662	OM640741	OM640698	OM616905
A. juncigena	Nimbya	FCCUU 1410	Iran	Juncus sp.	OM349087	OM640663	OM640742	OM640699	OM616906
A. juncigena	Nimbya	FCCUU 1411	Iran	Juncus sp.	OM349088	OM640664	OM640743	OM640700	OM616907
A. juncigena	Nimbya	FCCUU 1412	Iran	Juncus sp.	OM349089	OM640665	OM640744	OM640701	OM616908
A. junci-inflexi	Nimbya	IRAN 4227C	Iran	Juncus inflexus	OM349097	OM640660	OM640752	OM640696	OM616912
A. junci-inflexi	Nimbya	FCCUU 1414	Iran	Juncus inflexus	OM349098	OM640659	OM640751	OM640695	OM616914
A. junci-inflexi	Nimbya	FCCUU 1415	Iran	Juncus inflexus	OM349099	OM640658	OM640750	OM640694	OM616913
A. kordkuyana	Pseudoalternaria	IRAN 2764C	Iran	Triticum aestivum	MF033843	MF033826	-	-	-
A. kulundii	Soda	CBS 137525	Russia	Soil	KJ443262	KJ649618	-	KJ443176	-
A. leucanthemi	Teretispora	CBS 421.65	Netherlands	Chrysanthemum maximum	KC584240	KC584164	KC584732	KC584472	-
A. leucanthemi	Teretispora	CBS 422.65	USA	Chrysanthemum maximum	KC584241	KC584165	KC584733	KC584473	-
A. mimicula	Brassicicola	CBS 118696	USA	Lycopersicon esculentum	FJ266477	AY562415	KC584669	KC584411	AY563310
A. nepalensis	Japonicae	CBS 118700	Nepal	Brassica sp.	KC584207	KC584126	KC584672	KC584414	-
A. nobilis	Gypsophilae	CBS 116490	New Zealand	Dianthus caryophyllus	KC584208	KC584127	KC584673	KC584415	JQ646385
A. omanensis	Omanensis	SQUCC 15560	Oman	dead wood	MK878563	MK880900	MK880897	MK880894	-
A. omanensis	Omanensis	SQUCC 13580	Oman	dead wood	MK878562	MK880899	MK880896	MK880893	-
A. oregonensis	Infectoriae	CBS 542.94	USA	Triticum aestivum	FJ266478	FJ266491	KC584674	KC584416	FJ266503
A. oudemansii	Ulocladium	CBS 114.07	-	-	FJ266488	KC584175	KC584746	KC584486	FJ266514
A. panax	Panax	CBS 482.81	USA	Aralia racemosa	KC584209	KC584128	KC584675	KC584417	JQ646382
A. penicillata	Crivellia	CBS 116607	Austria	Papaver rhoeas	KC584229	KC584153	KC584706	KC584447	-
A. penicillata	Crivellia	CBS 116608	Austria	Papaver rhoeas	FJ357311	FJ357299	KC584698	KC584440	JN383502
A. perpunctulata	Althernantherae	CBS 115267	USA	Alternanthera philoxeroides	KC584210	KC584129	KC584676	KC584418	JQ905111
A. persica	Nimbya	IRAN 4229C	Iran	Juncus sp.	OM349082	OM640655	OM640737	OM640691	OM616901
A. persica	Nimbya	IRAN 4262C	Iran	Juncus sp.	OM349083	OM640656	OM640738	OM640692	OM616902
A. persica	Nimbya	FCCUU 1418	Iran	Juncus sp.	OM349084	OM640657	OM640739	OM640693	OM616903
A. petroselini	Radicina	CBS 112.41	-	Petroselinum sativum	KC584211	KC584130	KC584677	KC584419	AY563288
A. petuchovskii	Soda	CBS 137517	Russia	Soil	KJ443254	KJ649616	-	KJ443170	-
A. photistica	Panax	CBS 212.86	UK	Digitalis purpurea	KC584212	KC584131	KC584678	KC584420	AY563282
A. phragmospora	Phragmosporae	CBS 274.70	Netherlands	Soil	JN383493	JN383474	KC584721	KC584462	JN383509
A. porri	Porri	CBS 116699	USA	Allium cepa	KJ718218	KJ718053	KJ718564	KJ718391	KJ718727
A. proteae	Embellisioides	CBS 475.90	Australia	Protea sp.	AY278842	KC584161	KC584723	KC584464	-
A. protenta	Porri	CBS 116651	USA	Solanum tuberosum	KC584217	KC584139	KC584688	KC584430	GQ180097
A. pseudorostrata	Porri	CBS 119411	USA	Euphorbia pulcherrima	JN383483	AY562406	KC584680	KC584422	AY563295
A. radicina	Radicina	CBS 245.67	USA	Daucus carota	KC584213	KC584133	KC584681	KC584423	FN689405
A. rosae	Pseudoalternaria	CBS 121341	New Zealand	Rosa rubiginosa	JQ693639	JQ646279	-	-	JQ646370
A. salkadehensis	Nimbya	IRAN 4226C	Iran	Carex sp.	OM349094	OM640690	OM640747	OM640706	OM616911
A. salkadehensis	Nimbya	FCCUU 1399	Iran	Cyperus sp.	OM349095	OM640688	OM640732	OM640707	OM616909
A. salkadehensis	Nimbya	IRAN 4225C	Iran	Cyperus sp.	OM349096	OM640689	OM640733	OM640708	OM616910
A. schoenoplecti	Nimbya	IRAN 4263C	Iran	Schoenoplectu sp.	OM349103	OM640678	OM640729	OM640709	OM616915
A. schoenoplecti	Nimbya	FCCUU 1394	Iran	Schoenoplectu sp.	OM349104	OM640679	OM640730	OM640710	OM616916
A. schoenoplecti	Nimbya	FCCUU 1395	Iran	Schoenoplectu sp.	OM349105	OM640680	OM640731	OM640711	OM616917
A. scirpicola	Nimbya	CBS 481.90	UK	Scirpus sp.	KC584237	KC584163	KC584728	KC584469	-
A. scirpinfestans	Nimbya	EGS 49-185	USA	Scirpus acutus	JN383499	JN383480	-	-	JN383514
A. scirpivora	Nimbya	EGS 50-021	USA	Scirpus acutus	JN383500	JN383481	-	-	JN383515
A. scirpivora	Nimbya	FCCUU 1419	Iran	Scirpus acutus	OM535903	OM640681	OM640759	OM640727	OM616928
A. scirpivora	Nimbya	FCCUU 1420	Iran	Scirpus acutus	OM535904	OM640682	OM640760	OM640728	OM616929
A. scirpivora	Nimbya	IRAN 3421C	Iran	Scirpus acutus	MT176118	MT187248	MT187260	MT187274	MT187240
A. scirpivora	Nimbya	IRAN 3419C	Iran	Scirpus acutus	MT176119	MT187249	MT187261	MT187275	-
A. septospora	Pseudoulocladium	CBS 109.38	Italy	Wood	FJ266489	FJ266500	KC584747	KC584487	FJ266515
A. shukurtuzii	Soda	CBS 137520	Russia	Soil	KJ443257	KJ649620	-	KJ443172	-
A. simsimi	Dianthicola	CBS 115265	Argentina	Sesamum indicum	JF780937	KC584137	KC584686	KC584428	-
A. smyrnii	Radicina	CBS 109380	UK	Smyrnium olusatrum	AF229456	KC584138	KC584687	KC584429	AY563289
A. soliaridae	-	CBS 118387	USA	Soil	KC584218	KC584140	KC584689	KC584431	-
A. sonchi	Sonchi	CBS 119675	Canada	Sonchus asper	KC584220	KC584142	KC584691	KC584433	-
A. tellustris	Embellisia	CBS 538.83	USA	Soil	FJ357316	AY562419	KC584724	KC584465	AY563325
A. thalictrigena	-	CBS 121712	Germany	Thalictrum sp.	EU040211	KC584144	KC584694	KC584436	-
A. triglochinicola	Eureka	CBS 119676	Australia	Triglochin procera	KC584222	KC584145	KC584695	KC584437	-
A. urmiana	Nimbya	IRAN 4228C	Iran	Juncus inflexus	OM349108	OM640683	OM640754	OM640721	OM616896
A. urmiana	Nimbya	FCCUU 1404	Iran	Juncus inflexus	OM349109	OM640684	OM640755	OM640722	OM616897
A. urmiana	Nimbya	IRAN 4224C	Iran	Juncus acutus	OM349110	OM640685	OM640753	OM640723	OM616898
A. urmiana	Nimbya	FCCUU 1406	Iran	Juncus acutus	OM349111	OM640686	OM640756	OM640724	OM616899
A. urmiana	Nimbya	FCCUU 1407	Iran	Juncus acutus	OM349112	OM640687	OM640757	OM640725	OM616900
A. vaccariicola	Gypsophilae	CBS 118714	USA	Vaccaria hispanica	KC584224	KC584147	KC584697	KC584439	JQ646384
Stemphylium botryosum	-	CBS 714.68	Canada	Medicago sativa	KC584238	AF443881	KC584729	AF107804	-
S. vesicarium	-	CBS 191.86	India	Medicago sativa	KC584239	AF443884	KC584731	KC584471	-

Table 3. Phylogenetic information of individual and combined sequence datasets used in phylogenetic analyses.

Gene		Parameter
Gene		Number of Taxa	Total Characters	Constant Sites	Variable Sites	Parsimony Informative Sites	Parsimony Uninformative Sites	AIC Substitution Model *	Lset Nst, Rates	−lnL
Section Nimbya	ITS	55	469	388	81	76	5	SYM + I + G	6, invgamma	1393.2854
	GAPDH	53	514	368	146	138	8	GTR + I	6, propinv	2019.9746
	TEF1	46	177	113	64	60	4	K80 + G	2, gamma	758.6035
	RPB2	53	716	526	190	178	12	GTR + G	6, gamma	2521.9597
	Alt a 1	50	431	215	216	193	23	GTR + I + G	6, invgamma	2506.1685
	Combined	55	2307	1610	697	645	52	–	–	10,258.9258
All Alternaria sections	ITS	132	462	333	129	111	18	GTR + I + G	6, invgamma	2978.5835
	GAPDH	130	524	311	213	192	21	GTR + I + G	6, invgamma	5840.7612
	TEF1	107	187	59	127	109	18	GTR + G	6, gamma	2732.1633
	RPB2	125	690	437	253	247	6	SYM + I + G	6, invgamma	7530.5337
	Alt a 1	87	436	117	320	277	43	HKY + I + G	6, invgamma	7424.5391
	Combined	132	2299	1257	1042	936	106	–	–	28,937.1276

* Akaike information criterion substitution models implemented in Bayesian inference.

Table 4. A comparative analysis of the 13 species identified in this study based on host association, morphological features, and cultural characteristics on PCA medium at 25 °C after 7 days of growth. Measurements for conidial characteristics are given in ranges (minimum–maximum).

Species	Host Family (Genus or Species)	Conidial Characteristics	Colony Characteristics (on PCA)	Sexual Morph	Distribution in Iran (province)
A. caricicola	Cyperaceae (Cyperus sp. and Carex sp.)	87–205 × 10–15 μm; 7–14 transverse septa; smooth; Beaks 30–100	Flat, entire, olivaceous green to grey olivaceous; 60–70 mm/7d	Not observed	East Azarbaijan; West Azarbaijan
A. caricifolia	Cyperaceae (Carex sp.)	35–100 × 5–9 μm; 3–11 transverse septa; smooth, apical cell extension up to 45 μm	Flat, floccose, white to rosy buff center, hazel margins; 58 mm/7d	Present; ascomata 120–240 × 90–220 μm	West Azarbaijan
A. cyperi	Cyperaceae (Cyperus sp.)	55–100 × 10–12 μm; 5–12 transverse septa; smooth; apical cell extension up to 15 μm	Fawn with salmon tints; velvety; 59 mm/7d	Not observed	East Azarbaijan
A. cypericola	Cyperaceae (Cyperus sp. and Eleocharis sp.)	87–155 × 10–15 μm; 6–12 transverse septa; smooth; Beaks 37.5–137	Flat, entire, dark green to olivaceous brown; 60–70 mm/7d	Not observed	West Azarbaijan
A. heyranica	Cyperaceae (Carex sp.)	50–75 × 10–12 μm; 4–9 transverse septa; smooth, Beaks 50–175	Flat, entire, olivaceous brown; 25–30 mm/7d	Not observed	Guilan
A. junci–acuti	Cyperaceae (Carex sp.); Juncaceae (Juncus acutus)	50–87 × 7–9 μm; 5–14 transverse septa; smooth, Beaks 20–200	Flat, entire, dark green to olivaceous brown; 70–80 mm/7d	Not observed	Golestan; West Azarbaijan
A. juncigena sp. nov.	Juncaceae (Juncus sp.)	40–110 × 10–16 μm; 5–15 transverse septa; smooth; apical cell extension up to 50 μm	Flat, entire, velvety, pale vinaceous to vinaceous buff; 50 mm/7d	Not observed	West Azarbaijan
A. junci–inflexi	Juncaceae (Juncus inflexus)	21–80 × 8–12 μm; 2–9 transverse septa; smooth to verrucose; apical cell extension up to 15 μm	Flat, entire, velvety, fawn; 65 mm/7d	Not observed	East Azarbaijan; West Azarbaijan
A. persica	Juncaceae (Juncus sp.)	40–85 × 8–11 μm; 4–15 transverse septa; smooth to verrucose; apical cell extension up to 50 μm	Floccose, vinaceous buff; 60 mm/7d	Not observed	West Azarbaijan
A. salkadehensis	Cyperaceae (Cyperus sp. and Carex sp.)	35–100 × 10–13 μm; 4–13 transverse septa, smooth; apical cell extension up to 45 μm	Flat, entire, velvety, hazel; 63 mm/7d	Not observed	West Azarbaijan
A. schoenoplecti	Cyperaceae (Schoenoplectus sp.)	40–88 × 12–18 μm; 3–11 transverse septa; smooth; apical cell extension up to 22 μm	Flat, entire, velvety, sepia to cinnamon; 49 mm/7d	Not observed	West Azarbaijan
A. scirpivora	Cyperaceae (Scirpus acutus)	30–60 × 5–8 μm; 3–10 transverse septa; smooth; apical cell extension up to 50 μm	Flat, entire, dark green to olivaceous brown; 60–70 mm/7d	Present; ascomata 280–500 × 250–450 μm	Multiple provinces
A. urmiana	Juncaceae (Juncus acutus and Juncus inflexus)	35–55 × 12–15 μm; 3–8 transverse septa; smooth to verrucose; apical cell extension up to 10 μm	Flat, entire, velvety, rosy buff; 51 mm/7d	Not observed	West Azarbaijan

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Share and Cite

MDPI and ACS Style

Ahmadpour, A.; Ghosta, Y.; Alavi, Z.; Alavi, F.; Poursafar, A.; Rampelotto, P.H. Diversity of Alternaria Section Nimbya in Iran, with the Description of Eight New Species. J. Fungi 2025, 11, 225. https://doi.org/10.3390/jof11030225

AMA Style

Ahmadpour A, Ghosta Y, Alavi Z, Alavi F, Poursafar A, Rampelotto PH. Diversity of Alternaria Section Nimbya in Iran, with the Description of Eight New Species. Journal of Fungi. 2025; 11(3):225. https://doi.org/10.3390/jof11030225

Chicago/Turabian Style

Ahmadpour, Abdollah, Youbert Ghosta, Zahra Alavi, Fatemeh Alavi, Alireza Poursafar, and Pabulo Henrique Rampelotto. 2025. "Diversity of Alternaria Section Nimbya in Iran, with the Description of Eight New Species" Journal of Fungi 11, no. 3: 225. https://doi.org/10.3390/jof11030225

APA Style

Ahmadpour, A., Ghosta, Y., Alavi, Z., Alavi, F., Poursafar, A., & Rampelotto, P. H. (2025). Diversity of Alternaria Section Nimbya in Iran, with the Description of Eight New Species. Journal of Fungi, 11(3), 225. https://doi.org/10.3390/jof11030225

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Menu

Diversity of Alternaria Section Nimbya in Iran, with the Description of Eight New Species

Abstract

1. Introduction

2. Materials and Methods

2.1. Fungal Isolates

2.2. Morphological Observations

2.3. DNA Extraction and PCR Amplification

2.4. Sequence Alignment and Phylogenetic Analyses

2.5. Genealogical Concordance Phylogenetic Species Recognition Analysis

3. Results

3.1. Phylogenetic Analyses

3.2. Taxonomy

3.2.1. Alternaria caricifolia A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 4 and Figure 5)

3.2.2. Alternaria cyperi A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 7)

3.2.3. Alternaria juncigena A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 8)

3.2.4. Alternaria junci-inflexi A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 10)

3.2.5. Alternaria persica A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 11)

3.2.6. Alternaria salkadehensis A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 12)

3.2.7. Alternaria schoenoplecti A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 13)

3.2.8. Alternaria urmiana A. Ahmadpour, Y. Ghosta, Z. Alavi, F. Alavi and A. Poursafar, sp. nov. (Figure 14)

3.2.9. Alternaria caricicola Ahmadpour, Phytotaxa 405(2): 69. 2019 [19]

3.2.10. Alternaria cypericola Ahmadpour, Poursafar and Ghosta, Mycologia 113: 1078. 2021 [20]

3.2.11. Alternaria heyranica Ahmadpour, Poursafar and Ghosta, Mycologia 113: 1078. 2021 [20]

3.2.12. Alternaria junci-acuti Ahmadpour, Poursafar and Ghosta, Mycologia 113: 1080. 2021 [20]

3.2.13. Alternaria scirpivora (E.G. Simmons and D.A. Johnson) Woudenb. and Crous, Stud. Mycol. 75: 198. 2013 [17]

4. Discussion

Supplementary Materials

Author Contributions

Funding

Institutional Review Board Statement

Informed Consent Statement

Data Availability Statement

Conflicts of Interest

References

Share and Cite

Article Metrics

Article Access Statistics

Further Information

Guidelines

MDPI Initiatives

Follow MDPI