Next Article in Journal
Aspergillus Endocarditis in Native Valves in Non-Traditional Hosts: A Systematic Review of a Case in a Patient with CREST Syndrome and Advanced Liver Cirrhosis
Previous Article in Journal
Global Diversity, Host Associations, and New Insights into Aigialaceae, Astrosphaeriellaceae, and Pseudoastrosphaeriellaceae
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 11
Issue 12
10.3390/jof11120835
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Identification and Pathogenicity of Fusarium Fungi Causing Potato Dry Rot in Shanxi Province, China

by
Jiaru Guo
1,
Yupei Shi
1,
Xi Chen
1,
Peibing Du
2,
Yingli Zhao
1 and
Liang Wang
1,*
1
College of Food Science and Engineering, Shanxi Agricultural University, Taiyuan 030031, China
2
High Latitude Crops Institute, Shanxi Agricultural University, Datong 037008, China
*
Author to whom correspondence should be addressed.
J. Fungi 2025, 11(12), 835; https://doi.org/10.3390/jof11120835
Submission received: 22 October 2025 / Revised: 18 November 2025 / Accepted: 22 November 2025 / Published: 25 November 2025
(This article belongs to the Section Fungal Evolution, Biodiversity and Systematics)
Browse Figures
Versions Notes

Abstract

In the present study, 70 representative strains of potato dry-rot pathogen fungi were collected and isolated from three potato-growing areas in Northern Shanxi Province to determine their distribution and composition. The aim was to determine their distribution and composition by investigating their genetic structure through morphological characterization and phylogenetic tree construction using three DNA fragments (TEF1, RPB1, and RPB2). The results showed that potato dry rot disease in Northern Shanxi Province, is caused by five pathogenic species: Fusarium sambucinum, F. solani, F.oxysporum, F. acuminatum, and F. dimerum, among which F. sambucinum is the dominant species, accounting for 87.14% of all the strains, and distributed primarily in various potato-growing areas in the region. This study is the first to show that F. dimerum is a component of the pathogenic complex causing potato dry rot and is distributed primarily in the basin and hilly regions with relative frequencies of 3.45% and 13.04%, respectively. Fusarium acuminatum is distributed only in the plateau regions with a relative frequency of 5.56%.

1. Introduction

Potato is an important food and vegetable crop that serves as a staple food in China behind only wheat, rice, and maize [1]. Approximately 4.8 million hm2 of potatoes are grown in China, which ranks it first worldwide with respect to area and total production, at 28% and 23%, respectively. The planting area of potato spreads over all the provinces of China, with four main producing areas: a primary crop region in North China, a secondary crop region in the Central Plain region, a mixed crop region in Southwestern China, and a winter crop region in South China [2]. Among these, the North China primary crop region has the largest area, accounting for 42% of the total area. This is also the dominant producing area for seed potatoes, fresh potatoes, and processed special-purpose potatoes in China. The potato-planting areas in Shanxi Province are representative of the typical agricultural regions in North China, with over 90% of the planting area adopting the organic dry farming mode. This unique geographical environment (high altitude > 1200 m) and climatic conditions result in potatoes with excellent quality, making Shanxi a major production area for seed potatoes and commercial potatoes in China. As of 2018, the planted area of potato in Shanxi Province was approximately 200,000 hm2, forming three major potato industrial regions in the Yanmen Pass, Lvliang Mountain, and Taihang Mountain areas. Among these, the Yanmen Pass area is a golden region for potato production, accounting for approximately 50% of the total planted area of potato in Shanxi Province. These production areas have diverse geological morphologies and are classified into three major types, namely plateau, basin, and hilly.
In 2015, China proposed a strategy of establishing potato as a staple crop, which represents a major opportunity for the development of the potato industry. The planted area of potato and annual production have both increased in China, thereby continuously scaling up the potato industry. Postharvest storage losses of potato tubers range from 15% to 25% annually. To supply markets for fresh consumption and the starch processing industry, approximately 70% of the potato harvest requires storage for 3–6 months, making rot diseases an increasingly severe problem. However, dry rot disease of potato during storage, after harvest, is the primary storage disease in the potato-producing areas in the dry-crop growing regions of Shanxi and northwest China [3]. Potato dry rot has become a bottleneck restricting the sustainable and healthy development of the potato industry. The incidence of potato dry rot during storage is approximately 8–69% in the different growing areas in China, reaching up to 88.5% in severe cases. Crop loss due to potato dry rot ranges from 6% to 5% and can reach 60% in severe cases [4]. Dry rot not only affect the yield and quality of potato tubers, but its pathogenic agents also produce toxins and other secondary metabolites that are highly toxic to humans and animals [5]. Dry rot is caused by Fusarium spp. fungi and can infect a wide range of crops in the grass, eggplant, and legume families [6,7,8]. Seventeen species and five variants of dry-rot pathogens have been reported worldwide [9], and all of them have been reported in China. The pathogenic species and dominant strains show considerable variation in different potato-growing areas. The average incidence of potato dry rot in Shanxi Province is approximately 9% and can reach 25% in severe cases [10]. Wang et al. reported [10] that the potato dry-rot pathogens in Shanxi Province include F. acuminatum, F. avenaceum, F. sambucinum, F. solani, and F. oxysporum. Unfortunately, due to limitations associated with sampling sites and several samples, the species of dry-rot pathogens and dominant pathogens in the principal potato-producing region in the Yanmen Pass remain poorly characterized. To date, 17 species of potato dry-rot pathogens have been identified in China [10]. With the circulation of potatoes between regions and the planting of seed potatoes, there have been many changes in the populations of dry-rot pathogens. This has necessitated the systematic understanding of the species of dry-rot pathogens and dominant pathogens in the principal potato-producing region in the Yanmen Pass, to provide a theoretical basis for the scientific prevention and control of dry rot disease.

2. Materials and Methods

2.1. Pathogen Isolation and Purification

In 2020–2022, eight planting regions of the plateau (Zuoyun, Youyu), basin (Pingcheng, Tianzhen, Yanggao, Maozao), and hilly regions (Guangling, Hunyuan) of Northern Shanxi Province with continuous planting were selected. To collect potato disease samples, potato tubers with typical symptoms of disease were collected from 8 representative storage facilities. These symptomatic tubers, which displayed dark brown spots on the epidermis, shrinkage, and sunken lesions on the flesh, were subsequently packaged into self-sealing bags. Bags from different fields and harvest dates were strategically selected from key areas (e.g., vents, corners). From each bag, tubers were collected from both surface and core positions. In each storage facility, 10 to 13 samples of dry rot disease were collected, for a total of 93 potatoes. One sample was defined as an individual tuber. And these samples were transported to the laboratory at 18 °C, and the isolation of pathogenic fungi was performed within 6 h of collection.
The pathogenic fungi were isolated using tissue isolation methods [11,12]. Debris was cleared from the surface of the samples by rinsing them with sterile water. The surface of the tubers was wiped with cotton balls soaked in 75% alcohol. Tissue pieces (approximately 5 mm × 5 mm) were cut from the junctions of healthy and diseased tissues using a sterile dissecting knife, disinfected with 75% ethanol for 25 s, rinsed three times with sterile water, placed in a PDA (PDA, Hopebio, Qingdao, China) medium containing chloramphenicol (0.1 g/L), and incubated at 25 °C for 7 d.
Initial screening based on the color of the colonies and microscopic examination of the conidium morphology indicated the presence of Fusarium, and representative strains were screened. The PDA medium was inoculated with representative strains and cultured for 7 d. Spore suspensions (1 × 103 CFU/mL) were prepared, from which single spores were isolated and incubated at 25 °C for 2 d [13]. To ensure purity, the hyphal tips of single colonies were precisely excised and transferred to a PDA medium, and cultured for 7 d. Following this, single-spore isolates were obtained and stored at 4 °C.

2.2. Molecular Characterization

For molecular identification, genomic DNA was extracted, and multiple gene regions were sequenced and analyzed as follows: (a) DNA extraction: mycelium was collected after 5 d of culture, and the DNA was extracted using a fungal genomic DNA extraction kit (Hangzhou Bioer Technology, Co., Ltd., Hangzhou, China). The translation elongation factor 1-a region (TEF1), RNA polymerase largest subunit region (RPB1), and RNA polymerase second largest subunit region (RPB2) were amplified using the primer pairs EF-1T/EF-2T, Fa/G2R, and 7cf/11ar (Table 1) [14,15]. (b) the PCR amplification procedures for TEF1, RPB1, and RPB2 were as follows: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 30 s, annealing for 40 s, extension at 72 °C for 60 s, 35 cycles, and finally extension at 72 °C for 10 min. The annealing temperatures of the three primer pairs are listed in Table 1. (c) expected fragment sizes: the anticipated PCR product sizes were approximately 600 bp for TEF1, 800 bp for RPB1, and 800 bp for RPB2. (d) software versions: the sequencing results of TEF1, RPB1, and RPB2 were analyzed using T-BLASTn algorithm against the curated Fusarium-specific dataset of the FUSARIUM-ID v.3.0 database (http://isolate.fusariumdb.org/blast.php, accessed on 19 June 2025) and to standard BLASTn searches against the NCBI nucleotide collection (nr/nt) database (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 13 November 2025), respectively. The PCR products were visualized by 1% agarose gel electrophoresis, and the products were recovered using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). The amplified products were purified and sent to Sangon Biotech Co., Ltd. (Shanghai, China) for sequencing, and the sequences were obtained and deposited in Genbank (accession numbers listed in Table 2).
The obtained sequences of various Fusarium species were first subjected to multiple alignment and analysis using DNAMAN 9.0 software. Subsequently, the sequences were then aligned with MAFFT and manually corrected using MEGA 12.1 software. For phylogenetic tree construction, the TEF1, RPB1, and RPB2 gene sequences were concatenated end-to-end using PhyloSuite_v1.1.16. With Macroconia leptosphaeriae as the outgroup, a maximum likelihood (ML) phylogenetic tree was constructed in PAUP* v. 4.0b10 using the general time reversible model with gamma-distributed rate heterogeneity (GTR + G). Branch support was evaluated using 1000 bootstrap replicates.

2.3. Morphological Characterization

The PDA medium and SNA medium were inoculated with representative strains and incubated at 25 °C for 7 d, with a 12 h light/12 h dark cycle. The morphology and color of the pathogen colonies and the density of the hyphae were observed on PDA. Microscopic features, including the size, color, and morphology of the conidiophores and conidia [16], were observed with a random sample size of 100 for both macroconidia and microconidia, using an Olympus BX53F microscope on SNA.

2.4. Determination of Pathogenicity

The pathogenicity of the isolates was determined by injury inoculation, and eventually the pathogenicity was verified by re-isolating the post-inoculation strains in accordance with Koch’s postulates [17]. Strains cultured in PDA medium for 7 d were selected and a 1.0 × 105 CFU/mL spore suspension was prepared. Qingshu No. 9 potatoes of similar size and free from disease and injury were selected; they were rinsed with water, disinfected by soaking in 0.5% sodium hypochlorite for 10 min, and air dried. A hole punch (5 mm diameter) was used to punch holes in the surface of the potato, which were inoculated with 5 μL of the spore suspension. All 70 representative strains were selected for pathogenicity detection. Each representative strain was used to inoculate 10 potato tubers, which were then placed in a sterile 25 °C incubator. The diameter of the lesions was measured 30 d after inoculation. Disease incidence was calculated using the following formula: (Number of symptomatic tubers/Total number of inoculated tubers) × 100%. It is noted that all tubers were artificially wounded to ensure successful infection, and thus, disease incidence reflects the aggressiveness of the pathogen rather than natural infection rates.

2.5. Data Statistics and Analysis

Data were analyzed with IBM SPSS statistics 27.0.1 by one-way ANOVA, and means were compared using Duncan’s multiple range test at a significance level of p = 0.05. Letters indicate significant differences (p = 0.05). All experiments were repeated three times.

3. Results

3.1. Characterization of Potato Dry Rot Disease Symptoms During Storage

In the early stages of the disease, brown, slightly depressed spots initially appeared on the skin of the potatoes, and the internal decay of the diseased potatoes exhibited a light brown coloration (Figure 1A,B). With the progression of the disease, whorls of folds appeared in the spots, and the internal decay of the diseased potatoes exhibited a dark brown coloration (Figure 1C,D). In the late stages of the disease, the surface of the potato became dry, wrinkled, and grayish-brown to dark brown. The center of the potato became hollow and filled with white hyphae (Figure 1E–H).

3.2. Phylogenetic Analysis

The TEF1, RPB1, and RPB2 gene sequence were amplified from 70 representative strains isolated from the dry rot specimens from three potato-growing areas in Shanxi Province. These sequences were submitted to the GenBank database (Table 2).
A phylogenetic tree was constructed using the TEF1, RPB1, and RPB2 gene with Macroconia leptosphaeriae as the outgroup. The 70 screened strains clustered into five branches (Figure 2), suggesting that the potato dry-rot pathogens are classified as F. sambucinum, F. solani, F. oxysporum, F. acuminatum, and F. dimerum. The results showed that the 61 representative strains (BF0071, BF0072, and DT2, among others) clustered in the same branch as F. sambucinum with 74% bootstrap support, indicating that they are most closely related to F. sambucinum. Three strains (KX301, KX302, and HS74) clustered in the same branch as F. solani with 78% bootstrap support, indicating that they are most closely related to F. solani. LS163 clustered in the same branch as F. oxysporum with 100% bootstrap support, indicating that it is most closely related to F. oxysporum. YY3 clustered in the same branch as F. acuminatum with 95% bootstrap support, indicating that it is the most closely related to F. acuminatum. HY1, HY3, HY4, and HS73 clustered in the same branch as F. dimerum with 100% bootstrap support, indicating that they are the most closely related to F. dimerum (Figure 2).

3.3. Morphology of the Potato Dry-Rot Pathogens

Based on their colony morphology, the potato dry-rot strains were broadly categorized into five major groups. On PDA medium, class 1 representative strains had white-to-light yellow, velvet-like hyphae with clear margins and colony back surfaces that were light yellow-to-yellow in color. After 7 days of incubation, the colonies attained a diameter of 3.2–4.1 cm (Figure 3A,B). Microconidia were ovel-ellipsoidal, and 3.2–4.5 μm × 2.2–3.7 μm in size. Macroconidia were rarely observed. (Figure 3C). Class 2 representative strains had white, velvet-like hyphae with clear margins and colony back surfaces that were light yellow in color. After 7 days of incubation, the colonies attained a diameter of 1.6–2.2 cm (Figure 3D,E). Microconidia were crescent-shaped to ovoid, occasionally with pointed apices, and 4.8–7.3 μm × 2.3–3.8 μm in size. Macroconidia were not produced (Figure 3F). Class 3 representative strains had white, velvet-like hyphae with clear margins and colony back surfaces that were light yellow in color. After 7 days of incubation, the colonies attained a diameter of 5.3–6.2 cm (Figure 3G,H). The conidia (microconidia and macroconidia) were elliptical with tapered ends, and 3.2–6.9 μm × 2.2–3.4 μm in size (Figure 3I). Class 4 representative strains had white-to-grayish-white, cotton-to-velvet-like hyphae that were well developed in the center and diffused at the margins. The colony back surfaces were dark yellow and could produce a purple pigment. After 7 days of incubation, the colonies attained a diameter of 4.5–5.3 cm (Figure 3J,K). The fungus produced both macroconidia and microconidia. Macroconidia were falcate and 2 to 4 septate. Microconidia were fusiform, 0 to 1 septate and 7.6–35.7 μm × 2.1–3.7 μm in size. Chlamydospores were formed in clusters or chains (Figure 3L). Class 5 representative strains had white-to-grayish-white, cotton-to-velvet-like hyphae that were well developed in the center and had clear margins. The colony back surfaces were dark red and could produce a red pigment. After 7 days of incubation, the colonies attained a diameter of 5.1–5.5 cm (Figure 3M,N). Macroconidia were falcate and 2 to 3 septate, while the microconidia were elliptical to ovoid and 1 to 2 septate. Conidia (microconidia and macroconidia) measured 4.3–36.2 μm × 2.2–3.6 μm (Figure 3O).

3.4. Pathogenicity Analysis

After inoculation with F. acuminatum, F. dimerum, F. sambucinum, F. oxysporum, and F. solani, the symptoms in the healthy potatoes were generally consistent with those in the tuber bulking stage, and the Fusarium species isolated from each diseased plant was identical to those used during inoculation, indicating that F. acuminatum, F. dimerum, F. sambucinum, F. oxysporum, and F. solani were the pathogenic fungi responsible for the potato dry rot during storage. The pathogenicity of the five Fusarium species varied significantly, with large differences in the diameter of the spots on the potatoes. Fusarium sambucinum was the most pathogenic, with an incidence of 100% and a spot diameter of 6.51 ± 0.08 cm, which was significantly higher than that of the other four Fusarium species (p < 0.05). Fusarium solani was the next most pathogenic, with an incidence of 100% and a spot diameter of 5.43 ± 0.18 cm, exhibiting a significant difference compared to the other three Fusarium species. Fusarium acuminatum was less pathogenic, with an incidence and spot diameter of 100% and 3.49 ± 0.12 cm, respectively. The incidence and spot diameter of F. dimerum were 100% and 1.40 ± 0.03 cm, respectively. Fusarium oxysporum was the least pathogenic, with an incidence and spot diameter of 86.67% and 1.30 ± 0.20 cm, respectively (Figure 4 and Figure 5).
Pathogenicity analysis revealed a clear virulence gradient among the five Fusarium species. F. sambucinum and F. solani constituted a highly aggressive group, causing the most extensive lesions. In contrast, F. acuminatum, F. dimerum, and F. oxysporum formed a low-virulence group, with the latter also exhibiting reduced infectivity. Notably, the isolates of F. oxysporum and F. dimerum caused minimal tissue damage, suggesting that they might not be primary causal agents of dry rot but rather secondary colonizers that invade tissue following establishment by more aggressive microbes.

3.5. Composition and Distribution of the Pathogens Causing Potato Dry Rot in Three Potato-Growing Areas

The pathogens causing potato dry rot in Shanxi Province belonged to five pathogenic species. Among them, F. sambucinum was distributed in three potato-growing areas of Shanxi Province. Notably, F. sambucinum accounted for 87.14% of the total number of strains. Only two pathogenic species, F. acuminatum and F. sambucinum, were isolated from the plateau region. Four pathogenic species were isolated from the basin region, which were F. dimerum, F. oxysporum, F. sambucinum, and F. solani. Additionally, F. dimerum and F. sambucinum were distributed in the hilly region (Figure 6).

4. Discussion

Dry rot is a major disease experienced in potatoes during storage. Understanding the composition and distribution of dry rot fungus populations provides a scientific basis for targeted prevention and the control of potato dry rot. Potato dry-rot pathogens in various regions worldwide are complex and diverse, with approximately 17 species in China [12,18,19,20], including F. acuminatum, F. avenaceum, F. culmorum, F. equiseti, F. gibbosum, F. macroceras, F. moniliforme, F. redolens, F. sambucinum, F. semitectum, F. solani, F. sporotrichiodes, F. sulphureum, F. trichothecioides, and F. tricinctum, of which the 5 dominant species in the North China primary crop region are F. avenaceum, F. acuminatum, F. sambucinum, F. solani, and F. sporotrichiodes. Wang et al. reported [10] that among the five dominant pathogenic species in the potato-growing areas of Shanxi Province did not include F. sporotrichiodes. but F. oxysporum was. Potato dry rot has also been reported in other countries, including the United Kingdom, South Africa, the mid-northern United States, and Egypt [21,22,23,24,25]. The dominant species of potato dry rot disease across various regions of the world primarily concentrate on F. sambucinum, F. oxysporum, and F. solani, with F. sambucinum presenting the utmost pathogenicity and F. oxysporum the widest infective capacity [26,27,28,29,30,31,32,33,34]. In the present study, we found that the pathogenic agents of dry rot disease in the principal potato-producing areas in the Yanmen Pass included F. sambucinum, F. solani, F. oxysporum, F. acuminatum, and F. dimerum, of which F. sambucinum and F. solani accounted for large proportions and were the dominant species. However, F. avenaceum was not isolated from the Yanmen Pass potato-producing area, indicating that the composition of pathogenic species has changed over time and in response to changes in planting structure. Potato dry-rot pathogens are complex and diverse in different growing regions. It has been hypothesized that this is attributed to differences in planting structures, among other reasons. In Gansu Province, characterized by a temperate arid continental climate, F. solani and F. oxysporum have been reported as the predominant species [35]. In contrast, our study, conducted across three distinct regions in northern Shanxi Province, identified F. sambucinum as the dominant pathogen. This shift in species dominance may be attributed to the distinct climatic, geographical, and soil conditions specific to northern Shanxi. In addition, comprehensive and systematic studies on dry-rot pathogen species in various potato-producing areas remain essential.
The present study is the first to identify F. dimerum as a fungal species associated with potato dry rot disease, accounting for 5.71% of all strains. In China, F. dimerum primarily causes diseases in bananas, dragon fruit, broad beans, and peas. Banana and dragon fruit are primarily distributed in South China and cannot be cultivated in Shanxi Province. However, broad beans and peas are among the major small grain crops traditionally cultivated in Shanxi Province and are also common crops in the predominantly potato-growing area of the Yanmen Pass. Belete E et al. reported that broad bean root rot is caused by Fusarium fungi [36]. The pathogens of pea root rot include co-infection by over 10 species of Fusarium and Pythium [37], among which the major pathogens include F. solani, F. oxysporum, F. dimerum, and Rhizoctonia solani. Fusarium solani, F. oxysporum, F. acuminatum, and F. dimerum are the primary pathogens of broad bean and pea root rot and are generally the same pathogens as the dry-rot pathogens in the Northern Shanxi potato-producing area. There is a tradition of crop rotation between potatoes, broad beans, and peas in the Yanmen Pass potato-producing area. It has been hypothesized that this might have led to increased F. dimerum abundance in potato following broad bean and pea crop rotation. The principal source of potato dry-rot pathogens is the soil, and these pathogens can overwinter and survive for long periods [38]. Crop rotation is an important measure for controlling potato dry rot and is effective in reducing Fusarium levels in the soil. Potato is a member of the nightshade family of crops, and crop rotation with other nightshades, such as tomato, tobacco, eggplant, and pepper, as well as other tuberous crops such as sweet potato, should be avoided [39,40]. Peters et al. found that the incidence of potato dry rot was reduced when potato was rotated with alfalfa, clover, and cereals [41]. Therefore, selective crop rotation with non-Fusarium host crops may serve as a potential strategy for controlling potato dry rot.
This study revealed that F. sambucinum, F. solani, F. oxysporum, F. acuminatum, and F. dimerum could not directly invade potatoes through the epidermis but instead required the presence of wounds. Potatoes can be susceptible to Fusarium infection through injuries; therefore, caution must be exercised to keep potatoes intact during sowing, harvesting, and transport to prevent or minimize mechanical damage. In addition, the timely elimination of damaged potatoes is essential for the prevention and control of potato dry rot disease during storage. Agricultural control is only one of many methods of controlling potato dry rot, demonstrating its ineffectiveness as a standalone solution for disease control. Disease prevention and control rely on accurate identification of the dominant species and population structure of dry rot in the different potato-producing areas. Future selection of effective potato dry rot prevention and control measures should be conducted in accordance with the different dominant species and population structure, taking into account the local conditions.

5. Conclusions

In this research, to clarify the species, distribution, and potential pathogenicity of pathogens associated with potato dry rot in the northern part of Shanxi Province, we collected 93 samples showing symptoms of dry rot and isolated 70 pathogenic strains. By analyzing the cultural characteristics and conducting phylogenetic analysis of the strains we successfully identified five distinct Fusarium species. Pathogenicity analysis confirmed that F. sambucinum, F. solani, F. oxysporum, F. acuminatum, and F. dimerum are the causal agents of potato dry rot during the storage in three major potato-growing regions of northern part of Shanxi Province. Among these species, F. sambucinum exhibits the strongest pathogenicity and the widest distribution (occurring in all three regions areas), making it the dominant species. Furthermore, this study is the first to identify that F. dimerum is associated with potato dry rot and can act as a causal agent of the disease. However, its pathogenicity is significantly lower than that of other species, suggesting it primarily functions as a weak pathogen or secondary colonizer. The findings of this research provide a scientific basis for the comprehensive prevention and control of potato dry rot in the northern part of Shanxi Province.

Author Contributions

Conceptualization, J.G.; Data curation, Y.S., X.C. and P.D.; Formal analysis, Y.S.; Funding acquisition, L.W.; Investigation, J.G. and Y.Z.; Methodology, J.G., Y.S. and X.C.; Project administration, L.W.; Software, X.C.; Supervision, J.G. and L.W.; Validation, J.G. and X.C.; Visualization, P.D.; Writing—original draft, J.G.; Writing—review & editing, X.C. and P.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Research and Application of the Key Technologies for Enhancing Quality and Efficiency of Potatoes (2024XDHZ05), the Earmarked Fund for Modern Agro-industry Technology Research System (2025CYJSTX06-18), the Key Research and Development Program of Shanxi Province (201903D221039), and the Scientific and Technological Innovation Research Topics of Shanxi Academy of Agricultural Sciences (YCC2020202).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Qu, D.Y.; Xie, K.Y.; Jin, L.P.; Pang, W.F.; Bian, C.S.; Duan, S.G. Development of potato industry and food security in China. Sci. Agric. Sin. 2005, 38, 358–362. [Google Scholar] [CrossRef]
  2. Gao, Y.L.; Xu, J.; Liu, N.; Zhou, Q.; Ding, X.H.; Zhan, J.S.; Cheng, X.Y.; Huang, J.; Lu, Y.W.; Yang, Y.H. Current status and management strategies for potato insect pests and diseases in China. Plant Prot. 2019, 45, 106–111. [Google Scholar] [CrossRef]
  3. Du, M.R.; Ren, X.Y.; Sun, Q.H.; Wang, Y.; Zhang, R.F. Characterization of Fusarium spp. causing potato dry rot in China and susceptibility evaluation of Chinese potato germplasm to the pathogen. Potato Res. 2012, 55, 175–184. [Google Scholar] [CrossRef]
  4. Fan, Y.L.; Zhang, W.N.; Kang, Y.C.; Shi, M.F.; Yang, X.Y.; Yu, H.F.; Zhang, R.Y.; Liu, Y.H.; Qin, S.H. Physiological and dynamic transcriptome analysis of two potato varieties reveal response of lignin and MAPK signal to dry rot caused by Fusarium sulphureum. Sci. Hortic. 2021, 289, 110470. [Google Scholar] [CrossRef]
  5. Xue, H.L.; Liu, Q.L.; Yang, Z.M. Pathogenicity, mycotoxin production, and control of potato dry rot caused by Fusarium spp.: A review. J. Fungi 2023, 9, 843. [Google Scholar] [CrossRef]
  6. Li, B.Y.; Ma, S.M. Pathogens of soybean root rot and screening of resistant sources. J. Plant Prot. 2000, 27, 91–92. [Google Scholar] [CrossRef]
  7. Wu, H.Y.; Sun, S.R.; Fan, Z.W.; Liu, C.G.; Yang, T.Y.; Zhu, J.H. Research condition and prevention countermeasures of maize stalk rot. J. Maize Sci. 2007, 15, 129–132. [Google Scholar] [CrossRef]
  8. Xu, Y.H.; Li, Y.; Xu, X.Y. Progress in research on Fusarium wilt of tomato. J. Northeast Agric. Univ. 2008, 39, 128–134. [Google Scholar] [CrossRef]
  9. Li, Y.T.; Xia, X.N.; Zhao, Q.M.; Dong, P. The biocontrol of potato dry rot by microorganisms and bioactive substances: A review. Physiol. Mol. Plant Pathol. 2022, 122, 101919. [Google Scholar] [CrossRef]
  10. Wang, W.Z.; Min, F.X.; Yang, S.; Wei, Q.; Guo, M.; Gao, Y.; Hu, L.S.; Sheng, W.M. Research progress on potato dry rot disease in China and its control measures. China Veg. 2020, 40, 22–29. [Google Scholar] [CrossRef]
  11. Chen, S.Z.; Chen, T.X.; Ji, X.X.; Yang, C.D.; Chen, X.R. Identification of the pathogen of the potato dry rot disease and screening of fungicides in the Minxian district of Gansu Province. Pratacultural Sci. 2017, 34, 2218–2225. [Google Scholar] [CrossRef]
  12. Li, J.H.; Wang, D.; Chai, Z.X.; Lester, W.B. Isolation and identification of the dominant pathogens causing potato Fusarium dry rot in Gansu Province. Acta Phytopathol. Sin. 2011, 41, 456–463. [Google Scholar] [CrossRef]
  13. Liu, Z.P.; Wang, L.X.; Li, R.X.; Liu, C.F.; Li, Y.J. Identification and biological character test of wheat common rot pathogen. Acta Agric. Boreali-Sin. 2002, 17, 44–48. [Google Scholar] [CrossRef]
  14. O’Donnell, K.; Whitaker, B.; Laraba, I.; Proctor, R.; Brown, D.; Broders, K.; Kim, H.; McCormick, S.P.; Busman, M.; Aoki, T.; et al. DNA sequence-based identification of Fusarium: A work in progress. Plant Dis. 2021, 106, 1597–1609. [Google Scholar] [CrossRef]
  15. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef]
  16. Tiwari, R.K.; Bashyal, B.M.; Shanmugam, V.; Lal, M.K.; Kumar, R.; Sharma, S.; Vinod; Gaikwad, K.; Singh, B.; Aggarwal, R. Impact of Fusarium dry rot on physicochemical attributes of potato tubers during postharvest storage. Postharvest Biol. Technol. 2021, 181, 111638. [Google Scholar] [CrossRef]
  17. Fu, J.N.; Liu, X.H.; Cai, F.D.; Kou, L.P. Identification of pathogenic fungus causing a decay of stored pomegranate fruits using molecular biology technique. Acta Hortic. Sin. 2007, 34, 877–882. [Google Scholar] [CrossRef]
  18. Min, F.X.; Wang, X.D.; Hu, L.S.; Wei, Q.; Dong, X.Z.; Li, F.L.; Li, H.C.; Liu, W.T.; Guo, M. Identification of species and pathogenicity of the Fusarium on potato in Heilongjiang Province. Plant Prot. 2010, 36, 112–115. [Google Scholar] [CrossRef]
  19. Wei, W.; Zhu, J.H.; Zhang, H.L.; Yang, Z.H. Identification of the pathogens causing potato dry rot in Hebei and Inner Mongolia. J. Plant Prot. 2013, 40, 296–300. [Google Scholar] [CrossRef]
  20. Ye, Q.M.; Wang, G.C. On Fusarium dry rot of potato in Zhejiang. Acta Phytopathol. Sin. 1995, 25, 148. [Google Scholar] [CrossRef]
  21. Boyd, A. Dry-rot disease of the potato: VII. the effect of storage temperature upon subsequent susceptibility of tubers. Ann. Appl. Biol. 1952, 39, 351–357. [Google Scholar] [CrossRef]
  22. Theron, D.; Holz, G. Effect of temperature on dry rot development of potato tubers inoculated with different Fusarium spp. Potato Res. 1990, 33, 109–117. [Google Scholar] [CrossRef]
  23. Estrada Jr, R.; Gudmestad, N.; Rivera, V.; Secor, G. Fusarium graminearum as a dry rot pathogen of potato in the USA: Prevalence, comparison of host isolate aggressiveness and factors affecting aetiology. Plant Pathol. 2010, 59, 1114–1120. [Google Scholar] [CrossRef]
  24. Elsherbiny, E.A.; Dawood, D.H.; Elsebai, M.F.; Mira, A.; Taher, M.A. Control of dry rot and resistance induction in potato tubers against Fusarium sambucinum using red onion peel extract. Postharvest Biol. Technol. 2023, 195, 112119. [Google Scholar] [CrossRef]
  25. Pozo, M.G.; Vaessen, C.V.; Kourmpetli, S.; Terry, L.A.; Medina, A. Effect of temperature, relative humidity, and incubation time on the mycotoxin production by Fusarium spp. responsible for dry rot in potato tubers. Toxins 2024, 16, 414. [Google Scholar] [CrossRef]
  26. Aydin, M.H.; Inal, B. Comparative susceptibility of some commercial potato cultivars to Fusarium sambucinum and F. solani isolates causing tuber dry rot. Appl. Ecol. Environ. Res. 2018, 16, 4879–4892. [Google Scholar] [CrossRef]
  27. Azil, N.; Stefanczyk, E.; Sobkowiak, S.; Chihat, S.; Boureghda, H.; Sliwka, J. Identification and pathogenicity of Fusarium spp. associated with tuber dry rot and wilt of potato in Algeria. Eur. J. Plant Pathol. 2021, 159, 495–509. [Google Scholar] [CrossRef]
  28. Gachango, E.; Hanson, L.E.; Rojas, A.; Hao, J.J.; Kirk, W.W. Fusarium spp. causing dry rot of seed potato tubers in Michigan and their sensitivity to fungicides. Plant Dis. 2012, 96, 1767–1774. [Google Scholar] [CrossRef]
  29. Gavrilova, O.; Orina, A.; Trubin, I.; Gagkaeva, T. Identification and pathogenicity of Fusarium fungi associated with dry rot of potato tubers. Microorganisms 2024, 12, 598. [Google Scholar] [CrossRef]
  30. Gherbawy, Y.A.; Hussein, M.A.; Hassany, N.A.; Shebany, Y.M.; Hassan, S.; El-Dawy, E. Phylogeny and pathogenicity of Fusarium solani species complex (FSSC) associated with potato tubers. J. Basic Microbiol. 2021, 61, 1133–1144. [Google Scholar] [CrossRef]
  31. Heltoft, P.; Brierley, J.L.; Lees, A.K.; Sullivan, L.; Lynott, J.; Hermansen, A. The relationship between soil inoculum and the development of Fusarium dry rot in potato cultivars Asterix and Saturna. Eur. J. Plant Pathol. 2016, 146, 711–714. [Google Scholar] [CrossRef]
  32. Heltoft, P.; Molteberg, E.L.; Nærstad, R.; Hermansen, A. Effect of maturity level and potato cultivar on development of Fusarium dry rot in Norway. Potato Res. 2015, 58, 205–219. [Google Scholar] [CrossRef]
  33. Peters, J.C.; Lees, A.K.; Cullen, D.W.; Sullivan, L.; Stroud, G.P.; Cunnington, A.C. Characterization of Fusarium spp. responsible for causing dry rot of potato in Great Britain. Plant Pathol. 2008, 57, 262–271. [Google Scholar] [CrossRef]
  34. Stefanczyk, E.; Sobkowiak, S.; Brylinska, M.; Sliwka, J. Diversity of Fusarium spp. associated with dry rot of potato tubers in Poland. Eur. J. Plant Pathol. 2016, 145, 871–884. [Google Scholar] [CrossRef]
  35. Niu, X.; Li, J.; Zhang, J.; Shen, B.; Chai, Z.; Wang, D. Changes of Fusarium in rhizosphere soil under potato continuous cropping systems in arid-irrigated area of Gansu Province. Acta Prataculturae Sin. 2011, 20, 236–243. [Google Scholar] [CrossRef]
  36. Belete, E.; Ayalew, A.; Ahmed, S. Associations of biophysical factors with faba bean root rot (Fusarium solani) epidemics in the northeastern highlands of Ethiopia. Crop Prot. 2013, 52, 39–46. [Google Scholar] [CrossRef]
  37. Zhang, L.J.; Wang, C.; Min, G.M.; Yang, X.M. Research progress in pea root rot. Plant Prot. 2019, 45, 82–90. [Google Scholar] [CrossRef]
  38. Gálvez, L.; Palmero, D. Fusarium dry rot of garlic bulbs caused by Fusarium proliferatum: A review. Horticulturae 2022, 8, 628. [Google Scholar] [CrossRef]
  39. Peters, R.D.; Sturz, A.V.; Carter, M.R.; Sanderson, J.B. Developing disease-suppressive soils through crop rotation and tillage management practices. Soil Tillage Res. 2003, 72, 181–192. [Google Scholar] [CrossRef]
  40. Uwamahoro, F.; Berlin, A.; Bucagu, C.; Bylund, H.; Yuen, J. Ralstonia solanacearum causing potato bacterial wilt: Host range and cultivars’ susceptibility in Rwanda. Plant Pathol. 2020, 69, 559–568. [Google Scholar] [CrossRef]
  41. Peters, R.D.; MacLeod, C.; Seifert, K.A.; Martin, R.A.; Hale, L.R.; Grau, C.R.; MacInnis, S. Pathogenicity to potato tubers of Fusarium spp. isolated from potato, cereal and forage crops. Am. J. Potato Res. 2008, 85, 367–374. [Google Scholar] [CrossRef]
Jof 11 00835 g001
Figure 1. Symptoms of potato Fusarium dry rot during the storage period. Disease symptoms were photographed at 5 (A,B), 15 (C,D), 20 (E,F), and 30 (G,H) days post-inoculation (dpi).
Figure 1. Symptoms of potato Fusarium dry rot during the storage period. Disease symptoms were photographed at 5 (A,B), 15 (C,D), 20 (E,F), and 30 (G,H) days post-inoculation (dpi).
Jof 11 00835 g001
Jof 11 00835 g002aJof 11 00835 g002bJof 11 00835 g002cJof 11 00835 g002d
Figure 2. Phylogenetic tree of the Fusarium species isolated from potato in Shanxi Province. Maximum likelihood phylogenetic tree of Fusarium based on a concatenated dataset of TEF1, RPB1, and RPB2 gene sequences. Five independent phylogenetic trees were constructed, all rooted with Macroconia leptosphaeriae as the outgroup. They correspond to the following five species complexes: (A) F. acuminatum to F. tricinctum species complex (FTSC), (B) F. dimerum to F. dimerum species complex (FDSC), (C) F. oxysporum to F. oxysporum species complex (FOSC), (D) F. sambucinum to F. sambucinum species complex (FSAMSC), and (E) F. solani to F. solani species complex (FSSC). Isolates obtained in this study are shown in red.
Figure 2. Phylogenetic tree of the Fusarium species isolated from potato in Shanxi Province. Maximum likelihood phylogenetic tree of Fusarium based on a concatenated dataset of TEF1, RPB1, and RPB2 gene sequences. Five independent phylogenetic trees were constructed, all rooted with Macroconia leptosphaeriae as the outgroup. They correspond to the following five species complexes: (A) F. acuminatum to F. tricinctum species complex (FTSC), (B) F. dimerum to F. dimerum species complex (FDSC), (C) F. oxysporum to F. oxysporum species complex (FOSC), (D) F. sambucinum to F. sambucinum species complex (FSAMSC), and (E) F. solani to F. solani species complex (FSSC). Isolates obtained in this study are shown in red.
Jof 11 00835 g002aJof 11 00835 g002bJof 11 00835 g002cJof 11 00835 g002d
Jof 11 00835 g003
Figure 3. Colony Characteristics of the representative strains on the PDA plates. The characterization was carried out with strains incubated on PDA at 25 °C in the dark for 7 days (A,D,G,J,M), the frontal aspect of colonies on PDA medium (B,E,H,K,N), the reverse aspect of colonies on SNA medium (C,F,I,L,O), the spore morphology of colonies under an optical microscope (40×).
Figure 3. Colony Characteristics of the representative strains on the PDA plates. The characterization was carried out with strains incubated on PDA at 25 °C in the dark for 7 days (A,D,G,J,M), the frontal aspect of colonies on PDA medium (B,E,H,K,N), the reverse aspect of colonies on SNA medium (C,F,I,L,O), the spore morphology of colonies under an optical microscope (40×).
Jof 11 00835 g003
Jof 11 00835 g004
Figure 4. Pathogenicity of Fusarium acuminatum, F. dimerum, F. sambucinum, F. oxysporum, and F. solani. Representative isolates of Fusarium species inoculated on potato tubers (Qingshu No. 9). Species and corresponding strain numbers are as follows: F. acuminatum (YY3), F. dimerum (HY3), F. sambucinum (LWH1), F. oxysporum (LS163), and F. solani (KX301). All tubers were incubated at 25 °C for 30 d.
Figure 4. Pathogenicity of Fusarium acuminatum, F. dimerum, F. sambucinum, F. oxysporum, and F. solani. Representative isolates of Fusarium species inoculated on potato tubers (Qingshu No. 9). Species and corresponding strain numbers are as follows: F. acuminatum (YY3), F. dimerum (HY3), F. sambucinum (LWH1), F. oxysporum (LS163), and F. solani (KX301). All tubers were incubated at 25 °C for 30 d.
Jof 11 00835 g004
Jof 11 00835 g005
Figure 5. Spot diameter and incidence rate for each Fusarium species (70 strains). Fusarium acuminatum (n = 1), F. dimerum (n = 4), F. sambucinum (n = 61), F. oxysporum (n = 1), and F. solani (n = 3). Different letters represent significant differences in spot diameter among various Fusarium species (p < 0.05). The error bars represent the mean ± 95% Cl.
Figure 5. Spot diameter and incidence rate for each Fusarium species (70 strains). Fusarium acuminatum (n = 1), F. dimerum (n = 4), F. sambucinum (n = 61), F. oxysporum (n = 1), and F. solani (n = 3). Different letters represent significant differences in spot diameter among various Fusarium species (p < 0.05). The error bars represent the mean ± 95% Cl.
Jof 11 00835 g005
Jof 11 00835 g006
Figure 6. Distribution and species composition of the Fusarium spp. from potato-planting areas in Shanxi Province. Different lowercase letters in the figure indicated that there were significant differences among different Fusarium species in different regions (p < 0.05).
Figure 6. Distribution and species composition of the Fusarium spp. from potato-planting areas in Shanxi Province. Different lowercase letters in the figure indicated that there were significant differences among different Fusarium species in different regions (p < 0.05).
Jof 11 00835 g006
Table 1. Primer pairs and annealing temperatures used in the study.
Table 1. Primer pairs and annealing temperatures used in the study.
Amplified RegionPrimer NameSequence (5′-3′)Annealing Temperatures (°C)
TEF1EF-1TATGGGTAAGGAAGACAAGAC57.5
EF-2TGGAAGTACCAGTGATCATGTT
RPB1FaCAYAARGARTCYATGATGGGWC55
G2RGTCATYTGDGTDGCDGGYTCDCC
RPB27cfATGGGYAARCAAGCYATGGG55
11arGCRTGGATCTTRTCRTCSACC
Table 2. Species, Strain numbers, Host, and GenBank accession numbers of the taxa used for phylogenetic analyses. Isolates obtained in this study are shown in bold. T = Ex-type strains.
Table 2. Species, Strain numbers, Host, and GenBank accession numbers of the taxa used for phylogenetic analyses. Isolates obtained in this study are shown in bold. T = Ex-type strains.
SpeciesStrain No.HostGenBank Accession No.
TEF1RPB1RPB2
F. acuminatumYY3S. tuberosumPV382882PV854763PV854833
NJC23Allium sativumOL741722OL741716OL741720
LW-5-OP838084OP838085OP838086
LS1-1WheatOP105209OP785217OP785270
F. gamsiiKG411Triticum aestivumON960708ON960644ON960692
KG390Triticum aestivumON960707ON960643ON960691
F. torulosumNRRL 22748-OL772877OL773029OL773181
NRRL 52772-OL772887OL773039OL773191
F. iranicumNRRL 52714-OL772883OL773035OL773187
FRC R8972-OL772864OL773016OL773168
F. avenaceumNJC06Kiwi treeOL439731OL439737OL439740
NJC07Kiwi treeOL439732OL439738OL439741
NJC08Kiwi treeOL439733OL439739OL439742
F. reticulatumFRC T683-OL772860OL773012OL773164
FRC R8747-OL772859OL773011OL773163
F. tricinctumF1502-OL964794OL658681OL658756
F1534-OL964796OL658676OL658761
F1544-OL964791OL658669OL658768
F. dimerumHS73S. tuberosumPV382890PV854767PV854837
HY1S. tuberosumPV382889PV854766PV854836
HY3S. tuberosumPV382888PV854765PV854835
HY4S. tuberosumPV382887PV854764PV854834
MNHN_RF_05625-MW811085MW811058MW811070
NRRL 36140 T-HM347133HM347203HM347218
CBS 108944 T-KR673912KM232212KR674020
F. penzigiiCBS 317.34 T-EU926324KM232211KM232362
B. allantoidesUBOCC_A_120037-MW811088MW811055MW811073
UBOCC_A_120036-MW811087MW811087MW811072
UBOCC_A_120035-MW811075MW811046MW811060
B. penicilloidesUBOCC_A_120021-MW811081MW811051MW811066
UBOCC_A_120034-MW811080MW811050MW811065
F. oxysporumLS163S. tuberosumPV382883PV854762PV854832
NRRL:62542-KC808229KC808302KC808365
NRRL:62547-KC808224KC808304KC808367
F. triseptatumCBS 258.50 TIpomoea batatasMH484964MW928820MH484873
JW 277008-MZ921888MZ921662MZ921757
F. languescensCBS 645.78 TS. lycopersicumMH484971MW928813MH484880
MF67-4Dioscorea esculentaPQ774592PQ774580PQ774586
F. curvatumCBS 238.94 TBeaucarnea sp.MH484984MW928804MH484893
FO16-HB-ZJK-PQ300823PQ296597PQ296676
F. duoseptatumZHKUCC 23-0911Strelitzia reginaePQ316056PQ468017PQ356493
ZHKUCC 23-0896Strelitzia reginaePQ316055PQ468016PQ356492
F. fabacearumCPC 25801-MH485029MZ921691MH484938
FO65-SC-CD-PQ300866PQ296640PQ296719
F. gossypinumLLC1739SoilOP487221OP486374OP486789
LLC1691SoilOP487220OP486373OP486788
F. cugenangenseZJUE1544Citrus unshiuPX130564PV983890PX130492
ZJUE1541Citrus unshiuPX130563PV983889PX130491
F. sambucinumBF0071S. tuberosumPV382910PV854758PV854828
BF0072S. tuberosumPV382892PV854757PV854827
CBS 151942 TSambucus nigraPQ260927PQ280949PQ274212
DT2S. tuberosumPV382943PV854756PV854826
DT3S. tuberosumPV382891PV854755PV854825
GL1S. tuberosumPV382948PV854754PV854824
GL2S. tuberosumPV382947PV854753PV854823
GL3S. tuberosumPV382934PV854752PV854822
GL4S. tuberosumPV382924PV854751PV854821
HS71S. tuberosumPV382904PV854750PV854820
HS72S. tuberosumPV382927PV854749PV854819
HY2S. tuberosumPV382951PV854748PV854818
JS151S. tuberosumPV382906PV854747PV854817
JS152S. tuberosumPV382919PV854746PV854816
JS153S. tuberosumPV382937PV854745PV854815
JS161S. tuberosumPV382905PV854744PV854814
JZ11S. tuberosumPV382908PV854743PV854813
JZ12S. tuberosumPV382939PV854742PV854812
JZ82S. tuberosumPV382907PV854741PV854811
KS21S. tuberosumPV382901PV854740PV854810
KX271S. tuberosumPV382917PV854739PV854809
KX272S. tuberosumPV382945PV854738PV854808
KX273S. tuberosumPV382921PV854737PV854807
LS121S. tuberosumPV382946PV854736PV854806
LS122S. tuberosumPV382930PV854735PV854805
LS123S. tuberosumPV382914PV854734PV854804
LS161S. tuberosumPV382920PV854733PV854803
LS162S. tuberosumPV382893PV854732PV854802
LS164S. tuberosumPV382896PV854731PV854801
LWH1S. tuberosumPV382944PV854730PV854800
LWH2S. tuberosumPV382909PV854729PV854799
LWH3S. tuberosumPV382923PV854728PV854798
LWH4S. tuberosumPV382895PV854727PV854797
NRRL 20666-MW233072MW233243MW233415
QS91S. tuberosumPV382936PV854726PV854796
QS92S. tuberosumPV382913PV854725PV854795
TS291S. tuberosumPV382929PV854724PV854794
TS311S. tuberosumPV382935PV854723PV854793
TS312S. tuberosumPV382940PV854722PV854792
TS313S. tuberosumPV382915PV854721PV854791
TZ2S. tuberosumPV382903PV854720PV854790
TZ3S. tuberosumPV382911PV854719PV854789
WLS1S. tuberosumPV382942PV854718PV854788
WLS2S. tuberosumPV382894PV854717PV854787
YG1S. tuberosumPV382898PV854716PV854786
YG2S. tuberosumPV382899PV854715PV854785
YN82-OR019814OR019820OR019826
YY2S. tuberosumPV382932PV854714PV854784
ZJ21S. tuberosumPV382916PV854713PV854783
ZJ22S. tuberosumPV382925PV854712PV854782
ZJ71S. tuberosumPV382931PV854711PV854781
ZJ72S. tuberosumPV382928PV854710PV854780
ZS171S. tuberosumPV382897PV854709PV854779
ZS172S. tuberosumPV382938PV854708PV854778
ZS173S. tuberosumPV382912PV854707PV854777
ZS174S. tuberosumPV382922PV854706PV854776
ZS175S. tuberosumPV382941PV854705PV854775
ZS181S. tuberosumPV382933PV854704PV854774
ZS182S. tuberosumPV382918PV854703PV854773
ZY2S. tuberosumPV382949PV854702PV854772
ZY4S. tuberosumPV382950PV854701PV854771
ZY5S. tuberosumPV382926PV854700PV854770
ZY6S. tuberosumPV382900PV854699PV854769
ZY7S. tuberosumPV382902PV854698PV854768
F. brachygibbosumCBS 121682StonePQ260819PQ280843PQ274106
CBS 131017Agropyron sp.PQ260820PQ280844PQ274107
CBS 131252Triticum sp.PQ260821PQ280845PQ274108
F. venenatumNRRL 32015-MW233109MW233281MW233453
NRRL 22196-MW233078MW233249MW233421
CBS 140911GrassPQ260954PQ280984PQ274241
CBS 127.95 S. tuberosumPQ260953PQ280983PQ274240
F. solaniHS74S. tuberosumPV382886PV854761PV854831
KX301S. tuberosumPV382884PV854759PV854829
KX302S. tuberosumPV382885PV854760PV854830
CBS 102429BarkKM231936KM232227KM232376
GR_FS26 Asparagus rootMT305228MT305111MT305169
GR_FS83Asparagus rootMT305232MT305115MT305173
F. azukicolaNRRL 54364 T-JQ670137KJ511276KJ511287
NRRL 54366-JQ670139KJ511277KJ511288
F. catenatumNRRL:54993 T-KC808214KC808292KC808355
NRRL:54992-KC808213KC808291KC808354
F. petroliphilumNRRL:54995-KC808215KC808293KC808356
M. leptosphaeriaeCBS 112770Cucurbitaria laburniKM231960KM232256KM232389
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, J.; Shi, Y.; Chen, X.; Du, P.; Zhao, Y.; Wang, L. Molecular Identification and Pathogenicity of Fusarium Fungi Causing Potato Dry Rot in Shanxi Province, China. J. Fungi 2025, 11, 835. https://doi.org/10.3390/jof11120835

AMA Style

Guo J, Shi Y, Chen X, Du P, Zhao Y, Wang L. Molecular Identification and Pathogenicity of Fusarium Fungi Causing Potato Dry Rot in Shanxi Province, China. Journal of Fungi. 2025; 11(12):835. https://doi.org/10.3390/jof11120835

Chicago/Turabian Style

Guo, Jiaru, Yupei Shi, Xi Chen, Peibing Du, Yingli Zhao, and Liang Wang. 2025. "Molecular Identification and Pathogenicity of Fusarium Fungi Causing Potato Dry Rot in Shanxi Province, China" Journal of Fungi 11, no. 12: 835. https://doi.org/10.3390/jof11120835

APA Style

Guo, J., Shi, Y., Chen, X., Du, P., Zhao, Y., & Wang, L. (2025). Molecular Identification and Pathogenicity of Fusarium Fungi Causing Potato Dry Rot in Shanxi Province, China. Journal of Fungi, 11(12), 835. https://doi.org/10.3390/jof11120835

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop