SsNEP2 Plays a Role in the Interaction Between Sclerotinia sclerotiorum and Coniothyrium minitans
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Growth Conditions
2.2. RNA Preparation and cDNA Synthesis
2.3. Yeast Secretion Trap Screen Assay
2.4. Vector Construction and Fungal Transformation
2.5. RT-qPCR
2.6. Mycelial Growth Assay
2.7. Parasitic Test on Mycelia and Sclerotia of S. sclerotiorum by C. minitans
2.8. Conidial Production of C. minitans Induced by S. sclerotiorum Culture Filtrate
2.9. Conidial Germination of C. minitans Induced by S. sclerotiorum
2.10. Statistical Analysis
3. Results
3.1. SsNEP2 Is Highly Expressed During the Mycoparasitic Process
3.2. Silencing of SsNEP2 Has No Influence on the Growth of S. sclerotiorum
3.3. Silencing of SsNEP2 in S. sclerotiorum Inhibits the Conidial Production of C. minitans
3.4. Silencing of SsNEP2 in S. sclerotiorum Enhances Resistance to the Parasitism of C. minitans
3.5. Overexpression of SsNEP2 Promotes the Growth of C. minitans
3.6. Expression of SsNEP2 in C. minitans Improves Parasitism to Mycelia of S. sclerotiorum
3.7. Expression of SsNEP2 in C. minitans Restores Conidiation and Parasitism to Silencing Mutants of S. sclerotiorum
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| NEP1 | necrosis- and ethylene-inducing peptide 1 |
| NLP | NEP1-like protein |
| NPP1 | The necrosis-inducing protein |
| PAMP | pathogen-associated molecular patterns |
| ROS | regulating reactive oxygen species |
| hpi | hours post-inoculation |
| PDA | potato dextrose agar plates |
| suc2 | secretion-defective invertase gene |
| CMD-W | a medium lacking tryptophan, 0.67% yeast N base without amino acid, 0.075% W dropout supplement, 2%sucrose, 0.1% glucose, and 2% agar |
| YPRAA | a medium containing 10 g/L yeast extract, 20 g/L peptone, 20 g/L raffinose, 2 mg/L antimycin A, and 2% agar |
| TTC | 2,3,5-triphenyltetrazolium chloride |
| ATMT | Agrobacterium tumefaciens-mediated transformation |
| STC | a kind of medium containing 1.0 mol/L sorbitol, 0.05 mol/L Tris-HCl pH 8.0, and 0.05 mol/L CaCl2 |
| RT-PCR | reverse transcription PCR |
| RT-qPCR | quantitative reverse transcription PCR |
| ddH2O | double distilled water |
| FPDB | PDB fermentation broth |
| PDA-FPDB | filtered FPDB amended with PDA at 1:1 volume |
| WA-FPDB | filtered FPDB amended with water containing 2% agar at 1:1 volume |
References
- Boland, G.J.; Hall, R. Index of plant hosts of Sclerotinia sclerotiorum. Can. J. Plant Pathol. 1994, 16, 93–108. [Google Scholar] [CrossRef]
- Bolton, M.D.; Thomma, B.P.; Nelson, B.D. Sclerotinia sclerotiorum (Lib.) de Bary: Biology and molecular traits of a cosmopolitan pathogen. Mol. Plant Pathol. 2006, 7, 1–16. [Google Scholar] [CrossRef]
- Taylor, A.; Coventry, E.; Handy, C.; West, J.S.; Young, C.S.; Clarkson, J.P. Inoculum potential of Sclerotinia sclerotiorum sclerotia depends on isolate and host plant. Plant Pathol. 2018, 67, 1286–1295. [Google Scholar] [CrossRef]
- Zhu, Y.; Wu, C.; Deng, Y.; Yuan, W.; Zhang, T.; Lu, J. Recent advances in virulence of a broad host range plant pathogen Sclerotinia sclerotiorum: A mini-review. Front. Microbiol. 2024, 15, 1424130. [Google Scholar] [CrossRef] [PubMed]
- Campbell, W.A. A new species of Coniothyrium parasitic on sclerotia. Mycologia 1947, 39, 190–195. [Google Scholar] [CrossRef]
- Elsheshtawi, M.; Elkhaky, M.T.; Sayed, S.R.; Bahkali, A.H.; Mohammed, A.A.; Gambhir, D.; Mansour, A.S.; Elgorban, A.M. Integrated control of white rot disease on beans caused by Sclerotinia sclerotiorum using Contans and reduced fungicides application. Saudi J. Biol. Sci. 2017, 24, 405–409. [Google Scholar] [CrossRef] [PubMed]
- Jones, D.; Gordon, A.H.; Bacon, J.S. Co-operative action by endo- and exo-beta-(1 leads to 3)-glucanases from parasitic fungi in the degradation of cell-wall glucans of Sclerotinia sclerotiorum (Lib.) de Bary. Biochem. J. 1974, 140, 47–55. [Google Scholar] [CrossRef]
- Wei, W.; Zhu, W.; Cheng, J.; Xie, J.; Li, B.; Jiang, D.; Li, G.; Yi, X.; Fu, Y. CmPEX6, a gene involved in peroxisome biogenesis, is essential for parasitism and conidiation by the sclerotial parasite Coniothyrium minitans. Appl. Environ. Microbiol. 2013, 79, 3658–3666. [Google Scholar] [CrossRef] [PubMed]
- Zeng, L.M.; Zhang, J.; Han, Y.C.; Yang, L.; Wu, M.D.; Jiang, D.H.; Chen, W.; Li, G.Q. Degradation of oxalic acid by the mycoparasite Coniothyrium minitans plays an important role in interacting with Sclerotinia sclerotiorum. Environ. Microbiol. 2014, 16, 2591–2610. [Google Scholar] [CrossRef]
- Yang, X.; Yang, J.; Li, H.; Niu, L.; Xing, G.; Zhang, Y.; Xu, W.; Zhao, Q.; Li, Q.; Dong, Y. Overexpression of the chitinase gene CmCH1 from Coniothyrium minitans renders enhanced resistance to Sclerotinia sclerotiorum in soybean. Transgenic Res. 2020, 29, 187–198. [Google Scholar] [CrossRef]
- Zhao, H.; Zhou, T.; Xie, J.; Cheng, J.; Jiang, D.; Fu, Y. Host transcriptional response of Sclerotinia sclerotiorum induced by the mycoparasite Coniothyrium minitans. Front. Microbiol. 2020, 11, 183. [Google Scholar] [CrossRef] [PubMed]
- Bailey, B.A. Purification of a protein from culture filtrates of Fusarium oxysporum that induces ethylene and necrosis in leaves of Erythroxylum coca. Phytopathology 1995, 85, 1250–1255. [Google Scholar] [CrossRef]
- Bailey, B.A.; Apel-Birkhold, P.C.; Akingbe, O.O.; Ryan, J.L.; O’Neill, N.R.; Anderson, J.D. Nep1 protein from Fusarium oxysporum enhances biological control of opium poppy by Pleospora papaveracea. Phytopathology 2000, 90, 812–818. [Google Scholar] [CrossRef]
- Fellbrich, G.; Romanski, A.; Varet, A.; Blume, B.; Brunner, F.; Engelhardt, S.; Felix, G.; Kemmerling, B.; Krzymowska, M.; Nürnberger, T. NPP1, a Phytophthora-associated trigger of plant defense in parsley and Arabidopsis. Plant J. 2002, 32, 375–390. [Google Scholar] [CrossRef] [PubMed]
- Pemberton, C.L.; Salmond, G.P.C. The Nep1-like proteins-a growing family of microbial elicitors of plant necrosis. Mol. Plant Pathol. 2004, 5, 353–359. [Google Scholar] [CrossRef] [PubMed]
- Gijzen, M.; Nürnberger, T. Nep1-like proteins from plant pathogens: Recruitment and diversification of the NPP1 domain across taxa. Phytochemistry 2006, 67, 1800–1807. [Google Scholar] [CrossRef] [PubMed]
- Oome, S.; Van den Ackerveken, G. Comparative and functional analysis of the widely occurring family of Nep1-like proteins. Mol. Plant Microbe Interact. 2014, 27, 1081–1094. [Google Scholar] [CrossRef]
- Lenarčič, T.; Pirc, K.; Hodnik, V.; Albert, I.; Borišek, J.; Magistrato, A.; Nürnberger, T.; Podobnik, M.; Anderluh, G. Molecular basis for functional diversity among microbial Nep1-like proteins. PLoS Pathog. 2019, 15, 1007951. [Google Scholar] [CrossRef] [PubMed]
- Schoonbeek, H.J.; Yalcin, H.A.; Burns, R.; Taylor, R.E.; Casey, A.; Holt, S.; Van den Ackerveken, G.; Wells, R.; Ridout, C.J. Necrosis and ethylene-inducing-like peptide patterns from crop pathogens induce differential responses within seven brassicaceous species. Plant Pathol. J. 2022, 71, 2004–2016. [Google Scholar] [CrossRef] [PubMed]
- Feng, B.Z.; Zhu, X.P.; Fu, L.; Lv, R.F.; Storey, D.; Tooley, P.; Zhang, X.G. Characterization of necrosis-inducing NLP proteins in Phytophthora capsici. BMC Plant Biol. 2014, 14, 126. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.-L.; Peng, Y.-L.; Fan, J. The Nep1-like protein family of Magnaporthe oryzae is dispensable for the infection of rice plants. Sci. Rep. 2017, 7, 4372. [Google Scholar] [CrossRef]
- Staats, M.; van Baarlen, P.; Schouten, A.; van Kan, J.A.; Bakker, F.T. Positive selection in phytotoxic protein-encoding genes of Botrytis species. Fungal Genet. Biol. 2007, 44, 52–63. [Google Scholar] [CrossRef] [PubMed]
- Bashi, D.Z.; Hegedus, D.D.; Buchwaldt, L.; Rimmer, S.R.; Borhan, M.H. Expression and regulation of Sclerotinia sclerotiorum necrosis and ethylene-inducing peptides (NEPs). Mol. Plant Pathol. 2010, 11, 43–53. [Google Scholar] [CrossRef]
- Baroncelli, R.; Piaggeschi, G.; Fiorini, L.; Bertolini, E.; Zapparata, A.; Pè, M.E.; Sarrocco, S.; Vannacci, G. Draft whole-genome sequence of the biocontrol agent Trichoderma harzianum T6776. Genome Announc. 2015, 3, e00647-15. [Google Scholar] [CrossRef]
- Sun, Z.B.; Sun, M.H.; Li, S.D. Identification of mycoparasitism-related genes in Clonostachys rosea 67-1 active against Sclerotinia sclerotiorum. Sci. Rep. 2015, 5, 18169. [Google Scholar] [CrossRef]
- Schouten, A.; van Baarlen, P.; van Kan, J.A. Phytotoxic Nep1-like proteins from the necrotrophic fungus Botrytis cinerea associate with membranes and the nucleus of plant cells. New Phytol. 2008, 177, 493–505. [Google Scholar] [CrossRef] [PubMed]
- Qutob, D.; Kemmerling, B.; Brunner, F.; Kufner, I.; Engelhardt, S.; Gust, A.A.; Luberacki, B.; Seitz, H.U.; Stahl, D.; Rauhut, T.; et al. Phytotoxicity and innate immune responses induced by Nep1-like proteins. Plant Cell 2006, 18, 3721–3744. [Google Scholar] [CrossRef]
- Staats, M.; Van Baarlen, P.; Schouten, A.; Van Kan, J.A.L. Functional analysis of NLP genes from Botrytis elliptica. Mol. Plant Pathol. 2007, 8, 209–214. [Google Scholar] [CrossRef] [PubMed]
- Santhanam, P.; van Esse, H.P.; Albert, I.; Faino, L.; Nurnberger, T.; Thomma, B.P.H.J. Evidence for functional diversification within a fungal NEP1-like protein family. Mol. Plant Microbe Interact. 2013, 26, 278–286. [Google Scholar] [CrossRef]
- Arenas, Y.C.; Kalkman, E.R.I.C.; Schouten, A.; Dieho, M.; Vredenbregt, P.; Uwumukiza, B.; Ruiz, M.O.; Van Kan, J.A.L. Functional analysis and mode of action of phytotoxic Nep1-like proteins of Botrytis cinerea. Physiol. Mol. Plant Pathol. 2010, 74, 376–386. [Google Scholar] [CrossRef]
- Guyon, K.; Balagué, C.; Roby, D.; Raffaele, S. Secretome analysis reveals effector candidates associated with broad host range necrotrophy in the fungal plant pathogen Sclerotinia sclerotiorum. BMC Genom. 2014, 15, 336. [Google Scholar] [CrossRef] [PubMed]
- Ren, C.X.; Chen, S.Y.; He, Y.H.; Xu, Y.P.; Yang, J.; Cai, X.Z. Fine-tuning of the dual-role transcription factor WRKY8 via differential phosphorylation for robust broad-spectrum plant immunity. Plant. Commun. 2024, 5, 101072. [Google Scholar] [CrossRef]
- Yang, C.; Li, W.; Huang, X.; Tang, X.; Qin, L.; Liu, Y.; Xia, Y.; Peng, Z.; Xia, S. SsNEP2 contributes to the virulence of Sclerotinia sclerotiorum. Pathogens 2022, 11, 446. [Google Scholar] [CrossRef] [PubMed]
- Zhou, T. Preliminary Studies on Interaction Between Coniothyrium minitans and Sclerotinia sclerotiorum and Botrytis cinerea. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2011. [Google Scholar]
- Li, M.; Gong, X.; Zheng, J.; Jiang, D.; Fu, Y.; Hou, M. Transformation of Coniothyrium minitans, a parasite of Sclerotinia sclerotiorum, with Agrobacterium tumefaciens. FEMS Microbiol. Lett. 2005, 243, 323–329. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.-J.; Kim, B.-D.; Rose, J.K.C. Identification of eukaryotic secreted and cell surface proteins using the yeast secretion trap screen. Nat. Protoc. 2006, 1, 2439–2447. [Google Scholar] [CrossRef] [PubMed]
- Gietz, R.D.; Schiestl, R.H. Large-scale high-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2007, 2, 38–41. [Google Scholar] [CrossRef] [PubMed]
- Weld, R.J.; Eady, C.C.; Ridgway, H.J. Agrobacterium-mediated transformation of Sclerotinia sclerotiorum. J. Microbiol. Methods 2006, 65, 202–207. [Google Scholar] [CrossRef] [PubMed]
- Rollins, J.A. The Sclerotinia sclerotiorum pac1 gene is required for sclerotial development and virulence. Mol. Plant Microbe Interact. 2003, 16, 785–795. [Google Scholar] [CrossRef]
- Qiao, L.; Lan, C.; Capriotti, L.; Ah-Fong, A.; Nino Sanchez, J.; Hamby, R.; Heller, J.; Zhao, H.; Glass, N.L.; Judelson, H.S.; et al. Spray-induced gene silencing for disease control is dependent on the efficiency of pathogen RNA uptake. Plant Biotechnol. J. 2021, 19, 1756–1768. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Jiang, D.; Yi, X.; Fu, Y.; Li, G.; Whipps, J.M. Production, survival and efficacy of Coniothyrium minitans conidia produced in shaken liquid culture. FEMS Microbiol. Lett. 2003, 227, 127–131. [Google Scholar] [CrossRef] [PubMed]
- Gouveia, C.; Santos, R.B.; Paiva-Silva, C.; Buchholz, G.; Malhó, R.; Figueiredo, A. The pathogenicity of Plasmopara viticola: A review of evolutionary dynamics, infection strategies and effector molecules. BMC Plant Biol. 2024, 24, 327. [Google Scholar] [CrossRef]
- Motteram, J.; Kufner, I.; Deller, S.; Brunner, F.; Hammond-Kosack, K.E.; Nurnberger, T.; Rudd, J.J. Molecular characterization and functional analysis of MgNLP, the sole NPP1 domain-containing protein, from the fungal wheat leaf pathogen Mycosphaerella graminicola. Mol. Plant Microbe Interact. 2009, 22, 790–799. [Google Scholar] [CrossRef] [PubMed]
- Seidl, M.F.; Van den Ackerveken, G. Activity and phylogenetics of the broadly occurring family of microbial Nep1-Like proteins. Annu. Rev. Phytopathol. 2019, 57, 367–386. [Google Scholar] [CrossRef]
- Keates, S.E.; Kostman, T.A.; Anderson, J.D.; Bailey, B.A. Altered gene expression in three plant species in response to treatment with Nep1, a fungal protein that causes necrosis. Plant Physiol. 2003, 132, 1610–1622. [Google Scholar] [CrossRef] [PubMed]
- Jones, J.D.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef] [PubMed]
- Oome, S.; Raaymakers, T.M.; Cabral, A.; Samwel, S.; Bohm, H.; Albert, I.; Nurnberger, T.; Van Den Ackerveken, G. Nep1-like proteins from three kingdoms of life act as a microbe-associated molecular pattern in Arabidopsis. Proc. Natl. Acad. Sci. USA 2014, 111, 16955–16960. [Google Scholar] [CrossRef] [PubMed]
- Irieda, H.; Inoue, Y.; Mori, M.; Yamada, K.; Oshikawa, Y.; Saitoh, H.; Uemura, A.; Terauchi, R.; Kitakura, S.; Kosaka, A.; et al. Conserved fungal effector suppresses PAMP-triggered immunity by targeting plant immune kinases. Proc. Natl. Acad. Sci. USA 2019, 116, 496–505. [Google Scholar] [CrossRef]
- Pirc, K.; Hodnik, V.; Snoj, T.; Lenarčič, T.; Caserman, S.; Podobnik, M.; Böhm, H.; Albert, I.; Kotar, A.; Plavec, J.; et al. Nep1-like proteins as a target for plant pathogen control. PLoS Pathog. 2021, 17, e1009477. [Google Scholar] [CrossRef]
- Liu, J.; Nie, J.; Chang, Y.; Huang, L. Nep1-like proteins from Valsa mali differentially regulate pathogen virulence and response to abiotic stresses. J. Fungi 2021, 7, 830. [Google Scholar] [CrossRef]
- Bailey, B.A.; Bae, H.; Strem, M.D.; Antunez de Mayolo, G.; Guiltinan, M.J.; Verica, J.A.; Maximova, S.N.; Bowers, J.H. Developmental expression of stress response genes in Theobroma cacao leaves and their response to Nep1 treatment and a compatible infection by Phytophthora megakarya. Plant Physiol. Biochem. 2005, 43, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Xiang, J.; Cheng, J.; Wei, L.; Li, M.; Wu, J. Functional analysis of the Nep1-like proteins from Plasmopara viticola. Plant Signal. Behav. 2022, 17, e2000791. [Google Scholar] [CrossRef] [PubMed]
- Cabral, A.; Oome, S.; Sander, N.; Kufner, I.; Nurnberger, T.; Van den Ackerveken, G. Nontoxic Nep1-like proteins of the downy mildew pathogen Hyaloperonospora arabidopsidis: Repression of necrosis-inducing activity by a surface-exposed region. Mol. Plant Microbe Interact. 2012, 25, 697–708. [Google Scholar] [CrossRef] [PubMed]
- Lian, J.; Han, H.; Chen, X.; Chen, Q.; Zhao, J.; Li, C. Stemphylium lycopersici Nep1-like Protein (NLP) is a key virulence factor in tomato gray leaf spot disease. J. Fungi 2022, 8, 518. [Google Scholar] [CrossRef] [PubMed]
- Westrick, N.M.; Ranjan, A.; Jain, S.; Grau, C.R.; Smith, D.L.; Kabbage, M. Gene regulation of Sclerotinia sclerotiorum during infection of Glycine max: On the road to pathogenesis. BMC Genom. 2019, 20, 157. [Google Scholar] [CrossRef] [PubMed]
- Rogers, C.W.; Challen, M.P.; Muthumeenakshi, S.; Sreenivasaprasad, S.; Whipps, J.M. Disruption of the Coniothyrium minitans PIF1 DNA helicase gene impairs growth and capacity for sclerotial mycoparasitism. Microbiology 2008, 154, 1628–1636. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Yang, X.; Cui, H.; Cheng, J.; Xie, J.; Jiang, D.; Hsiang, T.; Fu, Y. A HOPS protein, CmVps39, is required for vacuolar morphology, autophagy, growth, conidiogenesis and mycoparasitic functions of Coniothyrium minitans. Environ. Microbiol. 2016, 18, 3785–3797. [Google Scholar] [CrossRef]
- Xu, Y.; Wu, M.; Zhang, J.; Li, G.; Yang, L. Cloning and molecular characterization of CmOxdc3 coding for oxalate decarboxylase in the mycoparasite Coniothyrium minitans. J. Fungi 2022, 8, 1304. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Zhao, H.; Luo, C.; Du, L.; Cheng, J.; Xie, J.; Jiang, D.; Fu, Y. CmAim24 is essential for mitochondrial morphology, conidiogenesis and mycoparasitism in Coniothyrium minitans. Appl. Environ. Microbiol. 2020, 86, e02291-19. [Google Scholar] [CrossRef]
- Luo, C.; Zhao, H.; Yang, X.; Qiang, C.; Cheng, J.; Xie, J.; Chen, T.; Jiang, D.; Fu, Y. Functional analysis of the melanin-associated gene CmMR1 in Coniothyrium minitans. Front. Microbiol. 2018, 9, 2658. [Google Scholar] [CrossRef]
- Dodds, P.N.; Rathjen, J.P. Plant immunity: Towards an integrated view of plant-pathogen interactions. Nat. Rev. Genet. 2010, 11, 539–548. [Google Scholar] [CrossRef] [PubMed]
- Bernoux, M.; Ellis, J.G.; Dodds, P.N. New insights in plant immunity signaling activation. Curr. Opin. Plant Biol. 2011, 14, 512–518. [Google Scholar] [CrossRef]
- Campos, M.L.; Kang, J.-H.; Howe, G.A. Jasmonate-triggered plant immunity. J. Chem. Ecol. 2014, 40, 657–675. [Google Scholar] [CrossRef] [PubMed]
- Lenarčič, T.; Albert, I.; Böhm, H.; Hodnik, V.; Pirc, K.; Zavec, A.B.; Podobnik, M.; Pahovnik, D.; Žagar, E.; Pruitt, R.; et al. Eudicot plant-specific sphingolipids determine host selectivity of microbial NLP cytolysins. Science 2017, 358, 1431–1434. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.-Y.; Zhang, Y.-J.; Chen, X.; Shi, X.-C.; Herrera-Balandrano, D.D.; Liu, F.-Q.; Laborda, P. Biocontrol methods for the management of Sclerotinia sclerotiorum in legumes: A Review. Phytopathology 2024, 114, 1447–1457. [Google Scholar] [CrossRef] [PubMed]







| Primer Name | Sequence (5′ to 3′) | Function |
|---|---|---|
| SsNEP2-EcoRV R | GATATCCCTCGATGTCGTAAATGGCTGC | SsNEP2 sense fragment to construct a silencing vector with EcoRV and ClaI restriction enzyme cleavage sites |
| SsNEP2-ClaI F | CCATCGATATTCTTGAACGGAACATTCGCCT | |
| SsNEP2-SmaI F | TCCCCCGGGCCTCGATGTCGTAAATGGCTGC | SsNEP2 antisense fragment to construct a silencing vector with SmaI and BamHI restriction enzyme cleavage sites |
| SsNEP2-BamHI R | CGGGATCCATTCTTGAACGGAACATTCGCCT | |
| OEssNEP2- SpeI F | ACCTTCAAAGAGCTCACTAGTATGGTTGCCTTTGCCAAATC | The full-length coding sequence of SsNEP2 to construct an overexpressing vector with SpeI and KpnI restriction endonuclease cleavage sites |
| OEssNEP2-KpnI R | GTAGTCCATCCCGGGGGTACCGAAACTACTAGCCTTCACAAAGTTATTCT | |
| RtSsNep1-F | CTTTGGGAAGAGATTTACC | Expression of SsNEP1 in S. sclerotiorum |
| RtSsNep1-R | GTTGAATGGACAGTTAGC | |
| RtSsNep2-F | ATCATTCCTGTGGTCTTAC | Expression of SsNEP2 in S. sclerotiorum |
| RtSsNep2-R | AATCCGTATTCTCAAGCG | |
| CmActin F | GATTGGTATGGGTCAGAA | Expression of actin in C. minitans |
| CmActin R | ATCTGGGTCATCTTCTCA | |
| β-tubulin F | TTGGATTTGCTCCTTTGACCAG | Expression of β-tubulin in S. sclerotiorum |
| β-tubulin R | AGCGGCCATCATGTTCTTAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, H.; Zhu, Z.; Xu, Y.; Wang, H.; Xie, J.; Cheng, J.; Jiang, D.; Fu, Y. SsNEP2 Plays a Role in the Interaction Between Sclerotinia sclerotiorum and Coniothyrium minitans. J. Fungi 2025, 11, 151. https://doi.org/10.3390/jof11020151
Zhao H, Zhu Z, Xu Y, Wang H, Xie J, Cheng J, Jiang D, Fu Y. SsNEP2 Plays a Role in the Interaction Between Sclerotinia sclerotiorum and Coniothyrium minitans. Journal of Fungi. 2025; 11(2):151. https://doi.org/10.3390/jof11020151
Chicago/Turabian StyleZhao, Huizhang, Zihang Zhu, Yueli Xu, Haixuan Wang, Jiatao Xie, Jiasen Cheng, Daohong Jiang, and Yanping Fu. 2025. "SsNEP2 Plays a Role in the Interaction Between Sclerotinia sclerotiorum and Coniothyrium minitans" Journal of Fungi 11, no. 2: 151. https://doi.org/10.3390/jof11020151
APA StyleZhao, H., Zhu, Z., Xu, Y., Wang, H., Xie, J., Cheng, J., Jiang, D., & Fu, Y. (2025). SsNEP2 Plays a Role in the Interaction Between Sclerotinia sclerotiorum and Coniothyrium minitans. Journal of Fungi, 11(2), 151. https://doi.org/10.3390/jof11020151

