Next Article in Journal
The Vacuolar Protein 8 (Vac8) Homolog in Cryptococcus neoformans Impacts Stress Responses and Virulence Traits Through Conserved and Unique Roles
Next Article in Special Issue
Sustained Release of Azoxystrobin from Clay Carriers for the Management of Maize Late Wilt Disease
Previous Article in Journal
Drug Discovery and Repurposing for Coccidioides: A Systematic Review
Previous Article in Special Issue
Baseline Sensitivity and Resistance Detection of Stemphylium lycopersici to Pydiflumetofen
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Wheat DNA Methyltransferase TaMET1 Negatively Regulates Salicylic Acid Biosynthesis to Facilitate Powdery Mildew Susceptibility

College of Life Sciences, Qingdao University, Qingdao 266071, China
*
Author to whom correspondence should be addressed.
J. Fungi 2025, 11(12), 876; https://doi.org/10.3390/jof11120876
Submission received: 17 November 2025 / Revised: 5 December 2025 / Accepted: 9 December 2025 / Published: 10 December 2025
(This article belongs to the Special Issue Plant Fungal Diseases and Crop Protection, 2nd Edition)

Abstract

Powdery mildew disease caused by the obligate biotrophic fungus Blumeria graminis forma specialis tritici (B.g. tritici) severely affects grain yields and end-use quality of bread wheat (Triticum aestivum L.). Uncovering the mechanism underlying the wheat susceptibility to B.g. tritici pathogen could contribute to the wheat breeding against powdery mildew disease. Herein, we revealed that the wheat DNA methyltransferase TaMET1 negatively regulates biosynthesis of defense hormone salicylic acid (SA) to promote powdery mildew susceptibility. Overexpression of TaMET1 compromised wheat resistance against B.g. tritici pathogen, while silencing of TaMET1 led to the SA overaccumulation and enhanced powdery mildew resistance. TaMET1 directly targets the SA biosynthesis activator gene TaSARD1. Decreased DNA methylation, increased histone acetylation, and reduced nucleosome occupancy at TaSARD1 promoter regions were observed in the TaMET1-silenced wheat plants, which is associated with activated TaSARD1 gene transcription. Silencing of the TaSARD1 and TaICS1 genes resulted in attenuated SA biosynthesis and dampened powdery mildew resistance in the TaMET1-silenced wheat plants. These results implied that DNA methyltransferase TaMET1 epigenetically suppresses the SA biosynthesis activator gene TaSARD1 by modulating DNA methylation, histone acetylation and nucleosome occupancy, thereby negatively regulating SA biosynthesis and facilitating the powdery mildew susceptibility.

1. Introduction

Staple crop bread wheat (Triticum aestivum L.) provides about one fifth of dietary energy consumed by humans [1,2]. Increasing demand for wheat grains is driven by the growing global population [1,2]. However, the fungal pathogen Blumeria graminis forma specialis tritici (B.g. tritici) causes powdery mildew and results in 5–50% loss of wheat production [3,4,5]. The obligate biotrophic pathogen B.g. tritici infects wheat aerial organs predominantly via the air-borne conidia and develops the feeding structure, haustorium, to acquire water and nutrients from host cells, and finally forms the microcolony to produce conidia for more infections [3,4,5]. Cultivating wheat varieties with improved powdery mildew resistance is one of the safest and most effective approaches to control the B.g. tritici epidemic [3,4,5]. Disclosing the mechanism underlying the wheat powdery mildew susceptibility could contribute to wheat breeding against the B.g. tritici pathogen.
As an important epigenetic mark, DNA methylation catalyzed by the DNA methyltransferase mainly takes place at the cytosine in the sequence contexts of CG, CHG and CHH (H=A, C and T) [6]. As summarized by prior reviews, DNA methylation could function in concert with histone modifications and chromatin remodeling to repress gene transcription [6]. In the dicot model plant Arabidopsis thaliana, DNA METHYLTRANSFERASE 1 (AtMET1) plays a key role in the DNA methylation essential for plant development and adaptation to biotic and abiotic stresses [7,8,9,10]. For instance, AtMET1 interacts with the Polycomb group protein MEDEA to suppress autonomous endosperm development [9]. Similarly, AtMET1 mediates DNA Methylation to repress light signaling and influences plant regeneration [10]. However, whether and how MET1 regulates wheat disease susceptibility remains unknown.
In this study, we reported that wheat DNA methyltransferase TaMET1 negatively regulates the biosynthesis of the defense hormone salicylic acid (SA) to promote powdery mildew susceptibility. Overexpression of TaMET1 compromised wheat resistance against the B.g. tritici pathogen, while silencing of TaMET1 led to the SA overaccumulation and enhanced powdery mildew resistance. TaMET1 directly targets the SA biosynthesis activator gene TaSARD1. Decreased DNA methylation, increased histone acetylation, and reduced nucleosome occupancy at TaSARD1 gene promoter regions were observed in the TaMET1-silenced wheat plants, which is associated with the activated TaSARD1 transcription. Knockdown of the TaSARD1 and SA biosynthesis gene TaICS1 expression could attenuate the SA biosynthesis and dampen the powdery mildew resistance in the TaMET1-silenced wheat plants. These results implied that the DNA methyltransferase TaMET1 epigenetically suppresses the SA biosynthesis activator gene TaSARD1 by modulating DNA methylation, histone acetylation and nucleosome occupancy, thereby negatively regulating SA biosynthesis and contributing to the powdery mildew susceptibility. These findings revealed the novel link between MET1 and SA biosynthesis in an important monocot crop.

2. Materials and Methods

2.1. Plant and Fungal Materials Maintenance

Seedlings of the powdery mildew-susceptible wheat cultivar Yannong 999 were cultivated in growth chambers under 16 h light, 20 °C/8 h dark, 18 °C cycle. The virulent B.g. tritici was kept on the Yannong 999 seedlings.

2.2. Gene Transcription Rate and Expression Level Measurement

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed as previously described to analyse the accumulation of gene transcripts [11]. The expression level of the TaMET1 gene was analyzed using primer 5′GTCCACGTTCTCCAGTTAC3′/5′CCGATTTTTCTTGATCTTG3′, and the primers for analyzing TaSARD1, TaICS1, TaPR1, TaPR2 and TaEF1 (internal control) genes were derived from a previous study [11]. The transcription rate of the TaSARD1 gene was analyzed by the nuclear run-on assay, as previously described [11].

2.3. Gene Silencing Assay

Fragments of TaMET1 were amplified using primers 5′AAGGAAGTTTAA CTGTGCTTGCTCTGAATGG3′/5′AACCACCACCACCGTCAAATGGTGGACCTGATACC3′, and cloned into the pCa-γbLIC vector create construct BSMV-TaMET1, as described by Yuan et al. [12]. Constructs BSMV-TaSARD1 and BSMV-TaICS1 were derived from a previous study [11]. The barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) assay was performed as described by Yuan et al. [12]. For the Agroinfiltration, about ∼0.7 OD600 of Agrobacteria resuspension in infiltration buffer (10 mM MgCl2, 10 mM MES, pH 5.2 and 0.1 mM acetosyringone) was infiltrated into leaves of Nicotinan benthamiana using a 1-mL needleless syringe.

2.4. Gene Overexpression Assay

For the single-cell transient gene overexpression assay, coding regions of TaMET1-2A, TaMET1-2B and TaMET1-2D were amplified using primers 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGTGAAAAGTCCACGTTC3′/5′GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGCCTGCTGGTGCTTCC3′, 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTGAAAAGTCCACGTTC3′/5′GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGCCTGCTGACGCTTCG3′, 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTGAAAAGTCCACGTTC3′/5′GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGCCTGCTGGCGCTTCG3′ and PCR products were cloned into the pIPKb001 to create the pIPKb001-TaMET1-2A (for OE-TaMET1-2A), pIPKb001-TaMET1-2B (for OE-TaMET1-2B) and pIPKb001-TaMET1-2D (for OE-TaMET1-2D) constructs. The single-cell transient gene overexpression assay was performed as previously described [11]. A 900-psi dip rupture disc was employed to ensure the helium pressure used, and at least bombardments was conducted for each sample.

2.5. Wheat-Powdery Mildew Interaction Analysis

Formation of B.g. tritici haustoria and microcolony was statistically analyzed as previously described to determine the wheat-powdery mildew interaction [11]. For the haustorium index (HI%) calculation, at least 50 B.g. tritici-infected wheat epidermal cells were analyzed per experiment. For the microcolony index (MI%) calculation, at least 1000 B.g. tritici-wheat interaction sites were counted per experiment.

2.6. SA Content Analysis

SA content was analyzed by high-performance liquid chromatography (HPLC) as previously described [11]. The free SA amount was descried as ng mg−1 fresh weight (FW) with reference to the amount of internal standard ortho-anisic acid.

2.7. DNA Methylation Analysis

DNA methylation at TaSARD1 promoter regions was analyzed by bisulfite sequencing. Genomic DNA samples of 0.5 μg, treated with conversion reagents in the kit, were employed as a template for subsequent PCR. Promoter regions of TaSARD1.1-6A, TaSARD1.1-6B, TaSARD1.1-6D, TaSARD1.2-6A, TaSARD1.2-6B and TaSARD1.2-6D were amplified using primers 5′ATAGGTCTACACATGCACCA3′/5′GCAAGCTAGCTCTAGTCTC3′, 5′AGATAGGACTACACATGTAC3′/5′GATTGATTTCAGTGCACGCA3′, 5′TGGTACATAAACTTCGAAGG3′/5′GCTGCAGGCAGCTAGGGAGA3′, 5′CAATTGAAGAAGACGAAAAC3′/5′AGAGAAATCGCTGAAAGTTA3′ and 5′AAGACGAAGATGTTCTCAAC3′/5′AGGAACAAGCTTGGAACAAG3′. The PCR products were cloned into pGEM-T Easy vector and transformed into bacteria Escherichia coli, and more than 25 individual clones for each genotype were sequenced.

2.8. Chromatin Immunoprecipitation Assay and Nucleosomal Occupancy Analysis

The chromatin immunoprecipitation (ChIP) assay analyzing the enrichment of TaMET1-HA protein and histone acetylation mark H3K9ac at TaSARD1 gene promoter regions was conducted as previously described [12]. Briefly, about 300 mg wheat protoplasts or leaves were harvested, and antibodies α-HA (Santa Cruz Biotechnology, Dallas, TX, USA, sc-805) α-H3K14ac (Abcam, Cambridge, UK, ab46984) and α-H3 (Abcam, ab1791) were employed for the ChIP. Relative enrichments of histone acetylation mark H3K9ac were calculated by normalizing the histone acetylation and ChIP with histone H3. Nucleosome occupancy micrococcal nuclease (MNase) assay, analyzing chromatin assembly structure at TaSARD1 promoter regions, was conducted as previously described [11]. Primer sequences for qPCR analyzing TaSARD1 promoter were derived from previous studies [11].

2.9. Statistical Analysis

For the statistical analysis, at least 5 wheat leaves (for the gene expression, nucleosomal occupancy and histone acetylation at gene promoter regions, cuticular wax and SA levels measurement), 300 mg wheat protoplasts (for the analysis of protein enrichment at gene promoter regions), 50 Bgt-infected wheat epidermal cells, and 1000 Bgt–wheat interaction sites were analyzed in one experiment or were randomly chosen for each group. At least three independent experiments were performed for each assay and three technical replicates per assay were analyzed using the Student’s t-test, and the value represents the mean ± standard deviation (n.s. p > 0.05, * 0.01 < p < 0.05, ** p < 0.01, n.s. represents no significant difference). These assays were repeated in three independent biological replicates using dependently prepared samples with similar results.

3. Results

3.1. Homology-Based Identification of Wheat TaMET1 Genes

In this study, we aimed to explore the putative regulation of DNA METHYLTRANSFERASE 1 (MET1) on wheat’s susceptibility to the B.g. tritici pathogen. To this end, we first employed the amino acid sequence of Arabidopsis AtMET1 (At5g49160) as a query to search the reference genome of the hexaploid bread (Triticum aestivum L., AABBDD). TaMET1-2A (TraesCS2A02G235900), TaMET1-2B (TraesCS2B02G260800) and TaMET1-2D (TraesCS2D02G241800) were identified from wheat chromosomes 2A, 2B and 2D as AtMET1 homologs. TaMET1-2A, TaMET1-2B and TaMET1-2D proteins shared more than 55% identity with Arabidopsis AtMET1 (Figure 1A). Phylogenetic analysis validated that wheat TaMET1-6A, TaMET1-6B and TaMET1-6D proteins are wheat close homologs of Arabidopsis AtMET1, mustard BrMET1, tomato SlMET1, Brachypodium BdMET1, maize ZmMET1 and rice OsMET1 (Figure 1B). As shown in Figure 1C, two Cytosine specific DNA methyltransferase replication foci (DNMT1-RFDs) domains, two BAH domains and one C-5 cytosine-specific DNA methylase (DNA_methylase) domain were identified from all TaMET1 proteins. A total of 12 exons and 11 introns exist in the coding regions of TaMET1-2A, TaMET1-2B and TaMET1-2D genomic sequences (Figure 1D).

3.2. Functional Analysis of TaMET1 Genes in the Regulation of Wheat Susceptibility to B.g. tritici

We overexpressed TaMET1-2A, TaMET1-2B and TaMET1-2D genes in the wheat leaf epidermal cells by bombardment, and inoculated on these bombarded wheat leaves with B.g. tritici conidia. Powdery mildew haustorium index (HI%) increased from about 57.6% for the empty vector (OE-EV) control to above 82.7% on wheat cells overexpressing TaMET1-2A, TaMET1-2B, or TaMET1-2D gene (Figure 2A). We silence all endogenous TaMET1 genes in the wheat leaves using BSMV-VIGS. RT-qPCR confirmed that TaMET1 gene expression levels decreased significantly in TaMET1-silenced wheat leaves (Figure 2B). B.g. tritici conidia were inoculated on these BSMV-VIGS wheat leaves, and the formation of B.g. tritici microcolony was statistically analyzed. As shown in Figure 2C, the powdery mildew microcolony index (MI%) decreased from 56.4% for the control (BSMV-γ) wheat leaves to 23.6% for TaMET1-silenced wheat leaves. These results implicated that the TaMET1 gene positively regulates wheat powdery mildew susceptibility. The HPLC assay demonstrated that silencing of TaMET1 gene resulted in the increased SA accumulation level, indicating that TaMET1 negatively regulates the SA accumulation in bread wheat. Consistently, silencing of TaMET1 resulted in the enhanced expression levels of SA signaling marker genes TaPR1 and TaPR2 (Figure 2E). These results suggested that TaMET1 suppresses SA biosynthesis and positively regulates wheat susceptibility to B.g. tritici pathogen.

3.3. Epigenetic Regulation of SA Biosynthesis Activator Gene TaSARD1 by TaMET1

Accumulating studies revealed that SA biosynthesis activator gene TaSARD1 is regulated by epigenetic events [11,13,14,15]. We ask whether the DNA methyltransferase TaMET1 could target TaSARD1 gene. To this end, we expressed the TaMET1-HA fusion protein in the wheat protoplasts and performed a ChIP assay to characterize the enrichment of TaMET1-HA proteins at TaSARD1 promoters (Figure 3). TaSARD1 promoter regions regulated by epigenetic events like histone acetylation and chromatin assembly were chosen for the ChIP analysis. As shown in Figure 3, these TaSARD1 promoter regions were found to be enriched in DNA samples co immuno-precipitated with TaMET1-HA protein, indicating that DNA methyltransferase TaMET1 could enrich at promoter regions of the TaSARD1 genes.
To examine whether DNA methyltransferase TaMET1 affects DNA methylation, histone acetylation and nucleosome occupancy at TaSARD1 promoter regions, we conducted the bisulfite sequencing, chromatin immunoprecipitation (ChIP), nucleosome occupancy micrococcal nuclease (MNase) assay to analyze the chromatin state at promoter regions of the TaSARD1 genes. As shown in Figure 4, silencing of the TaMET1 gene resulted in significantly reduced DNA methylation in the context of CG, CHG and CHH (H = A, C and T), at TaSARD1 promoters. Similarly, the levels of histone acetylation H3K9ac at the TaSARD1 promoter regions were significantly enhanced in the wheat leaves silencing TaMET1 gene, compared with the BSMV-γ control (Figure 5A). As shown in Figure 5B, silencing of the TaMET1 gene led to significantly reduced nucleosome occupancy at TaSARD1 promoters. Nuclear run-on and RT-qPCR assays demonstrated that silencing of the TaMET1 gene led to a significantly increased transcription rate and transcript accumulation of the TaSARD1 gene (Figure 5C,D). These results suggested that the DNA methyltransferase TaMET1 negatively regulates TaSARD1 gene transcription by modulating DNA methylation, histone acetylation and nucleosome occupancy.

3.4. Functional Analysis of TaSARD1-TaICS1-SA Circuit in the TaMET1-Governed Wheat Powdery Mildew Susceptibility

We ask whether TaSARD1 gene gets involved in the TaMET1-governed wheat powdery mildew susceptibility. To examine this hypothesis, we conducted the BSMV-VIGS assay to simultaneously silence TaMET1 and TaSARD1 genes in the wheat leaves, and found that expression levels of TaMET1 or TaSARD1 gene significantly decreased in TaMET1 and TaSARD1 co-silenced wheat leaves (Figure 6A). Simultaneous silencing of TaMET1 and TaSARD1 genes resulted in the microcolony index (MI%) increased to above 78.7% from 55.2% for the BSMV-γ control wheat leaves (Figure 6B). SA accumulation level significantly decreased in TaMET1 and TaSARD1 co-silenced wheat leaves, compared with the BSMV-γ control wheat leaves (Figure 6C). Consistently, simultaneous silencing of TaMET1 and TaSARD1 genes resulted in a significant reduction in expression levels of TaPR1 and TaPR2 genes, compared with the BSMV-γ control (Figure 6D). These data collectively suggested that the DNA methyltransferase TaMET1 negatively regulated SA biosynthesis by epigenetically suppressing the TaSARD1 gene, thereby facilitating the wheat susceptibility to B.g. tritici pathogen.
We ask whether TaICS1 gene encoding a core component of wheat SA biosynthetic machinery gets involved in the TaMET1-governed wheat powdery mildew susceptibility [11,13,14,15]. To examine this hypothesis, we conducted the BSMV-VIGS assay to simultaneously silence TaMET1 and TaICS1 genes in the wheat leaves, and found that expression levels of TaMET1 or TaICS1 gene significantly decreased in TaMET1 and TaICS1 co-silenced wheat leaves (Figure 7A). Simultaneous silencing of TaMET1 and TaICS1 genes resulted in the significantly increased microcolony index (MI%) (Figure 7B). SA accumulation level significantly decreased in TaMET1 and TaICS1 co-silenced wheat leaves, compared with the BSMV-γ control wheat leaves (Figure 7C). Consistently, simultaneous silencing of TaMET1 and TaICS1 genes resulted in a significant reduction in expression levels of TaPR1 and TaPR2 genes, compared with the BSMV-γ control (Figure 7D). These results collectively implicated DNA methyltransferase TaMET1 epigenetically suppresses SA biosynthesis activator gene TaSARD1, thereby negatively regulating SA biosynthesis and facilitating the compatible wheat-powdery mildew interaction.

4. Discussion

4.1. The DNA Methyltransferase TaMET1 Facilitates the Wheat Powdery Mildew Susceptibility

In this study, TaMET1-2A, TaMET1-2B and TaMET1-2D separately located on wheat chromosomes 2A, 2B and 2D were identified as AtMET1 homologs in the hexaploid bread (Triticum aestivum L., AABBDD). Transient overexpression of TaMET1-2A, TaMET1-2B and TaMET1-2D in wheat epidermal cells led to the increased haustorium index (HI%), whereas silencing of TaMET1 resulted in the decreased microcolony index (MI%), suggesting that the DNA methyltransferase TaMET1 positively regulates wheat powdery mildew susceptibility and facilitates the B.g. tritici post-penetration events haustorial development and microcolony formation. Histone modifiers and chromatin remodeling factors have been characterized to regulate wheat powdery mildew susceptibility. For instance, histone deacetylase TaHDA6 positively regulates wheat powdery mildew susceptibility, while wheat histone acetyltransferase TaHAG1 negatively regulates wheat powdery mildew susceptibility [16,17]. Similarly, wheat chromatin remodeling protein TaSWP73 facilitates the wheat susceptibility to B.g. tritici pathogen [13]. These findings implicated that wheat susceptibility to powdery mildew pathogen is governed by DNA methylation, histone (de)acetylation and chromatin remodeling.

4.2. The DNA Methyltransferase TaMET1 Epigenetically Suppresses SA Biosynthesis

Accumulating evidence revealed that defense-related hormone SA plays a key role in wheat powdery mildew resistance [11,13,14,15]. In this study, we demonstrated that DNA methyltransferase TaMET1 enriches at promoter regions of the TaSARD1, activator gene of wheat SA biosynthesis, and negatively regulates TaSARD1 gene transcription by modulating DNA methylation, histone acetylation and nucleosome occupancy. SA overaccumulation and activation of defense marker genes TaPR1 and TaPR2 were observed in the TaMET1-silenced wheat plants. Notably, silencing of TaSARD1 and the SA biosynthesis gene TaICS1 could attenuate the SA biosynthesis and powdery mildew resistance potentiated in the TaMET1-silenced wheat plants. These results suggested that DNA methyltransferase TaMET1 epigenetically suppresses SA biosynthesis activator gene TaSARD1, thereby negatively regulating SA biosynthesis and facilitating the compatible wheat-powdery mildew interaction. These results allow us to propose a model of how DNA methyltransferase TaMET1 regulates wheat powdery mildew susceptibility. In this model, wheat DNA methyltransferase TaMET1 directly targets the SA biosynthesis activator gene TaSARD1 to promote DNA methylation, and epigenetically suppress TaSARD1 gene transcription. Consequently, SA biosynthesis gene TaICS1 expression and SA biosynthesis is maintained at a resting state, facilitating the wheat powdery mildew susceptibility. In the absence of DNA methyltransferase TaMET1, decreased DNA methylation, increased histone acetylation and reduced nucleosome occupancy were observed at TaSARD1 promoter regions, which is associated with activated TaSARD1 gene transcription. Consequently, SA biosynthesis gene TaICS1 expression and SA biosynthesis is activated, attenuating the wheat powdery mildew susceptibility.
Wheat chromatin assembly factor TaSWP73 and chromatin assembly factor CAF-1 were previously demonstrated to suppress TaSARD1 gene transcription by enhancing nucleosome occupancy [11,13]. For the first time, this study revealed that DNA methylation governed by TaMET1 gets involved in the epigenetic suppression of TaSARD1 gene. Therefore, it is intriguing to examine the potential interplay among epigenetic regulators TaMET1, TaSWP73 and CAF-1 in the regulation of SA biosynthesis and wheat powdery mildew susceptibility. In the dicot model plant Arabidopsis, AtMET1 interacts with the histone deacetylase AtHDA6 to maintain transposable element silencing [8]. Interestingly, our previous studies demonstrated that wheat histone deacetylase TaHDA6, resembling TaMET1, negatively regulates expression of SA marker genes TaPR1 and TaPR2, and facilitates the wheat susceptibility to B.g. tritici pathogen [16]. Examine the potential interaction between TaHDA6 and TaMET1 and analyzing the potential regulation of TaHDA6 on the TaSARD1 gene transcription might shed novel light into the epigenetic regulation of wheat SA biosynthesis. In addition, the potential epigenetic impact of TaMET1 on the other defense-related genes and SA-independent immunity remains to be explored in future research.

4.3. Potentials of Exploiting Susceptibility Gene TaMET1 in Wheat Breeding Against Powdery Mildew Disease

Herein, DNA methyltransferase gene TaMET1 was characterized as a new Susceptibility (S) gene contributing to the wheat powdery mildew susceptibility. Overexpression of TaMET1-2A, TaMET1-2B, or TaMET1-2D in wheat epidermal cells led to increased powdery mildew susceptibility, whereas silencing of TaMET1 genes resulted in SA overaccumulation and decreased powdery mildew susceptibility. Notably, we demonstrated that DNA methyltransferase TaMET1 directly target the SA biosynthesis activator gene TaSARD1 and negatively regulates TaSARD1 gene transcription by modulating DNA methylation, histone acetylation and nucleosome occupancy, suggesting that DNA methyltransferase TaMET1 epigenetically suppresses SA biosynthesis activator gene TaSARD1, thereby negatively regulating SA biosynthesis and facilitating the compatible wheat-powdery mildew interaction. For the first time, this study identified the DNA methyltransferase gene as an S gene governing plant susceptibility to pathogens.
Previous studies have identified multiple susceptibility (S) genes contributing to the wheat powdery mildew susceptibility [18,19,20,21,22]. Manipulation of S genes by genome editing techniques could enhance wheat disease resistance [23,24,25,26,27,28,29,30,31,32,33,34]. For instance, genome editing of wheat S genes TaMLO and TaEDR1 by CRISPR-Cas9 and TALENs conferred wheat powdery mildew resistance [26,27,34]. Therefore, exploiting the S gene TaMET1 by CRISPR-Cas9, TALENs, or TILLING techniques might represent a new direction for the wheat breeding against powdery mildew resistance. In Arabidopsis, AtMET1 regulates multiple development events and play important roles in maintaining genome integrity. Therefore, the potential pleiotropic effects of TaMET1 gene on other important agronomic traits, as well as the possible trade-offs for deploying TaMET1-based resistance, should be carefully analyzed before its exploitation in wheat breeding. In addition, epigenetic plasticity regulated by wheat TaMET1 under biotic and abiotic stresses remains to be dissected in future research.

5. Conclusions

In this study, we reported that wheat DNA methyltransferase TaMET1 negatively regulates SA biosynthesis to promote powdery mildew susceptibility. Overexpression of TaMET1 resulted in the enhanced wheat susceptibility to B.g. tritici, while silencing of TaMET1 led to the SA overaccumulation and enhanced powdery mildew resistance. TaMET1 directly targets the SA biosynthesis activator gene TaSARD1. Decreased DNA methylation, increased histone acetylation, and reduced nucleosome occupancy at TaSARD1 promoter regions were observed in the TaMET1-silenced wheat plants, which is associated with the activated TaSARD1 transcription. Knockdown of TaSARD1 and SA biosynthesis gene TaICS1 expression could attenuate the SA biosynthesis and dampen the powdery mildew resistance in the TaMET1-silenced wheat plants. These results implicated that the DNA methyltransferase TaMET1 epigenetically suppresses the SA biosynthesis activator gene TaSARD1 by modulating DNA methylation, histone acetylation and nucleosome occupancy, thereby negatively regulating SA biosynthesis and contributing to the powdery mildew susceptibility. These findings elucidate the novel regulation of DNA methyltransferase MET1 on the molecular plant-fungal pathogen interaction and provide valuable information for genetic improvement of bread wheat against powdery mildew disease.

Author Contributions

Conceptualization, P.G., W.C., J.L., X.W. and C.C.; methodology, P.G., W.C., J.L. and X.W.; validation, P.G., W.C., J.L. and X.W.; investigation, P.G., W.C., J.L. and X.W.; resources, C.C.; data curation, P.G., W.C., J.L. and X.W.; writing—original draft preparation, P.G., W.C., J.L. and X.W.; writing—review and editing, C.C.; visualization, P.G., W.C., J.L., X.W. and C.C.; supervision, C.C.; project administration, C.C.; funding acquisition, C.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Shandong Provincial Natural Science Foundation, grant number ZR2022MC008 and ZR2017BC109; Qingdao Science and Technology Bureau Fund, grant number 17-1-1-50-jch; and the Qingdao University Fund, grant number DC1900005385.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Levy, A.A.; Feldman, M. Evolution and origin of bread wheat. Plant Cell 2022, 34, 2549–2567. [Google Scholar] [CrossRef]
  2. Lee, R. The outlook for population growth. Science 2011, 333, 569–573. [Google Scholar] [CrossRef]
  3. Savary, S.; Willocquet, L.; Pethybridge, S.J.; Esker, P.; McRoberts, N.; Nelson, A. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 2019, 3, 430–439. [Google Scholar] [CrossRef] [PubMed]
  4. Kusch, S.; Qian, J.; Loos, A.; Kümmel, F.; Spanu, P.D.; Panstruga, R. Long-term and rapid evolution in powdery mildew fungi. Mol. Ecol. 33, e16909. [CrossRef] [PubMed]
  5. Mapuranga, J.; Chang, J.; Yang, W. Combating powdery mildew: Advances in molecular interactions between Blumeria graminis f.sp. tritici and wheat. Front. Plant Sci. 2022, 13, 1102908. [Google Scholar] [CrossRef]
  6. Henderson, I.R.; Jacobsen, S.E. Epigenetic inheritance in plants. Nature 2007, 447, 418–424. [Google Scholar] [CrossRef]
  7. Srikant, T.; Yuan, W.; Berendzen, K.W.; Contreras-Garrido, A.; Drost, H.G.; Schwab, R.; Weigel, D. Canalization of genome-wide transcriptional activity in Arabidopsis thaliana accessions by MET1-dependent CG methylation. Genome Biol. 2022, 23, 263. [Google Scholar] [CrossRef]
  8. Liu, X.; Yu, C.W.; Duan, J.; Luo, M.; Wang, K.; Tian, G.; Cui, Y.; Wu, K. HDA6 directly interacts with DNA methyltransferase MET1 and maintains transposable element silencing in Arabidopsis. Plant Physiol. 2012, 158, 119–129. [Google Scholar] [CrossRef]
  9. Schmidt, A.; Wöhrmann, H.J.; Raissig, M.T.; Arand, J.; Gheyselinck, J.; Gagliardini, V.; Heichinger, C.; Walter, J.; Grossniklaus, U. The Polycomb group protein MEDEA and the DNA methyltransferase MET1 interact to repress autonomous endosperm development in Arabidopsis. Plant J. 2013, 73, 776–787. [Google Scholar] [CrossRef]
  10. Shim, S.; Lee, H.G.; Seo, P.J. MET1-Dependent DNA Methylation Represses Light Signaling and Influences Plant Regeneration in Arabidopsis. Mol. Cells 2021, 44, 746–757. [Google Scholar] [CrossRef]
  11. Liu, L.; Yang, Z.; Wang, X.; Chen, W.; Fu, Y.; Zhi, P.; Chang, C. Wheat chromatin assembly factor-1 negatively regulates the biosynthesis of cuticular wax and salicylic acid to fine-tune powdery mildew susceptibility. J. Agric. Food Chem. 2025, 73, 21786–21802. [Google Scholar] [CrossRef]
  12. Yuan, C.; Li, C.; Yan, L.; Jackson, A.O.; Liu, Z.; Han, C.; Yu, J.; Li, D. A high throughput barley stripe mosaic virus vector for virus induced gene silencing in monocots and dicots. PLoS ONE 2011, 6, e26468. [Google Scholar] [CrossRef]
  13. Fu, Y.; Yang, Z.; Liu, J.; Wang, X.; Li, H.; Zhi, P.; Chang, C. Wheat chromatin remodeling protein TaSWP73 contributes to compatible wheat-powdery mildew interaction. Int. J. Mol. Sci. 2025, 26, 2590. [Google Scholar] [CrossRef] [PubMed]
  14. Tian, H.; Xu, L.; Li, X.; Zhang, Y. Salicylic acid: The roles in plant immunity and crosstalk with other hormones. J. Integr. Plant Biol. 2025, 67, 773–785. [Google Scholar] [CrossRef]
  15. Zhang, Y.Z.; Man, J.; Xu, D.; Wen, L.; Li, Y.H.; Deng, M.; Jiang, Q.T.; Xu, Q.; Chen, G.Y.; Wei, Y.M. Investigating the mechanisms of isochorismate synthase: An approach to improve salicylic acid synthesis and increase resistance to Fusarium head blight in wheat. Crop J. 2024, 12, 1054–1063. [Google Scholar] [CrossRef]
  16. Liu, J.; Zhi, P.; Wang, X.; Fan, Q.; Chang, C. Wheat WD40-repeat protein TaHOS15 functions in a histone deacetylase complex to fine-tune defense responses to Blumeria graminis f.sp. tritici. J. Exp. Bot. 2019, 70, 255–268. [Google Scholar] [CrossRef] [PubMed]
  17. Song, N.; Lin, J.; Liu, X.; Liu, Z.; Liu, D.; Chu, W.; Li, J.; Chen, Y.; Chang, S.; Yang, Q.; et al. Histone acetyltransferase TaHAG1 interacts with TaPLATZ5 to activate TaPAD4 expression and positively contributes to powdery mildew resistance in wheat. New Phytol. 2022, 236, 590–607. [Google Scholar] [CrossRef]
  18. Jiang, J.; Zhao, J.; Duan, W.; Tian, S.; Wang, X.; Zhuang, H.; Fu, J.; Kang, Z. TaAMT2;3a, a wheat AMT2-type ammonium transporter, facilitates the infection of stripe rust fungus on wheat. BMC Plant Biol. 2019, 19, 239. [Google Scholar] [CrossRef]
  19. Moore, J.W.; Herrera-Foessel, S.; Lan, C.; Schnippenkoetter, W.; Ayliffe, M.; Huerta-Espino, J.; Lillemo, M.; Viccars, L.; Milne, R.; Periyannan, S.; et al. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat. Genet. 2015, 47, 1494–1498. [Google Scholar] [CrossRef]
  20. Huai, B.; Yang, Q.; Qian, Y.; Qian, W.; Kang, Z.; Liu, J. ABA-induced sugar transporter TaSTP6 promotes wheat susceptibility to stripe rust. Plant Physiol. 2019, 181, 1328–1343. [Google Scholar] [CrossRef]
  21. Huai, B.; Yang, Q.; Wei, X.; Pan, Q.; Kang, Z.; Liu, J. TaSTP13 contributes to wheat susceptibility to stripe rust possibly by increasing cytoplasmic hexose concentration. BMC Plant Biol. 2020, 20, 49. [Google Scholar] [CrossRef]
  22. Huai, B.; Yuan, P.; Ma, X.; Zhang, X.; Jiang, L.; Zheng, P.; Yao, M.; Chen, Z.; Chen, L.; Shen, Q.; et al. Sugar transporter TaSTP3 activation by TaWRKY19/61/82 enhances stripe rust susceptibility in wheat. New Phytol. 2022, 236, 266–282. [Google Scholar]
  23. Zaidi, S.S.; Mukhtar, M.S.; Mansoor, S. Editing: Targeting susceptibility genes for plant disease resistance. Trends Biotechnol. 2018, 36, 898–906. [Google Scholar] [CrossRef]
  24. van Schie, C.C.; Takken, F.L. Susceptibility genes 101: How to be a good host. Annu. Rev. Phytopathol. 2014, 52, 551–581. [Google Scholar] [CrossRef]
  25. Koseoglou, E.; van der Wolf, J.M.; Visser, R.; Bai, Y. Susceptibility reversed: Modified plant susceptibility genes for resistance to bacteria. Trends Plant Sci. 2022, 27, 69–79. [Google Scholar] [CrossRef] [PubMed]
  26. Li, S.; Lin, D.; Zhang, Y.; Deng, M.; Chen, Y.; Lv, B.; Li, B.; Lei, Y.; Wang, Y.; Zhao, L.; et al. Genome-edited powdery mildew resistance in wheat without growth penalties. Nature 2022, 602, 455–460. [Google Scholar] [CrossRef] [PubMed]
  27. Zhang, Y.; Bai, Y.; Wu, G.; Zou, S.; Chen, Y.; Gao, C.; Tang, D. Simultaneous modification of three homoeologs of TaEDR1 by genome editing enhances powdery mildew resistance in wheat. Plant J. 2017, 91, 714–724. [Google Scholar] [CrossRef] [PubMed]
  28. McCallum, C.M.; Comai, L.; Greene, E.A.; Henikoff, S. Targeting induced local lesions IN genomes (TILLING) for plant functional genomics. Plant Physiol. 2000, 123, 439–442. [Google Scholar] [CrossRef]
  29. Kurowska, M.; Daszkowska-Golec, A.; Gruszka, D.; Marzec, M.; Szurman, M.; Szarejko, I.; Maluszynski, M. TILLING: A shortcut in functional genomics. J. Appl. Genet. 2011, 52, 371–390. [Google Scholar] [CrossRef]
  30. Chen, L.; Hao, L.; Parry, M.A.; Phillips, A.L.; Hu, Y.G. Progress in TILLING as a tool for functional genomics and improvement of crops. J. Integr. Plant Biol. 2014, 56, 425–443. [Google Scholar] [CrossRef]
  31. Yin, K.; Qiu, J.L. Genome editing for plant disease resistance: Applications and perspectives. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2019, 374, 20180322. [Google Scholar] [CrossRef] [PubMed]
  32. Zhu, H.; Li, C.; Gao, C. Applications of CRISPR-Cas in agriculture and plant biotechnology. Nat. Rev. Mol. Cell Biol. 2020, 21, 661–677. [Google Scholar] [CrossRef]
  33. Schenke, D.; Cai, D. Applications of CRISPR/Cas to improve crop disease resistance: Beyond inactivation of susceptibility factors. iScience 2020, 23, 101478. [Google Scholar] [CrossRef] [PubMed]
  34. Wang, Y.; Cheng, X.; Shan, Q.; Zhang, Y.; Liu, J.; Gao, C.; Qiu, J.L. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat. Biotechnol. 2014, 32, 947–951. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Analysis of wheat TaMET1 sequence and domains. (A) Protein sequence alignments of Arabidopsis AtMET1, wheat TaMET1-2A, TaMET1-2B and TaMET1-2D. (B) Phylogenetic relationships of the MET1 proteins from Arabidopsis, mustard, tomato. (C) Domain arrangement of wheat TaMET1-2A, TaMET1-2B and TaMET1-2D proteins. (D) Exon and intron arrangement of wheat TaMET1-2A, TaMET1-2B and TaMET1-2D genes.
Figure 1. Analysis of wheat TaMET1 sequence and domains. (A) Protein sequence alignments of Arabidopsis AtMET1, wheat TaMET1-2A, TaMET1-2B and TaMET1-2D. (B) Phylogenetic relationships of the MET1 proteins from Arabidopsis, mustard, tomato. (C) Domain arrangement of wheat TaMET1-2A, TaMET1-2B and TaMET1-2D proteins. (D) Exon and intron arrangement of wheat TaMET1-2A, TaMET1-2B and TaMET1-2D genes.
Jof 11 00876 g001
Figure 2. Functional analysis of TaMET1 gene in the regulation of compatible wheat-powdery mildew interaction. (A) Statistical analysis of powdery mildew haustorial formation in wheat epidermal cells transiently overexpressing TaMET1. Empty vector (OE-EV) was employed as control and at least 50 B.g. tritici-infected wheat epidermal cells were analyzed per experiment (B) RT-qPCR analysis of TaMET1 transcript accumulation in the wheat leaves silencing TaMET1. (C) Statistical analysis of powdery mildew microcolony formation on wheat leaves silencing TaMET1. (D) Measurement of SA content in the wheat leaves silencing TaMET1. (E) RT-qPCR analysis of TaPR1 and TaPR2 transcript accumulation in the wheat leaves silencing TaMET1. For (BE), leaves of wheat plants infected with BSMV-γ were employed as the negative control. For (AE), three technical replicates per treatment were statistically analyzed and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Figure 2. Functional analysis of TaMET1 gene in the regulation of compatible wheat-powdery mildew interaction. (A) Statistical analysis of powdery mildew haustorial formation in wheat epidermal cells transiently overexpressing TaMET1. Empty vector (OE-EV) was employed as control and at least 50 B.g. tritici-infected wheat epidermal cells were analyzed per experiment (B) RT-qPCR analysis of TaMET1 transcript accumulation in the wheat leaves silencing TaMET1. (C) Statistical analysis of powdery mildew microcolony formation on wheat leaves silencing TaMET1. (D) Measurement of SA content in the wheat leaves silencing TaMET1. (E) RT-qPCR analysis of TaPR1 and TaPR2 transcript accumulation in the wheat leaves silencing TaMET1. For (BE), leaves of wheat plants infected with BSMV-γ were employed as the negative control. For (AE), three technical replicates per treatment were statistically analyzed and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Jof 11 00876 g002
Figure 3. Analysis of the TaMET1 enrichment at TaSARD1 promoters. ChIP-qPCR analysis of TaMET1-HA enrichment at TaSARD1 promoter regions in the wheat cells. RNAi-TaMET1 was employed as control. Three technical replicates per treatment were statistically analyzed, and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Figure 3. Analysis of the TaMET1 enrichment at TaSARD1 promoters. ChIP-qPCR analysis of TaMET1-HA enrichment at TaSARD1 promoter regions in the wheat cells. RNAi-TaMET1 was employed as control. Three technical replicates per treatment were statistically analyzed, and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Jof 11 00876 g003
Figure 4. Cytosine methylation analysis of TaSARD1 loci in TaMET1-silenced wheat leaves. Bisulfite sequencing analysis of TaSARD1 loci in TaMET1-silenced wheat leaves. The percentage cytosine methylation is indicated for each genotype, as determined at CG (A), CHG (B) and CHH (C) sites for at least 50 clones. H represents A, T, or C. Leaves of wheat plants infected with BSMV-TaMET1 were employed as the negative control.
Figure 4. Cytosine methylation analysis of TaSARD1 loci in TaMET1-silenced wheat leaves. Bisulfite sequencing analysis of TaSARD1 loci in TaMET1-silenced wheat leaves. The percentage cytosine methylation is indicated for each genotype, as determined at CG (A), CHG (B) and CHH (C) sites for at least 50 clones. H represents A, T, or C. Leaves of wheat plants infected with BSMV-TaMET1 were employed as the negative control.
Jof 11 00876 g004
Figure 5. Characterization of histone acetylation, nucleosomal occupancy and gene transcription at TaSARD1 loci in TaMET1-silenced wheat leaves. (A) ChIP-qPCR analysis of the H3K9ac abundance at TaSARD1 promoter regions in the TaMET1-silenced wheat leaves. (B) MNase analysis of nucleosome occupancy at TaSARD1 promoters in the TaMET1-silenced wheat leaves. The nucleosome occupancy levels in wheat leaves infected with the BSMV-γ empty vector were set to 1.0. Transcription rates (B) and expression levels (C) of TaSARD1 gene in the TaMET1-silenced wheat leaves were measured by nuclear run-on and RT-qPCR assays, respectively. For (AD), leaves of wheat plants infected with BSMV-γ were employed as the negative control, and three technical replicates per treatment were statistically analyzed and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Figure 5. Characterization of histone acetylation, nucleosomal occupancy and gene transcription at TaSARD1 loci in TaMET1-silenced wheat leaves. (A) ChIP-qPCR analysis of the H3K9ac abundance at TaSARD1 promoter regions in the TaMET1-silenced wheat leaves. (B) MNase analysis of nucleosome occupancy at TaSARD1 promoters in the TaMET1-silenced wheat leaves. The nucleosome occupancy levels in wheat leaves infected with the BSMV-γ empty vector were set to 1.0. Transcription rates (B) and expression levels (C) of TaSARD1 gene in the TaMET1-silenced wheat leaves were measured by nuclear run-on and RT-qPCR assays, respectively. For (AD), leaves of wheat plants infected with BSMV-γ were employed as the negative control, and three technical replicates per treatment were statistically analyzed and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Jof 11 00876 g005
Figure 6. Characterization of genetic interplay of TaMET1 and TaSARD1 in the regulation of compatible wheat-powdery mildew interaction. (A) RT-qPCR analysis of TaMET1 and TaSARD1 transcript accumulation in the wheat leaves silencing TaMET1, TaSARD1, or co-silencing TaMET1 and TaSARD1. (B) Statistical analysis of powdery mildew microcolony formation on wheat leaves silencing TaMET1, TaSARD1, or co-silencing TaMET1 and TaSARD1. (C) Measurement of SA content in the wheat leaves silencing TaMET1, TaSARD1, or co-silencing TaMET1 and TaSARD1. (D) RT-qPCR analysis of TaPR1 and TaPR2 transcript accumulation in the wheat leaves wheat leaves silencing TaMET1, TaSARD1, or co-silencing TaMET1 and TaSARD1. For (AD), leaves of wheat plants infected with BSMV-γ were employed as the negative control, and three technical replicates per treatment were statistically analyzed and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Figure 6. Characterization of genetic interplay of TaMET1 and TaSARD1 in the regulation of compatible wheat-powdery mildew interaction. (A) RT-qPCR analysis of TaMET1 and TaSARD1 transcript accumulation in the wheat leaves silencing TaMET1, TaSARD1, or co-silencing TaMET1 and TaSARD1. (B) Statistical analysis of powdery mildew microcolony formation on wheat leaves silencing TaMET1, TaSARD1, or co-silencing TaMET1 and TaSARD1. (C) Measurement of SA content in the wheat leaves silencing TaMET1, TaSARD1, or co-silencing TaMET1 and TaSARD1. (D) RT-qPCR analysis of TaPR1 and TaPR2 transcript accumulation in the wheat leaves wheat leaves silencing TaMET1, TaSARD1, or co-silencing TaMET1 and TaSARD1. For (AD), leaves of wheat plants infected with BSMV-γ were employed as the negative control, and three technical replicates per treatment were statistically analyzed and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Jof 11 00876 g006
Figure 7. Characterization of genetic interplay of TaMET1 and TaICS1 in the regulation of compatible wheat-powdery mildew interaction. (A) RT-qPCR analysis of TaMET1 and TaICS1 transcript accumulation in the wheat leaves silencing TaMET1, TaICS1, or co-silencing TaMET1 and TaICS1. (B) Statistical analysis of powdery mildew microcolony formation on wheat leaves silencing TaMET1, TaICS1, or co-silencing TaMET1 and TaICS1. (C) Measurement of SA content in the wheat leaves silencing TaMET1, TaICS1, or co-silencing TaMET1 and TaICS1. (D) RT-qPCR analysis of TaPR1 and TaPR2 transcript accumulation in the wheat leaves wheat leaves silencing TaMET1, TaICS1, or co-silencing TaMET1 and TaICS1. For (AD), leaves of wheat plants infected with BSMV-γ were employed as the negative control, and three technical replicates per treatment were statistically analyzed and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Figure 7. Characterization of genetic interplay of TaMET1 and TaICS1 in the regulation of compatible wheat-powdery mildew interaction. (A) RT-qPCR analysis of TaMET1 and TaICS1 transcript accumulation in the wheat leaves silencing TaMET1, TaICS1, or co-silencing TaMET1 and TaICS1. (B) Statistical analysis of powdery mildew microcolony formation on wheat leaves silencing TaMET1, TaICS1, or co-silencing TaMET1 and TaICS1. (C) Measurement of SA content in the wheat leaves silencing TaMET1, TaICS1, or co-silencing TaMET1 and TaICS1. (D) RT-qPCR analysis of TaPR1 and TaPR2 transcript accumulation in the wheat leaves wheat leaves silencing TaMET1, TaICS1, or co-silencing TaMET1 and TaICS1. For (AD), leaves of wheat plants infected with BSMV-γ were employed as the negative control, and three technical replicates per treatment were statistically analyzed and data are presented as the mean ± SE (Student’s t-test; ** p < 0.01), and these assays were repeated in three independent biological replicates with similar results.
Jof 11 00876 g007
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ge, P.; Chen, W.; Liu, J.; Wang, X.; Chang, C. Wheat DNA Methyltransferase TaMET1 Negatively Regulates Salicylic Acid Biosynthesis to Facilitate Powdery Mildew Susceptibility. J. Fungi 2025, 11, 876. https://doi.org/10.3390/jof11120876

AMA Style

Ge P, Chen W, Liu J, Wang X, Chang C. Wheat DNA Methyltransferase TaMET1 Negatively Regulates Salicylic Acid Biosynthesis to Facilitate Powdery Mildew Susceptibility. Journal of Fungi. 2025; 11(12):876. https://doi.org/10.3390/jof11120876

Chicago/Turabian Style

Ge, Pengkun, Wanzhen Chen, Jiao Liu, Xiaoyu Wang, and Cheng Chang. 2025. "Wheat DNA Methyltransferase TaMET1 Negatively Regulates Salicylic Acid Biosynthesis to Facilitate Powdery Mildew Susceptibility" Journal of Fungi 11, no. 12: 876. https://doi.org/10.3390/jof11120876

APA Style

Ge, P., Chen, W., Liu, J., Wang, X., & Chang, C. (2025). Wheat DNA Methyltransferase TaMET1 Negatively Regulates Salicylic Acid Biosynthesis to Facilitate Powdery Mildew Susceptibility. Journal of Fungi, 11(12), 876. https://doi.org/10.3390/jof11120876

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop